From yogeshp08 at gmail.com  Fri Jun  1 11:56:13 2012
From: yogeshp08 at gmail.com (Yogesh)
Date: Fri, 1 Jun 2012 11:56:13 -0500
Subject: [maker-devel] tblastn Cleanup?
In-Reply-To: <CBDBD0A5.C8CD%carsonhh@gmail.com>
References: <CBDBD0A5.C8CD%carsonhh@gmail.com>
Message-ID: <E782BA7523C145C994B5BE8509009476@gmail.com>

Hi Carson,

Thanks a lot. This is helpful.

Also I wanted to ask how can I follow this up with exonerate polishing. Is there a module in MAKER that can run this separately on my BLAST results?

-Yogesh


On Friday, May 18, 2012 at 9:22 AM, Carson Holt wrote:

> There are several things.  I set several filtering options directly on the BLAST command line.  These are things like maximum intron length, an e-value filter, and simple repeat filtering (called dust filter in NCBI blast and seg filter in WUBLAST).
> 
> I also run repeat masker over the genome first.  This allows simple and complex repeats to be removed before running BLAST (otherwise you get many false alignments).
> 
> Last I filter the results based on percent coverage of the hit to the original database sequence and percent identity.  I think you can set percent identity as a flag in BLAST, but the percent coverage filter is being calculated by MAKER, so to do this outside of MAKER would require that you write your own filtering script to compare the length of the alignment to the length of the sequence in the database.
> 
> I also have an HSP depth overlap filter.  This removes weird low complexity hits that escape repeatmasking.  They show up as multiple HSPs overlapping multiple times in the same region (usually very high numbers like 90 HSPs all 100 bp long in the same region).  I calculate the number of base pairs in the alignment on the hit then divide by the number of base pairs in the query alignment.  If it's greater than 3, I throw the hit out.
> 
> Thanks,
> Carson
> 
> 
> 
> From: Yogesh <yogeshp08 at gmail.com (mailto:yogeshp08 at gmail.com)>
> Date: Tuesday, 15 May, 2012 12:07 PM
> To: <maker-devel at yandell-lab.org (mailto:maker-devel at yandell-lab.org)>
> Subject: [maker-devel] tblastn Cleanup?
> 
> Hello,
> 
> I have a few tblastn alignments with a lot of low quality hits. I have to clean that up. Can you please suggest how Maker pipeline does it? Also can I run it directly on my data without having to go through the whole pipeline?
> 
> Thanks,
> 
> -Yogesh
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120601/71d95d76/attachment.html>

From carsonhh at gmail.com  Fri Jun  1 12:01:50 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 13:01:50 -0400
Subject: [maker-devel] tblastn Cleanup?
In-Reply-To: <E782BA7523C145C994B5BE8509009476@gmail.com>
Message-ID: <CBEE6CF1.D401%carsonhh@gmail.com>

MAKER does this in the GI library file (function --> GI::polish_exonerate).
You might have to do some coding to modify it to work in your own scripts.
It has multiple dependencies on other MAKER library files including
exonerate::splice_info, Widget::exonerate::est2genome, and
Widget::exonerate::protein2genome.

Thanks,
Carson

From:  Yogesh <yogeshp08 at gmail.com>
Date:  Friday, 1 June, 2012 12:56 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] tblastn Cleanup?

 
Hi Carson,

Thanks a lot. This is helpful.

Also I wanted to ask how can I follow this up with exonerate polishing. Is
there a module in MAKER that can run this separately on my BLAST results?

-Yogesh

  

On Friday, May 18, 2012 at 9:22 AM, Carson Holt wrote:
> 
>  
> There are several things.  I set several filtering options directly on the
> BLAST command line.  These are things like maximum intron length, an e-value
> filter, and simple repeat filtering (called dust filter in NCBI blast and seg
> filter in WUBLAST).
> 
> I also run repeat masker over the genome first.  This allows simple and
> complex repeats to be removed before running BLAST (otherwise you get many
> false alignments).
> 
> Last I filter the results based on percent coverage of the hit to the original
> database sequence and percent identity.  I think you can set percent identity
> as a flag in BLAST, but the percent coverage filter is being calculated by
> MAKER, so to do this outside of MAKER would require that you write your own
> filtering script to compare the length of the alignment to the length of the
> sequence in the database.
> 
> I also have an HSP depth overlap filter.  This removes weird low complexity
> hits that escape repeatmasking.  They show up as multiple HSPs overlapping
> multiple times in the same region (usually very high numbers like 90 HSPs all
> 100 bp long in the same region).  I calculate the number of base pairs in the
> alignment on the hit then divide by the number of base pairs in the query
> alignment.  If it's greater than 3, I throw the hit out.
> 
> Thanks,
> Carson
> 
> 
> 
> From:  Yogesh <yogeshp08 at gmail.com>
> Date:  Tuesday, 15 May, 2012 12:07 PM
> To:  <maker-devel at yandell-lab.org>
> Subject:  [maker-devel] tblastn Cleanup?
> 
>  
> Hello,
> 
> I have a few tblastn alignments with a lot of low quality hits. I have to
> clean that up. Can you please suggest how Maker pipeline does it? Also can I
> run it directly on my data without having to go through the whole pipeline?
> 
> Thanks,
> 
> -Yogesh


-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120601/e145c056/attachment.html>

From barry.moore at genetics.utah.edu  Fri Jun  1 13:22:56 2012
From: barry.moore at genetics.utah.edu (Barry Moore)
Date: Fri, 1 Jun 2012 12:22:56 -0600
Subject: [maker-devel] Can maker select a gene model based
	on	#algoritham predicted it
In-Reply-To: <CBEB8E25.D097%carsonhh@gmail.com>
References: <CBEB8E25.D097%carsonhh@gmail.com>
Message-ID: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543




-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120601/1a78f472/attachment.html>

From carsonhh at gmail.com  Fri Jun  1 13:41:53 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 14:41:53 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>
Message-ID: <CBEE8148.D418%carsonhh@gmail.com>

While I could add an option to keep them if there are more than one, the
actual implementation is not as trivial as it seems.  On some organisms like
fungi and oomycetes, the predictions that don't overlap evidence tend to be
similar to each other across predictors, but on other eukaryotes with
difficult and complex intron/exon structure like lamprey or even planaria
about the only time two predictors will produce similar results coorelated
with when there is evidence supporting them, and all the unsupported regions
are messy with weird partial overlaps (sometimes even conflicting reading
frames).  I have a figure in the MAKER2 paper showing how poorly these
algorithms perform on such organisms and how additional evidence based
feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant
non-overlapping proteins recorded at the end of a MAKER run uses a complex
variant of the AED calculation across the alternate predictions to build a
consensus.  So in short it's not exactly as simple as just saying there are
two predictions at a given locus.  It would require some thought (as well as
good documentation), but it could probably be done.

--Carson

From:  Barry Moore <barry.moore at genetics.utah.edu>
Date:  Friday, 1 June, 2012 2:22 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

Carson,

How hard would it be to have maker take an option something like
'require_abinits=2' that would instruct maker to promote predictions that
overlap with (2, 3 or more) other predictions?  Seems like the maker might
have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.
I've got an offline copy of a newer tutorial wiki that is more up to date
than the GMOD version.  It's on a server right now that we've got locked
behind a firewall, but I'm hoping to move that to a public facing server in
the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120601/a3ab059e/attachment.html>

From carsonhh at gmail.com  Fri Jun  1 13:52:46 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 14:52:46 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8543.D43A%carsonhh@gmail.com>
Message-ID: <CBEE8622.D43F%carsonhh@gmail.com>

One idea related to this.  I could have keep_preds be a floating point value
between 0 and 1.  This would then represent a threshold for an internal
MAKER value called the ab-initio AED (it already exists internally deep in
MAKER).  0 would turn keep_preds off (as it does now), 1 would keep
everything (as it does now), and values in between would allow the user to
dial in the degree of consensus among overlapping predictions when
considering them without evidence.  The ab-initio AED already works similar
to AED, with 0 being perfect concordance and 1 being complete discordance.

--Carson



From:  Carson Holt <carsonhh at gmail.com>
Date:  Friday, 1 June, 2012 2:41 PM
To:  Barry Moore <barry.moore at genetics.utah.edu>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

While I could add an option to keep them if there are more than one, the
actual implementation is not as trivial as it seems.  On some organisms like
fungi and oomycetes, the predictions that don't overlap evidence tend to be
similar to each other across predictors, but on other eukaryotes with
difficult and complex intron/exon structure like lamprey or even planaria
about the only time two predictors will produce similar results coorelated
with when there is evidence supporting them, and all the unsupported regions
are messy with weird partial overlaps (sometimes even conflicting reading
frames).  I have a figure in the MAKER2 paper showing how poorly these
algorithms perform on such organisms and how additional evidence based
feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant
non-overlapping proteins recorded at the end of a MAKER run uses a complex
variant of the AED calculation across the alternate predictions to build a
consensus.  So in short it's not exactly as simple as just saying there are
two predictions at a given locus.  It would require some thought (as well as
good documentation), but it could probably be done.

--Carson

From:  Barry Moore <barry.moore at genetics.utah.edu>
Date:  Friday, 1 June, 2012 2:22 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

Carson,

How hard would it be to have maker take an option something like
'require_abinits=2' that would instruct maker to promote predictions that
overlap with (2, 3 or more) other predictions?  Seems like the maker might
have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.
I've got an offline copy of a newer tutorial wiki that is more up to date
than the GMOD version.  It's on a server right now that we've got locked
behind a firewall, but I'm hoping to move that to a public facing server in
the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120601/11d85f8f/attachment.html>

From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 14:06:30 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:06:30 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8148.D418%carsonhh@gmail.com>
References: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>,
	<CBEE8148.D418%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F903@mail02.sbri.org>

Hi Carson,
I agree with you mostly. Its better to have some form of evidence (blast, pfam etc) to call something as a coding gene. Genes that dont have evidence are hard to interpret anyway. But, in the organism we work on (Malaria and Leishmania parasites) we tend to see 100s of genus specific genes. Of course, as you would suspect, their biological/functional significance is not known. They remain as hypothetical proteins for years. But, the researchers still would like to lean towards slight over prediction over under prediction. 

Here is the approach i follow. I collect NON redundant set of proteins from all the related genus to supply as evidence in Maker. I run Augustus and Genemark inside Maker. Also supply gene models from another ab-initio gene prediction suite (automagi-our parasite specific). Automagi in-trun runs 3 algorithm and chooses a consensus gene model.  In short i run 5 gene predictors and chose anything that is predicted by 3. And predictions need NOT overlap to their entire length (this helps us to pull genes that are separated into two due to frame shifts). 

Yesterday, I wrote a small script, that takes all features predicted by MAKER compares them with 3 gffs (of Automagi=3, Augustus, Genemark). I keep_pred=1. It counts if a Maker chosen gene overlaps with prediction from at least 3 of 5 algorithms.

Hi Barry,
Thanks for letting me contribute to the wiki. Most of the edits i thought of is from discussing with Carson. I thought, doing so will save him bit more time from emailing in future. Its possible you got most of it already in latest wiki.  Something like, how to train Genemark. Its really hard to find it in their documentation. I learned it from one of Carson's earlier discussion.  My two cents.

Thanks,
Gowthaman

Carson: Thanks for the great tool. And thanks for every GREATER support. 

  
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 11:41 AM
To: Barry Moore
Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

While I could add an option to keep them if there are more than one, the actual implementation is not as trivial as it seems.  On some organisms like fungi and oomycetes, the predictions that don't overlap evidence tend to be similar to each other across predictors, but on other eukaryotes with difficult and complex intron/exon structure like lamprey or even planaria about the only time two predictors will produce similar results coorelated with when there is evidence supporting them, and all the unsupported regions are messy with weird partial overlaps (sometimes even conflicting reading frames).  I have a figure in the MAKER2 paper showing how poorly these algorithms perform on such organisms and how additional evidence based feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant non-overlapping proteins recorded at the end of a MAKER run uses a complex variant of the AED calculation across the alternate predictions to build a consensus.  So in short it's not exactly as simple as just saying there are two predictions at a given locus.  It would require some thought (as well as good documentation), but it could probably be done.

--Carson

From: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Date: Friday, 1 June, 2012 2:22 PM
To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

It's not an option in exactly the way you are specifying, but there is
something I usually do for annotation that works well.  I run interproscan
or rpsblast on the non_overlapping.proteins.fasta file and select just
those non-overlapping models that have a recognizable protein domain (just
searching the pfam doamin space is more than sufficient).  Then I provide
the selected results to model_gff, and provide the previous maker results
to the maker_gff option with (all reannotation pass options set to 1 and
all analysis options turned off).  This adds models with at least
recognizable domains (as even multiple gene predictors can overpredict in
a similar way).

Attached is a script to help select predictions and upgrade them to models
in GFF3 format.  If you have question let me know.

Thanks,
Carson



On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>> wrote:

Hi Carson,
Thanks for all the help during the long weekend, in spite of that long
drive. I am still trying to imagine that.

I now have maker to consider our own prediction via pred_gff, and use
augustus and gene mark (with our training model). And i was able to use
altest and protein evidences. Maker happily picks one gene model when
there is a overlap between three different predictions. But, when I look
at the gff, it seems like it picks a gene model only when there is an
est/protein evidence. It leaves out some genes even though, they are
predicted by all three algorithms. Of course, keep_pred=1 helps to keep
all the models. This kind of leads to over prediction.

But, I am looking for something in between. And would like to know if
that is possible?
1) Pick a gene model if it has an evidence from (est/prot etc...)
irrespective of how many algorithms predicted it
2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
if that is predicted by at least two algorithms.

Or even simpler:
I have ab-initio predictions from three algorithms, Can I output, those
genes that is supported by at least two of them. I care less about
exactness of gene boundaries.

Thanks,
Gowthaman

PS: With my recent attempts, i learned couple things about maker/other
associated tools that is not documented in gmod-maker wiki. Is it
possible/ok if I add contents to it. I am okay with running it by you
before making it public.

<gff3_preds2models>_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 14:07:18 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:07:18 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8622.D43F%carsonhh@gmail.com>
References: <CBEE8543.D43A%carsonhh@gmail.com>,
	<CBEE8622.D43F%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>

That sounds really good. 

Just wondering what would that float point mean? 

fraction of gene prediction algorithms predicted that region to contain a gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms predicted it?? 
Or 
it just indicates lever of concordance (in maker language) and user has to try different values before settling on one?

Thanks,
gowthaman
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 11:52 AM
To: Barry Moore
Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

One idea related to this.  I could have keep_preds be a floating point value between 0 and 1.  This would then represent a threshold for an internal MAKER value called the ab-initio AED (it already exists internally deep in MAKER).  0 would turn keep_preds off (as it does now), 1 would keep everything (as it does now), and values in between would allow the user to dial in the degree of consensus among overlapping predictions when considering them without evidence.  The ab-initio AED already works similar to AED, with 0 being perfect concordance and 1 being complete discordance.

--Carson



From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Date: Friday, 1 June, 2012 2:41 PM
To: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

While I could add an option to keep them if there are more than one, the actual implementation is not as trivial as it seems.  On some organisms like fungi and oomycetes, the predictions that don't overlap evidence tend to be similar to each other across predictors, but on other eukaryotes with difficult and complex intron/exon structure like lamprey or even planaria about the only time two predictors will produce similar results coorelated with when there is evidence supporting them, and all the unsupported regions are messy with weird partial overlaps (sometimes even conflicting reading frames).  I have a figure in the MAKER2 paper showing how poorly these algorithms perform on such organisms and how additional evidence based feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant non-overlapping proteins recorded at the end of a MAKER run uses a complex variant of the AED calculation across the alternate predictions to build a consensus.  So in short it's not exactly as simple as just saying there are two predictions at a given locus.  It would require some thought (as well as good documentation), but it could probably be done.

--Carson

From: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Date: Friday, 1 June, 2012 2:22 PM
To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

It's not an option in exactly the way you are specifying, but there is
something I usually do for annotation that works well.  I run interproscan
or rpsblast on the non_overlapping.proteins.fasta file and select just
those non-overlapping models that have a recognizable protein domain (just
searching the pfam doamin space is more than sufficient).  Then I provide
the selected results to model_gff, and provide the previous maker results
to the maker_gff option with (all reannotation pass options set to 1 and
all analysis options turned off).  This adds models with at least
recognizable domains (as even multiple gene predictors can overpredict in
a similar way).

Attached is a script to help select predictions and upgrade them to models
in GFF3 format.  If you have question let me know.

Thanks,
Carson



On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>> wrote:

Hi Carson,
Thanks for all the help during the long weekend, in spite of that long
drive. I am still trying to imagine that.

I now have maker to consider our own prediction via pred_gff, and use
augustus and gene mark (with our training model). And i was able to use
altest and protein evidences. Maker happily picks one gene model when
there is a overlap between three different predictions. But, when I look
at the gff, it seems like it picks a gene model only when there is an
est/protein evidence. It leaves out some genes even though, they are
predicted by all three algorithms. Of course, keep_pred=1 helps to keep
all the models. This kind of leads to over prediction.

But, I am looking for something in between. And would like to know if
that is possible?
1) Pick a gene model if it has an evidence from (est/prot etc...)
irrespective of how many algorithms predicted it
2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
if that is predicted by at least two algorithms.

Or even simpler:
I have ab-initio predictions from three algorithms, Can I output, those
genes that is supported by at least two of them. I care less about
exactness of gene boundaries.

Thanks,
Gowthaman

PS: With my recent attempts, i learned couple things about maker/other
associated tools that is not documented in gmod-maker wiki. Is it
possible/ok if I add contents to it. I am okay with running it by you
before making it public.

<gff3_preds2models>_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543







From carsonhh at gmail.com  Fri Jun  1 14:23:59 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 15:23:59 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>
Message-ID: <CBEE8C00.D465%carsonhh@gmail.com>

The metric AED is Annotation Edit Distance (original paper -->
http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
the sensitivity/specificity measure used to quantify the performance of
gene predictors and can be used to measure changes in gene models across
releases, and I further adapted use it for some slightly different purpose
than given in the original paper above.

This is copied from the MAKER2 paper -->
"Given a gene prediction i and a reference j, the base pair level
sensitivity can be calculated using the formula SN = |i?j|/|j|; where
|i?j| represents the number overlapping nucleotides between i and j, and
|j| represents the total number of nucleotides in the reference j.
Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
and accuracy is the average of the two.  Because we are not comparing to a
high quality reference (reference is arbitrary for AED), it is more
correct to refer to the average of sensitivity and specificity as the
congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
distance between i and j, then becomes D = 1-C, with a value of 0
indicating complete agreement of an annotation to the evidence, and values
at or near 1 indicating disagreement or no evidence support."



The ab-initio AED in comparison is the pairwise AED calculated between
each overlapping prediction and then averaged.  Each pair then have a
score representing it's average distance from the overlapping set of
predictions as a whole.  So a value of .1 would be 10% average
incongruency or 90% average congruency.

Thanks,
Carson



On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>That sounds really good.
>
>Just wondering what would that float point mean?
>
>fraction of gene prediction algorithms predicted that region to contain a
>gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>predicted it?? 
>Or 
>it just indicates lever of concordance (in maker language) and user has
>to try different values before settling on one?
>
>Thanks,
>gowthaman
>________________________________________
>From: Carson Holt [carsonhh at gmail.com]
>Sent: Friday, June 01, 2012 11:52 AM
>To: Barry Moore
>Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>One idea related to this.  I could have keep_preds be a floating point
>value between 0 and 1.  This would then represent a threshold for an
>internal MAKER value called the ab-initio AED (it already exists
>internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>1 would keep everything (as it does now), and values in between would
>allow the user to dial in the degree of consensus among overlapping
>predictions when considering them without evidence.  The ab-initio AED
>already works similar to AED, with 0 being perfect concordance and 1
>being complete discordance.
>
>--Carson
>
>
>
>From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Date: Friday, 1 June, 2012 2:41 PM
>To: Barry Moore 
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>, 
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>While I could add an option to keep them if there are more than one, the
>actual implementation is not as trivial as it seems.  On some organisms
>like fungi and oomycetes, the predictions that don't overlap evidence
>tend to be similar to each other across predictors, but on other
>eukaryotes with difficult and complex intron/exon structure like lamprey
>or even planaria about the only time two predictors will produce similar
>results coorelated with when there is evidence supporting them, and all
>the unsupported regions are messy with weird partial overlaps (sometimes
>even conflicting reading frames).  I have a figure in the MAKER2 paper
>showing how poorly these algorithms perform on such organisms and how
>additional evidence based feedback provided by MAKER produces
>dramatically improved results.
>
>The way I get around the issues when choosing the non-redundant
>non-overlapping proteins recorded at the end of a MAKER run uses a
>complex variant of the AED calculation across the alternate predictions
>to build a consensus.  So in short it's not exactly as simple as just
>saying there are two predictions at a given locus.  It would require some
>thought (as well as good documentation), but it could probably be done.
>
>--Carson
>
>From: Barry Moore 
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Date: Friday, 1 June, 2012 2:22 PM
>To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>, 
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>Carson,
>
>How hard would it be to have maker take an option something like
>'require_abinits=2' that would instruct maker to promote predictions that
>overlap with (2, 3 or more) other predictions?  Seems like the maker
>might have all that info in one place at some point already?
>
>Gowthaman, your contributions to the maker tutorial would be most
>welcome.  I've got an offline copy of a newer tutorial wiki that is more
>up to date than the GMOD version.  It's on a server right now that we've
>got locked behind a firewall, but I'm hoping to move that to a public
>facing server in the next week and I'd be happy to give you an account on
>the wiki.
>
>B
>
>On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>
>It's not an option in exactly the way you are specifying, but there is
>something I usually do for annotation that works well.  I run interproscan
>or rpsblast on the non_overlapping.proteins.fasta file and select just
>those non-overlapping models that have a recognizable protein domain (just
>searching the pfam doamin space is more than sufficient).  Then I provide
>the selected results to model_gff, and provide the previous maker results
>to the maker_gff option with (all reannotation pass options set to 1 and
>all analysis options turned off).  This adds models with at least
>recognizable domains (as even multiple gene predictors can overpredict in
>a similar way).
>
>Attached is a script to help select predictions and upgrade them to models
>in GFF3 format.  If you have question let me know.
>
>Thanks,
>Carson
>
>
>
>On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>> wrote:
>
>Hi Carson,
>Thanks for all the help during the long weekend, in spite of that long
>drive. I am still trying to imagine that.
>
>I now have maker to consider our own prediction via pred_gff, and use
>augustus and gene mark (with our training model). And i was able to use
>altest and protein evidences. Maker happily picks one gene model when
>there is a overlap between three different predictions. But, when I look
>at the gff, it seems like it picks a gene model only when there is an
>est/protein evidence. It leaves out some genes even though, they are
>predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>all the models. This kind of leads to over prediction.
>
>But, I am looking for something in between. And would like to know if
>that is possible?
>1) Pick a gene model if it has an evidence from (est/prot etc...)
>irrespective of how many algorithms predicted it
>2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>if that is predicted by at least two algorithms.
>
>Or even simpler:
>I have ab-initio predictions from three algorithms, Can I output, those
>genes that is supported by at least two of them. I care less about
>exactness of gene boundaries.
>
>Thanks,
>Gowthaman
>
>PS: With my recent attempts, i learned couple things about maker/other
>associated tools that is not documented in gmod-maker wiki. Is it
>possible/ok if I add contents to it. I am okay with running it by you
>before making it public.
>
><gff3_preds2models>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>Barry Moore
>Research Scientist
>Dept. of Human Genetics
>University of Utah
>Salt Lake City, UT 84112
>--------------------------------------------
>(801) 585-3543
>
>
>
>





From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 14:28:21 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:28:21 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8C00.D465%carsonhh@gmail.com>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>,
	<CBEE8C00.D465%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F906@mail02.sbri.org>

That sounds really neat. I will read those papers. Thanks for sharing.

Gowthaman
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 12:23 PM
To: Gowthaman Ramasamy; Barry Moore
Cc: maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

The metric AED is Annotation Edit Distance (original paper -->
http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
the sensitivity/specificity measure used to quantify the performance of
gene predictors and can be used to measure changes in gene models across
releases, and I further adapted use it for some slightly different purpose
than given in the original paper above.

This is copied from the MAKER2 paper -->
"Given a gene prediction i and a reference j, the base pair level
sensitivity can be calculated using the formula SN = |i?j|/|j|; where
|i?j| represents the number overlapping nucleotides between i and j, and
|j| represents the total number of nucleotides in the reference j.
Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
and accuracy is the average of the two.  Because we are not comparing to a
high quality reference (reference is arbitrary for AED), it is more
correct to refer to the average of sensitivity and specificity as the
congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
distance between i and j, then becomes D = 1-C, with a value of 0
indicating complete agreement of an annotation to the evidence, and values
at or near 1 indicating disagreement or no evidence support."



The ab-initio AED in comparison is the pairwise AED calculated between
each overlapping prediction and then averaged.  Each pair then have a
score representing it's average distance from the overlapping set of
predictions as a whole.  So a value of .1 would be 10% average
incongruency or 90% average congruency.

Thanks,
Carson



On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>That sounds really good.
>
>Just wondering what would that float point mean?
>
>fraction of gene prediction algorithms predicted that region to contain a
>gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>predicted it??
>Or
>it just indicates lever of concordance (in maker language) and user has
>to try different values before settling on one?
>
>Thanks,
>gowthaman
>________________________________________
>From: Carson Holt [carsonhh at gmail.com]
>Sent: Friday, June 01, 2012 11:52 AM
>To: Barry Moore
>Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>One idea related to this.  I could have keep_preds be a floating point
>value between 0 and 1.  This would then represent a threshold for an
>internal MAKER value called the ab-initio AED (it already exists
>internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>1 would keep everything (as it does now), and values in between would
>allow the user to dial in the degree of consensus among overlapping
>predictions when considering them without evidence.  The ab-initio AED
>already works similar to AED, with 0 being perfect concordance and 1
>being complete discordance.
>
>--Carson
>
>
>
>From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Date: Friday, 1 June, 2012 2:41 PM
>To: Barry Moore
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>,
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>While I could add an option to keep them if there are more than one, the
>actual implementation is not as trivial as it seems.  On some organisms
>like fungi and oomycetes, the predictions that don't overlap evidence
>tend to be similar to each other across predictors, but on other
>eukaryotes with difficult and complex intron/exon structure like lamprey
>or even planaria about the only time two predictors will produce similar
>results coorelated with when there is evidence supporting them, and all
>the unsupported regions are messy with weird partial overlaps (sometimes
>even conflicting reading frames).  I have a figure in the MAKER2 paper
>showing how poorly these algorithms perform on such organisms and how
>additional evidence based feedback provided by MAKER produces
>dramatically improved results.
>
>The way I get around the issues when choosing the non-redundant
>non-overlapping proteins recorded at the end of a MAKER run uses a
>complex variant of the AED calculation across the alternate predictions
>to build a consensus.  So in short it's not exactly as simple as just
>saying there are two predictions at a given locus.  It would require some
>thought (as well as good documentation), but it could probably be done.
>
>--Carson
>
>From: Barry Moore
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Date: Friday, 1 June, 2012 2:22 PM
>To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>,
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>Carson,
>
>How hard would it be to have maker take an option something like
>'require_abinits=2' that would instruct maker to promote predictions that
>overlap with (2, 3 or more) other predictions?  Seems like the maker
>might have all that info in one place at some point already?
>
>Gowthaman, your contributions to the maker tutorial would be most
>welcome.  I've got an offline copy of a newer tutorial wiki that is more
>up to date than the GMOD version.  It's on a server right now that we've
>got locked behind a firewall, but I'm hoping to move that to a public
>facing server in the next week and I'd be happy to give you an account on
>the wiki.
>
>B
>
>On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>
>It's not an option in exactly the way you are specifying, but there is
>something I usually do for annotation that works well.  I run interproscan
>or rpsblast on the non_overlapping.proteins.fasta file and select just
>those non-overlapping models that have a recognizable protein domain (just
>searching the pfam doamin space is more than sufficient).  Then I provide
>the selected results to model_gff, and provide the previous maker results
>to the maker_gff option with (all reannotation pass options set to 1 and
>all analysis options turned off).  This adds models with at least
>recognizable domains (as even multiple gene predictors can overpredict in
>a similar way).
>
>Attached is a script to help select predictions and upgrade them to models
>in GFF3 format.  If you have question let me know.
>
>Thanks,
>Carson
>
>
>
>On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>> wrote:
>
>Hi Carson,
>Thanks for all the help during the long weekend, in spite of that long
>drive. I am still trying to imagine that.
>
>I now have maker to consider our own prediction via pred_gff, and use
>augustus and gene mark (with our training model). And i was able to use
>altest and protein evidences. Maker happily picks one gene model when
>there is a overlap between three different predictions. But, when I look
>at the gff, it seems like it picks a gene model only when there is an
>est/protein evidence. It leaves out some genes even though, they are
>predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>all the models. This kind of leads to over prediction.
>
>But, I am looking for something in between. And would like to know if
>that is possible?
>1) Pick a gene model if it has an evidence from (est/prot etc...)
>irrespective of how many algorithms predicted it
>2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>if that is predicted by at least two algorithms.
>
>Or even simpler:
>I have ab-initio predictions from three algorithms, Can I output, those
>genes that is supported by at least two of them. I care less about
>exactness of gene boundaries.
>
>Thanks,
>Gowthaman
>
>PS: With my recent attempts, i learned couple things about maker/other
>associated tools that is not documented in gmod-maker wiki. Is it
>possible/ok if I add contents to it. I am okay with running it by you
>before making it public.
>
><gff3_preds2models>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>Barry Moore
>Research Scientist
>Dept. of Human Genetics
>University of Utah
>Salt Lake City, UT 84112
>--------------------------------------------
>(801) 585-3543
>
>
>
>





From barry.moore at genetics.utah.edu  Fri Jun  1 15:39:25 2012
From: barry.moore at genetics.utah.edu (Barry Moore)
Date: Fri, 1 Jun 2012 14:39:25 -0600
Subject: [maker-devel] Can maker select a gene model based on
	#algoritham predicted it
In-Reply-To: <CBEE8C00.D465%carsonhh@gmail.com>
References: <CBEE8C00.D465%carsonhh@gmail.com>
Message-ID: <B876750E-47CD-4DEC-81F1-5E5EC5F6B754@genetics.utah.edu>

I like this a lot Carson - for two reasons:  First, it sounds like it's fairly easy to implement with that data and code that already exists within MAKER! And second it sounds like the right way to be doing this - the more the abintis agree the more likely to they are to be correct.

B

On Jun 1, 2012, at 1:23 PM, Carson Holt wrote:

> The metric AED is Annotation Edit Distance (original paper -->
> http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
> the sensitivity/specificity measure used to quantify the performance of
> gene predictors and can be used to measure changes in gene models across
> releases, and I further adapted use it for some slightly different purpose
> than given in the original paper above.
> 
> This is copied from the MAKER2 paper -->
> "Given a gene prediction i and a reference j, the base pair level
> sensitivity can be calculated using the formula SN = |i?j|/|j|; where
> |i?j| represents the number overlapping nucleotides between i and j, and
> |j| represents the total number of nucleotides in the reference j.
> Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
> and accuracy is the average of the two.  Because we are not comparing to a
> high quality reference (reference is arbitrary for AED), it is more
> correct to refer to the average of sensitivity and specificity as the
> congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
> distance between i and j, then becomes D = 1-C, with a value of 0
> indicating complete agreement of an annotation to the evidence, and values
> at or near 1 indicating disagreement or no evidence support."
> 
> 
> 
> The ab-initio AED in comparison is the pairwise AED calculated between
> each overlapping prediction and then averaged.  Each pair then have a
> score representing it's average distance from the overlapping set of
> predictions as a whole.  So a value of .1 would be 10% average
> incongruency or 90% average congruency.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> That sounds really good.
>> 
>> Just wondering what would that float point mean?
>> 
>> fraction of gene prediction algorithms predicted that region to contain a
>> gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>> predicted it?? 
>> Or 
>> it just indicates lever of concordance (in maker language) and user has
>> to try different values before settling on one?
>> 
>> Thanks,
>> gowthaman
>> ________________________________________
>> From: Carson Holt [carsonhh at gmail.com]
>> Sent: Friday, June 01, 2012 11:52 AM
>> To: Barry Moore
>> Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> One idea related to this.  I could have keep_preds be a floating point
>> value between 0 and 1.  This would then represent a threshold for an
>> internal MAKER value called the ab-initio AED (it already exists
>> internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>> 1 would keep everything (as it does now), and values in between would
>> allow the user to dial in the degree of consensus among overlapping
>> predictions when considering them without evidence.  The ab-initio AED
>> already works similar to AED, with 0 being perfect concordance and 1
>> being complete discordance.
>> 
>> --Carson
>> 
>> 
>> 
>> From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>> Date: Friday, 1 June, 2012 2:41 PM
>> To: Barry Moore 
>> <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>> Cc: Gowthaman Ramasamy
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>>, 
>> "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
>> <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> While I could add an option to keep them if there are more than one, the
>> actual implementation is not as trivial as it seems.  On some organisms
>> like fungi and oomycetes, the predictions that don't overlap evidence
>> tend to be similar to each other across predictors, but on other
>> eukaryotes with difficult and complex intron/exon structure like lamprey
>> or even planaria about the only time two predictors will produce similar
>> results coorelated with when there is evidence supporting them, and all
>> the unsupported regions are messy with weird partial overlaps (sometimes
>> even conflicting reading frames).  I have a figure in the MAKER2 paper
>> showing how poorly these algorithms perform on such organisms and how
>> additional evidence based feedback provided by MAKER produces
>> dramatically improved results.
>> 
>> The way I get around the issues when choosing the non-redundant
>> non-overlapping proteins recorded at the end of a MAKER run uses a
>> complex variant of the AED calculation across the alternate predictions
>> to build a consensus.  So in short it's not exactly as simple as just
>> saying there are two predictions at a given locus.  It would require some
>> thought (as well as good documentation), but it could probably be done.
>> 
>> --Carson
>> 
>> From: Barry Moore 
>> <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>> Date: Friday, 1 June, 2012 2:22 PM
>> To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>> Cc: Gowthaman Ramasamy
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>>, 
>> "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
>> <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> Carson,
>> 
>> How hard would it be to have maker take an option something like
>> 'require_abinits=2' that would instruct maker to promote predictions that
>> overlap with (2, 3 or more) other predictions?  Seems like the maker
>> might have all that info in one place at some point already?
>> 
>> Gowthaman, your contributions to the maker tutorial would be most
>> welcome.  I've got an offline copy of a newer tutorial wiki that is more
>> up to date than the GMOD version.  It's on a server right now that we've
>> got locked behind a firewall, but I'm hoping to move that to a public
>> facing server in the next week and I'd be happy to give you an account on
>> the wiki.
>> 
>> B
>> 
>> On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>> 
>> It's not an option in exactly the way you are specifying, but there is
>> something I usually do for annotation that works well.  I run interproscan
>> or rpsblast on the non_overlapping.proteins.fasta file and select just
>> those non-overlapping models that have a recognizable protein domain (just
>> searching the pfam doamin space is more than sufficient).  Then I provide
>> the selected results to model_gff, and provide the previous maker results
>> to the maker_gff option with (all reannotation pass options set to 1 and
>> all analysis options turned off).  This adds models with at least
>> recognizable domains (as even multiple gene predictors can overpredict in
>> a similar way).
>> 
>> Attached is a script to help select predictions and upgrade them to models
>> in GFF3 format.  If you have question let me know.
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>> wrote:
>> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
>> 
>> <gff3_preds2models>_______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> Barry Moore
>> Research Scientist
>> Dept. of Human Genetics
>> University of Utah
>> Salt Lake City, UT 84112
>> --------------------------------------------
>> (801) 585-3543
>> 
>> 
>> 
>> 
> 
> 

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543




-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120601/c444140d/attachment.html>

From weckalba at asu.edu  Mon Jun  4 12:41:14 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Mon, 4 Jun 2012 10:41:14 -0700
Subject: [maker-devel] question regarding alternate splicing annotation
Message-ID: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>

Hi Maker developers,

I am trying to expand on some current annotations that are already quite
good, but only predict protein coding sequence and one isoform per gene, to
add UTRs and alternative splice forms from cufflinks data.  To do this I
put the current annotations in both the model_gff and pred_gff field, plus
the cufflinks gff3 for the ests (as I noticed was suggested in a previous
email).  I've left everything else as default, except changing
alt_splice=1. I am watching the progress of the *.gff.ann files, but I'm
not noticing alternate splicing being added, while UTRs are being picked up
(exons being added, etc.).  This is a vertebrate genome, so run times are
fairly long and I just wanted to double check if I wasn't missing
something.  Will maker go back through a second step to annotate
alternative splicing?  Or should I be trying something a little different.

Thanks,

Walter
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120604/80ac7225/attachment.html>

From carsonhh at gmail.com  Mon Jun  4 13:02:19 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Mon, 04 Jun 2012 14:02:19 -0400
Subject: [maker-devel] question regarding alternate splicing annotation
In-Reply-To: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>
Message-ID: <CBF26EB9.D534%carsonhh@gmail.com>

Using GFF3 pass-through options alone won't allow for the alternate splice
prediction to work.  You have to also allow gene predictors like SNAP and
Augustus to run.  MAKER uses mutually exclusive EST data to produce separate
hint files in some cases that can produce alternate splice forms from the ab
initio predictors.  The EST evidence must be very long in general or they
will not produce alternate forms.  These alternate splice model can then
compete against your existing gene models based on scoring statistics MAKER
produces and potentially replace them.  This may not be what you want
though.  The alternate splice prediction works better De Novo than for
re-annotation.

The alternate splicing option still needs more work, but I would appreciate
any feedback.

Thanks,
Carson




From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Monday, 4 June, 2012 1:41 PM
To:  <maker-devel at yandell-lab.org>
Subject:  [maker-devel] question regarding alternate splicing annotation

Hi Maker developers,

I am trying to expand on some current annotations that are already quite
good, but only predict protein coding sequence and one isoform per gene, to
add UTRs and alternative splice forms from cufflinks data.  To do this I put
the current annotations in both the model_gff andusing the gff_field, plus
the cufflinks gff3 for the ests (as I noticed was suggested in a previous
email).  I've left everything else as default, except changing alt_splice=1.
I am watching the progress of the *.gff.ann files, but I'm not noticing
alternate splicing being added, while UTRs are being picked up (exons being
added, etc.).  This is a vertebrate genome, so run times are fairly long and
I just wanted to double check if I wasn't missing something.  Will maker go
back through a second step to annotate alternative splicing?  Or should I be
trying something a little different.

Thanks,

Walter
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120604/01844803/attachment.html>

From weckalba at asu.edu  Mon Jun  4 13:23:18 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Mon, 4 Jun 2012 11:23:18 -0700
Subject: [maker-devel] question regarding alternate splicing annotation
In-Reply-To: <CBF26EB9.D534%carsonhh@gmail.com>
References: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>
	<CBF26EB9.D534%carsonhh@gmail.com>
Message-ID: <CANRPJSfXK1Py7297bTg3_nQXuUkce4c0WueSM_iYA0MLvXP_OQ@mail.gmail.com>

Hi Carson,

Thanks for the quick reply.  I have already trained SNAP and Augustus based
on the de novo assembly from the same RNA-seq data used to generate the
cufflinks annotations.  Those SNAP and Augustus predictions were part of my
initial annotation, along with the de novo assembled transcripts, previous
reference annotations, and related species protein alignments.  I had
broken this up because of run time issues, and thought it might speed
things along.  I will switch gears to add in the SNAP and Augustus ab
initio predictions.

As you might infer, I have a great deal of formats this transcript data
could come in (ie outputs from cufflinks for each sample, cuffmerge,
tophat, trinity, or raw).  Do you have any suggestions for what might be a
good balance between speed and completeness?  I also can not for life of me
get Maker install on our cluster, but I do have Augustus and SNAP installed
there.  I have a massive amount of RNA-seq data I'm trying to incorporate,
so I'm confident plenty of alternative splicing could be found, but I'm
hitting time issues due to the scale (ie four day wall limit on the cluster
and only having an 8-core in house).

I've tried other programs to do this, but obviously cufflinks gives you way
too much, and I'm finding EVM, while fast, is too happy to shorten gene
models based on partial transcript evidence, which requires way more manual
correction than we are capable of doing.

I'll start with just letting Maker run SNAP and Augustus, and let you know
how it goes.

Walter


On 4 June 2012 11:02, Carson Holt <carsonhh at gmail.com> wrote:

> Using GFF3 pass-through options alone won't allow for the alternate splice
> prediction to work.  You have to also allow gene predictors like SNAP and
> Augustus to run.  MAKER uses mutually exclusive EST data to produce
> separate hint files in some cases that can produce alternate splice forms
> from the ab initio predictors.  The EST evidence must be very long in
> general or they will not produce alternate forms.  These alternate splice
> model can then compete against your existing gene models based on scoring
> statistics MAKER produces and potentially replace them.  This may not be
> what you want though.  The alternate splice prediction works better De Novo
> than for re-annotation.
>
> The alternate splicing option still needs more work, but I would
> appreciate any feedback.
>
> Thanks,
> Carson
>
>
>
>
> From: Walter Eckalbar <weckalba at asu.edu>
> Date: Monday, 4 June, 2012 1:41 PM
> To: <maker-devel at yandell-lab.org>
> Subject: [maker-devel] question regarding alternate splicing annotation
>
> Hi Maker developers,
>
> I am trying to expand on some current annotations that are already quite
> good, but only predict protein coding sequence and one isoform per gene, to
> add UTRs and alternative splice forms from cufflinks data.  To do this I
> put the current annotations in both the model_gff andusing the gff_field,
> plus the cufflinks gff3 for the ests (as I noticed was suggested in a
> previous email).  I've left everything else as default, except changing
> alt_splice=1. I am watching the progress of the *.gff.ann files, but I'm
> not noticing alternate splicing being added, while UTRs are being picked up
> (exons being added, etc.).  This is a vertebrate genome, so run times are
> fairly long and I just wanted to double check if I wasn't missing
> something.  Will maker go back through a second step to annotate
> alternative splicing?  Or should I be trying something a little different.
>
> Thanks,
>
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120604/7e44220c/attachment.html>

From jrliberto at yahoo.com  Wed Jun  6 13:22:46 2012
From: jrliberto at yahoo.com (Jennifer Liberto)
Date: Wed, 6 Jun 2012 11:22:46 -0700 (PDT)
Subject: [maker-devel] MAKER output concerns
Message-ID: <1339006966.41760.YahooMailNeo@web110112.mail.gq1.yahoo.com>

To whom this may concern,
?
I am brand new to MAKER and I am concerned about the output
files that I am receiving.? My
partner and I were able to run the dpp test with no errors, all the files and
directories were accounted for.? However, when we tried to run it on our own small dataset of 5 genes,
and a surfperch genome, we were missing 2 files in the output of every contig:
?
Snig2_XXXXXXX.maker.proteins.fasta
Snig2_XXXXXXX.maker.transcripts.fasta
?
When I look at the run log for each of the contigs, I see that
blastx, blastn, tblastx, augustus, snap, and repeatrunner were called but not
exonerate; I have attached a sample run log with this post. Also, our gff files
contain only short 52 bp repeat sequences (I have attached one of these here as
well in a .txt format) and looks nothing like the gff file we received in out
dpp test.? If you could give any
pointers or hints as to why we are not receiving the two files, why exonerate
is not being called, and why our gff files contain only uniformly small repeat
sequences, the help would be greatly appreciated.? 
?
Thank you for your time,
Jennifer Liberto
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120606/3394c6ed/attachment.html>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: run.log
Type: application/octet-stream
Size: 5078 bytes
Desc: not available
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120606/3394c6ed/attachment.obj>
-------------- next part --------------
An embedded and charset-unspecified text was scrubbed...
Name: Snig2_1983881.gff.txt
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120606/3394c6ed/attachment.txt>

From carsonhh at gmail.com  Wed Jun  6 13:39:42 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 06 Jun 2012 14:39:42 -0400
Subject: [maker-devel] MAKER output concerns
In-Reply-To: <1339006966.41760.YahooMailNeo@web110112.mail.gq1.yahoo.com>
Message-ID: <CBF51A5C.D620%carsonhh@gmail.com>

Hi Jennifer,

The contig you ran with was only 52 bp in length and contained only
repetitive sequence.  Exonerate only runs if there are BLAST results that
need polishing, which there weren't.
The Snig2_XXXXXXX.maker.proteins.fasta and
Snig2_XXXXXXX.maker.transcripts.fasta were not produced because there were
no proteins or transcripts to report.

In general running on sequence shorter than 10,000 bp isn't useful.  This is
because programs like SNAP and Augustus need sequence flanking the actual
gene to make their calls, and with intron/exon structure you are unlikely to
fully capture a gene (end to end) at random in under 10kb for many
eukaryotic organisms.

If you are trying to use raw reads, you will need to assemble them first
before running MAKER.  Let us know specifically what you are trying to do,
and we can give you pointers on how to proceed.

Thanks,
Carson



From:  Jennifer Liberto <jrliberto at yahoo.com>
Reply-To:  Jennifer Liberto <jrliberto at yahoo.com>
Date:  Wednesday, 6 June, 2012 2:22 PM
To:  "maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  [maker-devel] MAKER output concerns

To whom this may concern,
 
I am brand new to MAKER and I am concerned about the output files that I am
receiving.  My partner and I were able to run the dpp test with no errors,
all the files and directories were accounted for. However, when we tried to
run it on our own small dataset of 5 genes, and a surfperch genome, we were
missing 2 files in the output of every contig:
 
Snig2_XXXXXXX.maker.proteins.fasta
Snig2_XXXXXXX.maker.transcripts.fasta
 
When I look at the run log for each of the contigs, I see that blastx,
blastn, tblastx, augustus, snap, and repeatrunner were called but not
exonerate; I have attached a sample run log with this post. Also, our gff
files contain only short 52 bp repeat sequences (I have attached one of
these here as well in a .txt format) and looks nothing like the gff file we
received in out dpp test.  If you could give any pointers or hints as to why
we are not receiving the two files, why exonerate is not being called, and
why our gff files contain only uniformly small repeat sequences, the help
would be greatly appreciated.
 
Thank you for your time,
Jennifer Liberto
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120606/237aa6e6/attachment.html>

From gowthaman.ramasamy at seattlebiomed.org  Thu Jun  7 08:36:38 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Thu, 7 Jun 2012 06:36:38 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <CBF61973.D683%carson.holt@oicr.on.ca>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>,
	<CBF61973.D683%carson.holt@oicr.on.ca>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F928@mail02.sbri.org>

Thats a very nice catch. I will adjust parent to Parent and try. 

Its nice idea to run maker first with prok. mode. I will keep that in mind.

Thanks,
Gowtham

_____________________________
From: Carson Holt [Carson.Holt at oicr.on.ca]
Sent: Thursday, June 07, 2012 6:28 AM
To: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: GFF3 file format not accepted by pred_gff options

You have parent= instead of Parent=.  In GFF3, attribute tags are case
sensitive.  Those starting with uppercase letters represent reserved
words, and all others represent ad hoc tags.
The modencode validator would not check parent= for validity because it
sees it as an ad hoc tag (thus not producing an error).

Try changing parent= to some invalid value and compare with what you get
when Parent= is set to an invalid value in the modencode validator, and
you will see what I mean.


The fixed version is attached.


Also the genemark_gtf2gff script was made for converting the GeneMark-ES
output, so I'm not surprised it didn't work on the prokaryote version, but
you should
be fine just by fixing the parent= tag on the conversion you made.  You
could also have run MAKER once in prokaryote mode with the prokaryotic
parameter file to get it to produce a GFF3 for you.

Thanks,
Carson




On 12-06-06 9:53 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Carson,
>As I wrote to you earlier, I was able to successfully create a gff3 file
>from our predictor to be used in pred_gff option. But, now, I am trying
>to add another abinitio prediction (GeneMark-prokaryotic).  For some
>weird reasons,  I would like to run GeneMark-prokaryote and
>Augustus-eukaryotes. So, i am not able to run both inside maker.
>
>But, that gff3 was not used by pred_gff. I tried to make it as similar to
>the working gffs as possible. Still in vein. Would you mind having look
>at the attached gff file. I even run it by gff validator at
>modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All
>passed.
>
>In the maker produced gff i just see one pair of match-matchpart that
>corresponds to entire supercontig from GeneMark. Not corresponding to
>genes.
>
>I really appreciate your time and help.
>
>Gowthaman




From gowthaman.ramasamy at seattlebiomed.org  Wed Jun  6 20:53:20 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Wed, 6 Jun 2012 18:53:20 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>

Hi Carson,
As I wrote to you earlier, I was able to successfully create a gff3 file from our predictor to be used in pred_gff option. But, now, I am trying to add another abinitio prediction (GeneMark-prokaryotic).  For some weird reasons,  I would like to run GeneMark-prokaryote and Augustus-eukaryotes. So, i am not able to run both inside maker.

But, that gff3 was not used by pred_gff. I tried to make it as similar to the working gffs as possible. Still in vein. Would you mind having look at the attached gff file. I even run it by gff validator at modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All passed.

In the maker produced gff i just see one pair of match-matchpart that corresponds to entire supercontig from GeneMark. Not corresponding to genes.

I really appreciate your time and help. 

Gowthaman

-------------- next part --------------
A non-text attachment was scrubbed...
Name: Contig23.GMprok.gff
Type: application/octet-stream
Size: 291755 bytes
Desc: Contig23.GMprok.gff
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120606/2c5bf543/attachment.obj>

From gowthaman.ramasamy at seattlebiomed.org  Wed Jun  6 20:59:33 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Wed, 6 Jun 2012 18:59:33 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F927@mail02.sbri.org>

Carson,
I also tried to use maker's genemart_gtf2gff script to create valid gff3 file. I seem to have problems with it too.
Here is what I see...

-bash-3.2$ ~/software/maker/bin/genemark_gtf2gff3 CrfA_v13.3.5_supercontigs.gff2
ERROR: Cannot understand format
expecting -> gene_id "xxxx"; transcript_id "xxxx";

Attached is first 10000 lines of the GTF output from genemark.

Any help/pointers will be really appreciated.

Thanks again,
Gowthaman
________________________________________
From: Gowthaman Ramasamy
Sent: Wednesday, June 06, 2012 6:53 PM
To: Carson Holt; maker-devel at yandell-lab.org
Subject: GFF3 file format not accepted by pred_gff options

Hi Carson,
As I wrote to you earlier, I was able to successfully create a gff3 file from our predictor to be used in pred_gff option. But, now, I am trying to add another abinitio prediction (GeneMark-prokaryotic).  For some weird reasons,  I would like to run GeneMark-prokaryote and Augustus-eukaryotes. So, i am not able to run both inside maker.

But, that gff3 was not used by pred_gff. I tried to make it as similar to the working gffs as possible. Still in vein. Would you mind having look at the attached gff file. I even run it by gff validator at modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All passed.

In the maker produced gff i just see one pair of match-matchpart that corresponds to entire supercontig from GeneMark. Not corresponding to genes.

I really appreciate your time and help.

Gowthaman
-------------- next part --------------
A non-text attachment was scrubbed...
Name: tiny_genemark-prok.gtf.bz2
Type: application/x-bzip2
Size: 209923 bytes
Desc: tiny_genemark-prok.gtf.bz2
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120606/ace7deee/attachment.bin>

From Carson.Holt at oicr.on.ca  Thu Jun  7 08:28:06 2012
From: Carson.Holt at oicr.on.ca (Carson Holt)
Date: Thu, 7 Jun 2012 13:28:06 +0000
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
Message-ID: <CBF61973.D683%carson.holt@oicr.on.ca>

You have parent= instead of Parent=.  In GFF3, attribute tags are case
sensitive.  Those starting with uppercase letters represent reserved
words, and all others represent ad hoc tags.
The modencode validator would not check parent= for validity because it
sees it as an ad hoc tag (thus not producing an error).

Try changing parent= to some invalid value and compare with what you get
when Parent= is set to an invalid value in the modencode validator, and
you will see what I mean.


The fixed version is attached.


Also the genemark_gtf2gff script was made for converting the GeneMark-ES
output, so I'm not surprised it didn't work on the prokaryote version, but
you should 
be fine just by fixing the parent= tag on the conversion you made.  You
could also have run MAKER once in prokaryote mode with the prokaryotic
parameter file to get it to produce a GFF3 for you.

Thanks,
Carson




On 12-06-06 9:53 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Carson,
>As I wrote to you earlier, I was able to successfully create a gff3 file
>from our predictor to be used in pred_gff option. But, now, I am trying
>to add another abinitio prediction (GeneMark-prokaryotic).  For some
>weird reasons,  I would like to run GeneMark-prokaryote and
>Augustus-eukaryotes. So, i am not able to run both inside maker.
>
>But, that gff3 was not used by pred_gff. I tried to make it as similar to
>the working gffs as possible. Still in vein. Would you mind having look
>at the attached gff file. I even run it by gff validator at
>modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All
>passed.
>
>In the maker produced gff i just see one pair of match-matchpart that
>corresponds to entire supercontig from GeneMark. Not corresponding to
>genes.
>
>I really appreciate your time and help.
>
>Gowthaman

-------------- next part --------------
A non-text attachment was scrubbed...
Name: Contig23.GMprok.gff
Type: application/octet-stream
Size: 291755 bytes
Desc: Contig23.GMprok.gff
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120607/685ec79a/attachment.obj>

From weckalba at asu.edu  Thu Jun  7 15:40:20 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Thu, 7 Jun 2012 13:40:20 -0700
Subject: [maker-devel] cluster error running maker
Message-ID: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>

Hi everyone,

I have been retrying installing maker on our university cluster, everything
seems to install correctly, but when I run maker I find the following error
message:

Ran into unknown state (hex char: 29) at
/home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
A data structure will be created for you at:
/scratch/weckalba/Maker/genome.maker.output/genome_datastore

To access files for individual sequences use the datastore index:
/scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log

DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.


Seems to have something to do with permissions and DBD::SQLite.  I
installed DBD::SQLite on my own home directories and routed the perl path
to it (and other CPAN installs in the same directories).

I was wondering if anyone ever encountered this before and knew a work
around.  The admins for our cluster are unfortunately very slow to respond.

Thanks

Walter
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120607/b3459baf/attachment.html>

From carsonhh at gmail.com  Fri Jun  8 07:45:42 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 08 Jun 2012 08:45:42 -0400
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>
Message-ID: <CBF76A49.D740%carsonhh@gmail.com>

Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to Volker
Brendel at Iowa State for this one.

> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
> 646785-and-handle-Hex29.patch
> 
> This adds to previously posted 646785 patch.  At least on some systems,
> commands can contain "(" and ")".  See comments in the code.
> 

Download Proc-ProcessTable-0.45 to reinstall before applying the patch.


I'll also send you a link in a separate e-mail to download a maker 2.26 test
version where I've replaced Proc::ProcessTable with a different module
because of the failure on some systems.

Thanks,
Carson




From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Thursday, 7 June, 2012 4:40 PM
To:  <maker-devel at yandell-lab.org>
Subject:  [maker-devel] cluster error running maker

Hi everyone,

I have been retrying installing maker on our university cluster, everything
seems to install correctly, but when I run maker I find the following error
message:

Ran into unknown state (hex char: 29) at
/home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
A data structure will be created for you at:
/scratch/weckalba/Maker/genome.maker.output/genome_datastore

To access files for individual sequences use the datastore index:
/scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.lo
g

DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.


Seems to have something to do with permissions and DBD::SQLite.  I installed
DBD::SQLite on my own home directories and routed the perl path to it (and
other CPAN installs in the same directories).

I was wondering if anyone ever encountered this before and knew a work
around.  The admins for our cluster are unfortunately very slow to respond.

Thanks

Walter
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120608/87256d43/attachment.html>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: 646785-and-handle-Hex29.patch
Type: application/octet-stream
Size: 4618 bytes
Desc: not available
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120608/87256d43/attachment.obj>

From weckalba at asu.edu  Fri Jun  8 11:15:38 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Fri, 8 Jun 2012 09:15:38 -0700
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CBF76A49.D740%carsonhh@gmail.com>
References: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>
	<CBF76A49.D740%carsonhh@gmail.com>
Message-ID: <CANRPJScgVoFkm2-fO5Y7MUyFngSgMjN71fPJL3tfr5k-dPDDYA@mail.gmail.com>

Hi Carson,

I will try this as well to get my 2.25 version of maker running.

I have hit another error on my local machine.  This only seems to come up
with scaffolds > 5Mbp.  And am hitting this same error with version 2.10
and 2.25.

  [0] = Make
  [1] = 0
  [2] = additional
  [3] = prediction
  [4] = runs.
dead in Widget::augustus::parse_gene unknown feature type:additional
ERROR: Failed while preparing ab-inits
ERROR: Chunk failed at level:4, tier_type:0
FAILED CONTIG:GL343198.1

Do you have a suggestion for this one?

Thanks for all your help,

Walter


On 8 June 2012 05:45, Carson Holt <carsonhh at gmail.com> wrote:

> Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to
> Volker Brendel at Iowa State for this one.
>
> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
> 646785-and-handle-Hex29.patch
>
> This adds to previously posted 646785 patch.  At least on some
> systems, commands can contain "(" and ")".  See comments in the code.
>
>
> Download Proc-ProcessTable-0.45 to reinstall before applying the patch.
>
>
> I'll also send you a link in a separate e-mail to download a maker 2.26
> test version where I've replaced Proc::ProcessTable with a different module
> because of the failure on some systems.
>
> Thanks,
> Carson
>
>
>
>
> From: Walter Eckalbar <weckalba at asu.edu>
> Date: Thursday, 7 June, 2012 4:40 PM
> To: <maker-devel at yandell-lab.org>
> Subject: [maker-devel] cluster error running maker
>
> Hi everyone,
>
> I have been retrying installing maker on our university cluster,
> everything seems to install correctly, but when I run maker I find the
> following error message:
>
> Ran into unknown state (hex char: 29) at
> /home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
> A data structure will be created for you at:
> /scratch/weckalba/Maker/genome.maker.output/genome_datastore
>
> To access files for individual sequences use the datastore index:
>
> /scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log
>
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
> DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.
>
>
> Seems to have something to do with permissions and DBD::SQLite.  I
> installed DBD::SQLite on my own home directories and routed the perl path
> to it (and other CPAN installs in the same directories).
>
> I was wondering if anyone ever encountered this before and knew a work
> around.  The admins for our cluster are unfortunately very slow to respond.
>
> Thanks
>
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120608/f5a6a74f/attachment.html>

From carsonhh at gmail.com  Fri Jun  8 11:28:36 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 08 Jun 2012 12:28:36 -0400
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CANRPJScgVoFkm2-fO5Y7MUyFngSgMjN71fPJL3tfr5k-dPDDYA@mail.gmail.com>
Message-ID: <CBF79DE3.D7AE%carsonhh@gmail.com>

That is one I haven't seen before (including on large multi-megabase contigs
).

Right before the error, it will say the location of the file that is being
read.  It will terminate in  ".augustus".  Could you send that file to me?
Augustus seems to be producing something weird in it's output.

Thanks,
Carson



From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Friday, 8 June, 2012 12:15 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] cluster error running maker

Hi Carson,

I will try this as well to get my 2.25 version of maker running.

I have hit another error on my local machine.  This only seems to come up
with scaffolds > 5Mbp.  And am hitting this same error with version 2.10 and
2.25.

  [0] = Make
  [1] = 0
  [2] = additional
  [3] = prediction
  [4] = runs.
dead in Widget::augustus::parse_gene unknown feature type:additional
ERROR: Failed while preparing ab-inits
ERROR: Chunk failed at level:4, tier_type:0
FAILED CONTIG:GL343198.1

Do you have a suggestion for this one?

Thanks for all your help,

Walter


On 8 June 2012 05:45, Carson Holt <carsonhh at gmail.com> wrote:
> Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to Volker
> Brendel at Iowa State for this one.
> 
>> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
>> 646785-and-handle-Hex29.patch
>> 
>> This adds to previously posted 646785 patch.  At least on some systems,
>> commands can contain "(" and ")".  See comments in the code.
>> 
> 
> Download Proc-ProcessTable-0.45 to reinstall before applying the patch.
> 
> 
> I'll also send you a link in a separate e-mail to download a maker 2.26 test
> version where I've replaced Proc::ProcessTable with a different module because
> of the failure on some systems.
> 
> Thanks,
> Carson
> 
> 
> 
> 
> From:  Walter Eckalbar <weckalba at asu.edu>
> Date:  Thursday, 7 June, 2012 4:40 PM
> To:  <maker-devel at yandell-lab.org>
> Subject:  [maker-devel] cluster error running maker
> 
> Hi everyone,
> 
> I have been retrying installing maker on our university cluster, everything
> seems to install correctly, but when I run maker I find the following error
> message:
> 
> Ran into unknown state (hex char: 29) at
> /home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
> A data structure will be created for you at:
> /scratch/weckalba/Maker/genome.maker.output/genome_datastore
> 
> To access files for individual sequences use the datastore index:
> /scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log
> 
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
> DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.
> 
> 
> Seems to have something to do with permissions and DBD::SQLite.  I installed
> DBD::SQLite on my own home directories and routed the perl path to it (and
> other CPAN installs in the same directories).
> 
> I was wondering if anyone ever encountered this before and knew a work around.
> The admins for our cluster are unfortunately very slow to respond.
> 
> Thanks
> 
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.comhttp://box290.bluehost.com/mailman/listinfo/mak
> er-devel_yandell-lab.org



-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120608/8b777a77/attachment.html>

From daniel.standage at gmail.com  Thu Jun 14 13:26:18 2012
From: daniel.standage at gmail.com (Daniel Standage)
Date: Thu, 14 Jun 2012 13:26:18 -0500
Subject: [maker-devel] Quick question about re-annotation
Message-ID: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>

Greetings!

I have a quick question about re-annotation with Maker. I have successfully
completed a Maker run, but now I would like to re-run Maker with some
additional EST evidence (from a related organism, aligned and in GFF3
format). I simply added the file to the *altest_gff* configuration setting
and re-ran Maker. However, from  the log messages it looked like Maker was
starting from scratch rather than using what had already been completed in
the initial run. Luckily, I had made a backup of the complete Maker data
structure, so I killed the job, deleted the data structure, and restored
from the backup.

Before I try to run this again, do I need to change any other configuration
settings to do this re-annotation? The stanza under *Re-annotation Using
MAKER Derived GFF3* looks relevant, but it is not clear to me which
settings need to be set.

Thanks!

--
Daniel S. Standage
Ph.D. Candidate
Bioinformatics and Computational Biology Program
Department of Genetics, Development, and Cell Biology
Iowa State University
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120614/13e8189c/attachment.html>

From gowthaman.ramasamy at seattlebiomed.org  Thu Jun 14 13:48:01 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Thu, 14 Jun 2012 11:48:01 -0700
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
References: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>

Of course, Carson knows the best answer.

But, I think, you need to grab the GFFs from your previous maker run, and pass it as model_gff= option. That way, gene models in GFFs are used as a starting point and now will check for evidences from your alt_est dataset....

-Gowthaman
________________________________________
From: maker-devel-bounces at yandell-lab.org [maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage [daniel.standage at gmail.com]
Sent: Thursday, June 14, 2012 11:26 AM
To: Maker Mailing List
Subject: [maker-devel] Quick question about re-annotation

Greetings!

I have a quick question about re-annotation with Maker. I have successfully completed a Maker run, but now I would like to re-run Maker with some additional EST evidence (from a related organism, aligned and in GFF3 format). I simply added the file to the altest_gff configuration setting and re-ran Maker. However, from  the log messages it looked like Maker was starting from scratch rather than using what had already been completed in the initial run. Luckily, I had made a backup of the complete Maker data structure, so I killed the job, deleted the data structure, and restored from the backup.

Before I try to run this again, do I need to change any other configuration settings to do this re-annotation? The stanza under Re-annotation Using MAKER Derived GFF3 looks relevant, but it is not clear to me which settings need to be set.

Thanks!

--
Daniel S. Standage
Ph.D. Candidate
Bioinformatics and Computational Biology Program
Department of Genetics, Development, and Cell Biology
Iowa State University




From jason.stajich at gmail.com  Sun Jun 17 02:30:20 2012
From: jason.stajich at gmail.com (Jason Stajich)
Date: Sun, 17 Jun 2012 08:30:20 +0100
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>
References: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
	<89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>
Message-ID: <CALf8Lpwq4kQu2-VrviAKK9R7EG2vRG3ATQo8g_LjM=stO1tLpA@mail.gmail.com>

Well remember that ESTs are used as extra helper information to the ab
initio gene predictors so it will want to run all those predictions again
and re-call the gene structures from the combined output with this extra
info added in. So you will need to decide how you want these to be
incorporated and if you are willing to wait for the analysis to complete
again with this info. The pass through of the previous run will allow you
to keep the names from that previous run if they are important to you.

Jason Stajich


On Thu, Jun 14, 2012 at 7:48 PM, Gowthaman Ramasamy <
gowthaman.ramasamy at seattlebiomed.org> wrote:

> Of course, Carson knows the best answer.
>
> But, I think, you need to grab the GFFs from your previous maker run, and
> pass it as model_gff= option. That way, gene models in GFFs are used as a
> starting point and now will check for evidences from your alt_est
> dataset....
>
> -Gowthaman
> ________________________________________
> From: maker-devel-bounces at yandell-lab.org [
> maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage [
> daniel.standage at gmail.com]
> Sent: Thursday, June 14, 2012 11:26 AM
> To: Maker Mailing List
> Subject: [maker-devel] Quick question about re-annotation
>
> Greetings!
>
> I have a quick question about re-annotation with Maker. I have
> successfully completed a Maker run, but now I would like to re-run Maker
> with some additional EST evidence (from a related organism, aligned and in
> GFF3 format). I simply added the file to the altest_gff configuration
> setting and re-ran Maker. However, from  the log messages it looked like
> Maker was starting from scratch rather than using what had already been
> completed in the initial run. Luckily, I had made a backup of the complete
> Maker data structure, so I killed the job, deleted the data structure, and
> restored from the backup.
>
> Before I try to run this again, do I need to change any other
> configuration settings to do this re-annotation? The stanza under
> Re-annotation Using MAKER Derived GFF3 looks relevant, but it is not clear
> to me which settings need to be set.
>
> Thanks!
>
> --
> Daniel S. Standage
> Ph.D. Candidate
> Bioinformatics and Computational Biology Program
> Department of Genetics, Development, and Cell Biology
> Iowa State University
>
>
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120617/522b4820/attachment.html>

From alvinchen2002 at gmail.com  Fri Jun 15 14:41:52 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Fri, 15 Jun 2012 15:41:52 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
Message-ID: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>

Hi, 

	This is my first time to use maker. I have installed everything that required by maker, and use the data in "data" folder to test this program. But I got a "Segmentation fault" message after "Maker is now finished!!!". And I can't find gff file anywhere. Does anyone have a clue of this?

Thanks, 
Alvin

Here is the output of the program:

[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
WARNING: blast_type is set to 'wublast' but executables cannot be located
The blast_type 'ncbi' will be used instead.

A data structure will be created for you at:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore

To access files for individual sequences use the datastore index:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_datastore_index.log




--Next Contig--

#---------------------------------------------------------------------
Now starting the contig!!
SeqID: contig-dpp-500-500
Length: 32156
#---------------------------------------------------------------------


running  repeat masker.
#--------- command -------------#
Widget::RepeatMasker:
/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.all.rb -species all -dir /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
#-------------------------------#
processing output: 
cycle 1 
cycle 2 
cycle 3 
cycle 4 
cycle 5 
cycle 6 
cycle 7 
cycle 8 
cycle 9 
cycle 10 
Generating output... 
masking
done
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.repeatrunner
#-------------------------------#
deleted:0 hits
 in cluster:shadow cluster...
    i_size:5 j_size:3
 sorting hits in shadow cluster...
... finished.
 i_size:5   current i:0
 i_size:5   current i:1
 i_size:5   current i:2
 i_size:5   current i:3
 i_size:5   current i:4
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastn:
/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
#-------------------------------#
deleted:-1 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
#-------------------------------#
deleted:0 hits
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.dpp-mRNA-5.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.dpp-mRNA-4.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.dpp-mRNA-3.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.dpp-mRNA-2.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.dpp-mRNA-1.est_exonerate
#-------------------------------#
cleaning blastn...
cleaning tblastx...
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-5.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-4.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-3.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-2.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-1.p_exonerate
#-------------------------------#
cleaning blastx...
Preparing evidence for hint based annotation
 in cluster:shadow cluster...
    i_size:15 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:15   current i:0
 i_size:15   current i:1
 i_size:15   current i:2
 i_size:15   current i:3
 i_size:15   current i:4
 i_size:15   current i:5
 i_size:15   current i:6
 i_size:15   current i:7
 i_size:15   current i:8
 i_size:15   current i:9
 i_size:15   current i:10
 i_size:15   current i:11
 i_size:15   current i:12
 i_size:15   current i:13
 i_size:15   current i:14
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
 ...processing 0 of 5
 ...processing 1 of 5
 ...processing 2 of 5
 ...processing 3 of 5
Making transcripts
Processing transcripts into genes
 in cluster:shadow cluster...
    i_size:3 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:3   current i:0
 i_size:3   current i:1
 i_size:3   current i:2
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
now careful_clustering....
getting Pairs
doing single linkage clustering
 ...processing 0 of 3
 ...processing 1 of 3
Calculating annotation quality statistics
Choosing best annotations


Maker is now finished!!!

Segmentation fault






From gowthaman.ramasamy at seattlebiomed.org  Mon Jun 18 13:16:00 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Mon, 18 Jun 2012 11:16:00 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>
References: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C9EAEDA1E@mail02.sbri.org>

Hi Alvin,
I am a relatively new user too. I too get "seg fault" even though, maker did finish making the gff file successfully.

GFFs are actually buried deep down. One possibility is that you were looking only in parent folders.
If you have not done already,  you might want to check for gffs at: /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/*/*/*. ie, three levels down your data store.

what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?

Gowthaman
________________________________________
From: maker-devel-bounces at yandell-lab.org [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen [alvinchen2002 at gmail.com]
Sent: Friday, June 15, 2012 12:41 PM
To: maker-devel at yandell-lab.org
Subject: [maker-devel] maker 2.10 Segmentation fault

Hi,

        This is my first time to use maker. I have installed everything that required by maker, and use the data in "data" folder to test this program. But I got a "Segmentation fault" message after "Maker is now finished!!!". And I can't find gff file anywhere. Does anyone have a clue of this?

Thanks,
Alvin

Here is the output of the program:

[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
WARNING: blast_type is set to 'wublast' but executables cannot be located
The blast_type 'ncbi' will be used instead.

A data structure will be created for you at:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore

To access files for individual sequences use the datastore index:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_datastore_index.log




--Next Contig--

#---------------------------------------------------------------------
Now starting the contig!!
SeqID: contig-dpp-500-500
Length: 32156
#---------------------------------------------------------------------


running  repeat masker.
#--------- command -------------#
Widget::RepeatMasker:
/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.all.rb -species all -dir /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
#-------------------------------#
processing output:
cycle 1
cycle 2
cycle 3
cycle 4
cycle 5
cycle 6
cycle 7
cycle 8
cycle 9
cycle 10
Generating output...
masking
done
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.repeatrunner
#-------------------------------#
deleted:0 hits
 in cluster:shadow cluster...
    i_size:5 j_size:3
 sorting hits in shadow cluster...
... finished.
 i_size:5   current i:0
 i_size:5   current i:1
 i_size:5   current i:2
 i_size:5   current i:3
 i_size:5   current i:4
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastn:
/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
#-------------------------------#
deleted:-1 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
#-------------------------------#
deleted:0 hits
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.dpp-mRNA-5.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.dpp-mRNA-4.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.dpp-mRNA-3.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.dpp-mRNA-2.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.dpp-mRNA-1.est_exonerate
#-------------------------------#
cleaning blastn...
cleaning tblastx...
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-5.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-4.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-3.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-2.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-1.p_exonerate
#-------------------------------#
cleaning blastx...
Preparing evidence for hint based annotation
 in cluster:shadow cluster...
    i_size:15 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:15   current i:0
 i_size:15   current i:1
 i_size:15   current i:2
 i_size:15   current i:3
 i_size:15   current i:4
 i_size:15   current i:5
 i_size:15   current i:6
 i_size:15   current i:7
 i_size:15   current i:8
 i_size:15   current i:9
 i_size:15   current i:10
 i_size:15   current i:11
 i_size:15   current i:12
 i_size:15   current i:13
 i_size:15   current i:14
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
 ...processing 0 of 5
 ...processing 1 of 5
 ...processing 2 of 5
 ...processing 3 of 5
Making transcripts
Processing transcripts into genes
 in cluster:shadow cluster...
    i_size:3 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:3   current i:0
 i_size:3   current i:1
 i_size:3   current i:2
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
now careful_clustering....
getting Pairs
doing single linkage clustering
 ...processing 0 of 3
 ...processing 1 of 3
Calculating annotation quality statistics
Choosing best annotations


Maker is now finished!!!

Segmentation fault




_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org



From carsonhh at gmail.com  Tue Jun 19 10:30:28 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 08:30:28 -0700
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <CALf8Lpwq4kQu2-VrviAKK9R7EG2vRG3ATQo8g_LjM=stO1tLpA@mail.gmail.com>
Message-ID: <CC05E879.EA7E%carsonhh@gmail.com>

Yes the advice given so far is correct.  You can pass back through old
evidence using the maker_gff option and setting est_pass, protein_pass, etc.
to 1.  Set the pred_pass=0 so as to ignore old predictions.  Let MAKER
generate those again to reflect the additional evidence (added to the
alt_est= option).  If you have model_pass=1 and map_forward=1 set then if
any model changes, you can at least maintain the name.

Thanks,
Carson


From:  Jason Stajich <jason.stajich at gmail.com>
Date:  Sunday, 17 June, 2012 12:30 AM
To:  Daniel Standage <daniel.standage at gmail.com>
Cc:  Maker Mailing List <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Quick question about re-annotation

Well remember that ESTs are used as extra helper information to the ab
initio gene predictors so it will want to run all those predictions again
and re-call the gene structures from the combined output with this extra
info added in. So you will need to decide how you want these to be
incorporated and if you are willing to wait for the analysis to complete
again with this info. The pass through of the previous run will allow you to
keep the names from that previous run if they are important to you.

Jason Stajich


On Thu, Jun 14, 2012 at 7:48 PM, Gowthaman Ramasamy
<gowthaman.ramasamy at seattlebiomed.org> wrote:
> Of course, Carson knows the best answer.
> 
> But, I think, you need to grab the GFFs from your previous maker run, and pass
> it as model_gff= option. That way, gene models in GFFs are used as a starting
> point and now will check for evidences from your alt_est dataset....
> 
> -Gowthaman
> ________________________________________
> From: maker-devel-bounces at yandell-lab.org
> [maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage
> [daniel.standage at gmail.com]
> Sent: Thursday, June 14, 2012 11:26 AM
> To: Maker Mailing List
> Subject: [maker-devel] Quick question about re-annotation
> 
> Greetings!
> 
> I have a quick question about re-annotation with Maker. I have successfully
> completed a Maker run, but now I would like to re-run Maker with some
> additional EST evidence (from a related organism, aligned and in GFF3 format).
> I simply added the file to the altest_gff configuration setting and re-ran
> Maker. However, from  the log messages it looked like Maker was starting from
> scratch rather than using what had already been completed in the initial run.
> Luckily, I had made a backup of the complete Maker data structure, so I killed
> the job, deleted the data structure, and restored from the backup.
> 
> Before I try to run this again, do I need to change any other configuration
> settings to do this re-annotation? The stanza under Re-annotation Using MAKER
> Derived GFF3 looks relevant, but it is not clear to me which settings need to
> be set.
> 
> Thanks!
> 
> --
> Daniel S. Standage
> Ph.D. Candidate
> Bioinformatics and Computational Biology Program
> Department of Genetics, Development, and Cell Biology
> Iowa State University
> 
> 
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120619/039e29b4/attachment.html>

From carsonhh at gmail.com  Tue Jun 19 10:39:55 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 08:39:55 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C9EAEDA1E@mail02.sbri.org>
Message-ID: <CC05E9A6.EA88%carsonhh@gmail.com>

The "Maker is now finished" message occurs before the Segmentation fault
so it is finished.  The Segmentation fault is probably an issue with your
system reaping the perl threads on completion.  You can try reinstalling
the forks and forks::shared from CPAN.  Also make sure you are using the
2.25 version and no 2.10.  But your job is finished anyways, so it's
really not affecting the output.  MAKER puts the results for each contig
in a separate folder because some downstream programs like Apollo can only
handle one contig at a time.  Use the
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file to see where each contigs output is stored.


If you want a merged output file for everything, use the merge_gff script
in maker and give it the
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file and it will assemble a merged output file for you.
 There are two type of output GFF3 which gives detailed annotation
information and fasta which just produces sequence for each transcript.
Use fasta_merge to get a merged fasta file for all contigs (giving it the
same 
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file).  The fiel you are interested will be the
maker.pteins.fasta and maker.transcripts.fasta file.

More information on MAKER's output here -->
http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output

Thanks,
Carson


On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Alvin,
>I am a relatively new user too. I too get "seg fault" even though, maker
>did finish making the gff file successfully.
>
>GFFs are actually buried deep down. One possibility is that you were
>looking only in parent folders.
>If you have not done already,  you might want to check for gffs at:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/*/*/*. ie, three levels down your data store.
>
>what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?
>
>Gowthaman
>________________________________________
>From: maker-devel-bounces at yandell-lab.org
>[maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>[alvinchen2002 at gmail.com]
>Sent: Friday, June 15, 2012 12:41 PM
>To: maker-devel at yandell-lab.org
>Subject: [maker-devel] maker 2.10 Segmentation fault
>
>Hi,
>
>        This is my first time to use maker. I have installed everything
>that required by maker, and use the data in "data" folder to test this
>program. But I got a "Segmentation fault" message after "Maker is now
>finished!!!". And I can't find gff file anywhere. Does anyone have a clue
>of this?
>
>Thanks,
>Alvin
>
>Here is the output of the program:
>
>[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
>WARNING: blast_type is set to 'wublast' but executables cannot be located
>The blast_type 'ncbi' will be used instead.
>
>A data structure will be created for you at:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re
>
>To access files for individual sequences use the datastore index:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_
>datastore_index.log
>
>
>
>
>--Next Contig--
>
>#---------------------------------------------------------------------
>Now starting the contig!!
>SeqID: contig-dpp-500-500
>Length: 32156
>#---------------------------------------------------------------------
>
>
>running  repeat masker.
>#--------- command -------------#
>Widget::RepeatMasker:
>/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.all.rb -species all -dir
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>#-------------------------------#
>processing output:
>cycle 1
>cycle 2
>cycle 3
>cycle 4
>cycle 5
>cycle 6
>cycle 7
>cycle 8
>cycle 9
>cycle 10
>Generating output...
>masking
>done
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
> in cluster:shadow cluster...
>    i_size:5 j_size:3
> sorting hits in shadow cluster...
>... finished.
> i_size:5   current i:0
> i_size:5   current i:1
> i_size:5   current i:2
> i_size:5   current i:3
> i_size:5   current i:4
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastn:
>/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>-i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>-o 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>#-------------------------------#
>deleted:-1 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
>#-------------------------------#
>deleted:0 hits
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26586-31847.dpp-mRNA-5.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.23089-31847.dpp-mRNA-4.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.22854-31847.dpp-mRNA-3.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.20908-31847.dpp-mRNA-2.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26901-31847.dpp-mRNA-1.est_exonerate
>#-------------------------------#
>cleaning blastn...
>cleaning tblastx...
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-5.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-4.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-3.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-2.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-1.p_exonerate
>#-------------------------------#
>cleaning blastx...
>Preparing evidence for hint based annotation
> in cluster:shadow cluster...
>    i_size:15 j_size:1
> sorting hits in shadow cluster...
>... finished.
> i_size:15   current i:0
> i_size:15   current i:1
> i_size:15   current i:2
> i_size:15   current i:3
> i_size:15   current i:4
> i_size:15   current i:5
> i_size:15   current i:6
> i_size:15   current i:7
> i_size:15   current i:8
> i_size:15   current i:9
> i_size:15   current i:10
> i_size:15   current i:11
> i_size:15   current i:12
> i_size:15   current i:13
> i_size:15   current i:14
> in cluster:shadow cluster...
>    i_size:0 j_size:0
> sorting hits in shadow cluster...
>... finished.
> ...processing 0 of 5
> ...processing 1 of 5
> ...processing 2 of 5
> ...processing 3 of 5
>Making transcripts
>Processing transcripts into genes
> in cluster:shadow cluster...
>    i_size:3 j_size:1
> sorting hits in shadow cluster...
>... finished.
> i_size:3   current i:0
> i_size:3   current i:1
> i_size:3   current i:2
> in cluster:shadow cluster...
>    i_size:0 j_size:0
> sorting hits in shadow cluster...
>... finished.
>now careful_clustering....
>getting Pairs
>doing single linkage clustering
> ...processing 0 of 3
> ...processing 1 of 3
>Calculating annotation quality statistics
>Choosing best annotations
>
>
>Maker is now finished!!!
>
>Segmentation fault
>
>
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From alvinchen2002 at gmail.com  Tue Jun 19 22:57:33 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Tue, 19 Jun 2012 23:57:33 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC05E9A6.EA88%carsonhh@gmail.com>
References: <CC05E9A6.EA88%carsonhh@gmail.com>
Message-ID: <3C1B46A3-09B2-4BFC-9CDE-BBCFF2B74073@gmail.com>

Hey Carson and Gowthaman, 

	Thanks for your replies! You are right, Carson, the problem caused by "Proc::Signal::reap_children_by_name(9, 'maintain.pl');". dpp_contig_master_datastore_index.log shows that the job has finished. I have installed the newest version of forks and forks::shared. but the version is 0.34 not 2.25, is that correct? The bad news is that the program still crashed at last, but it won't hurt.  I have tried the dpp and hsap data in data folder, and I have got 6 genes for hsap and 3 genes for dpp, is this number correct? I just want make sure everything works fine and I will begin to use it with my data. Thanks!

Best,
Alvin


On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:

> The "Maker is now finished" message occurs before the Segmentation fault
> so it is finished.  The Segmentation fault is probably an issue with your
> system reaping the perl threads on completion.  You can try reinstalling
> the forks and forks::shared from CPAN.  Also make sure you are using the
> 2.25 version and no 2.10.  But your job is finished anyways, so it's
> really not affecting the output.  MAKER puts the results for each contig
> in a separate folder because some downstream programs like Apollo can only
> handle one contig at a time.  Use the
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file to see where each contigs output is stored.
> 
> 
> If you want a merged output file for everything, use the merge_gff script
> in maker and give it the
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file and it will assemble a merged output file for you.
> There are two type of output GFF3 which gives detailed annotation
> information and fasta which just produces sequence for each transcript.
> Use fasta_merge to get a merged fasta file for all contigs (giving it the
> same 
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file).  The fiel you are interested will be the
> maker.pteins.fasta and maker.transcripts.fasta file.
> 
> More information on MAKER's output here -->
> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
> 
> Thanks,
> Carson
> 
> 
> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Alvin,
>> I am a relatively new user too. I too get "seg fault" even though, maker
>> did finish making the gff file successfully.
>> 
>> GFFs are actually buried deep down. One possibility is that you were
>> looking only in parent folders.
>> If you have not done already,  you might want to check for gffs at:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/*/*/*. ie, three levels down your data store.
>> 
>> what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?
>> 
>> Gowthaman
>> ________________________________________
>> From: maker-devel-bounces at yandell-lab.org
>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>> [alvinchen2002 at gmail.com]
>> Sent: Friday, June 15, 2012 12:41 PM
>> To: maker-devel at yandell-lab.org
>> Subject: [maker-devel] maker 2.10 Segmentation fault
>> 
>> Hi,
>> 
>>       This is my first time to use maker. I have installed everything
>> that required by maker, and use the data in "data" folder to test this
>> program. But I got a "Segmentation fault" message after "Maker is now
>> finished!!!". And I can't find gff file anywhere. Does anyone have a clue
>> of this?
>> 
>> Thanks,
>> Alvin
>> 
>> Here is the output of the program:
>> 
>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
>> WARNING: blast_type is set to 'wublast' but executables cannot be located
>> The blast_type 'ncbi' will be used instead.
>> 
>> A data structure will be created for you at:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re
>> 
>> To access files for individual sequences use the datastore index:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_
>> datastore_index.log
>> 
>> 
>> 
>> 
>> --Next Contig--
>> 
>> #---------------------------------------------------------------------
>> Now starting the contig!!
>> SeqID: contig-dpp-500-500
>> Length: 32156
>> #---------------------------------------------------------------------
>> 
>> 
>> running  repeat masker.
>> #--------- command -------------#
>> Widget::RepeatMasker:
>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.all.rb -species all -dir
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>> #-------------------------------#
>> processing output:
>> cycle 1
>> cycle 2
>> cycle 3
>> cycle 4
>> cycle 5
>> cycle 6
>> cycle 7
>> cycle 8
>> cycle 9
>> cycle 10
>> Generating output...
>> masking
>> done
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> in cluster:shadow cluster...
>>   i_size:5 j_size:3
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:5   current i:0
>> i_size:5   current i:1
>> i_size:5   current i:2
>> i_size:5   current i:3
>> i_size:5   current i:4
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastn:
>> /usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>> -o 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>> #-------------------------------#
>> deleted:-1 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
>> #-------------------------------#
>> deleted:0 hits
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26586-31847.dpp-mRNA-5.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .23089-31847.dpp-mRNA-4.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .22854-31847.dpp-mRNA-3.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .20908-31847.dpp-mRNA-2.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26901-31847.dpp-mRNA-1.est_exonerate
>> #-------------------------------#
>> cleaning blastn...
>> cleaning tblastx...
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-5.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-4.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-3.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-2.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-1.p_exonerate
>> #-------------------------------#
>> cleaning blastx...
>> Preparing evidence for hint based annotation
>> in cluster:shadow cluster...
>>   i_size:15 j_size:1
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:15   current i:0
>> i_size:15   current i:1
>> i_size:15   current i:2
>> i_size:15   current i:3
>> i_size:15   current i:4
>> i_size:15   current i:5
>> i_size:15   current i:6
>> i_size:15   current i:7
>> i_size:15   current i:8
>> i_size:15   current i:9
>> i_size:15   current i:10
>> i_size:15   current i:11
>> i_size:15   current i:12
>> i_size:15   current i:13
>> i_size:15   current i:14
>> in cluster:shadow cluster...
>>   i_size:0 j_size:0
>> sorting hits in shadow cluster...
>> ... finished.
>> ...processing 0 of 5
>> ...processing 1 of 5
>> ...processing 2 of 5
>> ...processing 3 of 5
>> Making transcripts
>> Processing transcripts into genes
>> in cluster:shadow cluster...
>>   i_size:3 j_size:1
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:3   current i:0
>> i_size:3   current i:1
>> i_size:3   current i:2
>> in cluster:shadow cluster...
>>   i_size:0 j_size:0
>> sorting hits in shadow cluster...
>> ... finished.
>> now careful_clustering....
>> getting Pairs
>> doing single linkage clustering
>> ...processing 0 of 3
>> ...processing 1 of 3
>> Calculating annotation quality statistics
>> Choosing best annotations
>> 
>> 
>> Maker is now finished!!!
>> 
>> Segmentation fault
>> 
>> 
>> 
>> 
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
> 
> 




From carsonhh at gmail.com  Wed Jun 20 00:03:14 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:03:14 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <3C1B46A3-09B2-4BFC-9CDE-BBCFF2B74073@gmail.com>
Message-ID: <CC06A670.EACE%carsonhh@gmail.com>

Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
version 2.25 (type maker -v to see the version you are using).  The
reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
process fails to respond to signals upstream in the code.  The 2.25
version of MAKER does some extra things that should even further avoid the
need for the call compared to MAKER 2.10.

Thanks,
Carson






On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey Carson and Gowthaman,
>
>	Thanks for your replies! You are right, Carson, the problem caused by
>"Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>dpp_contig_master_datastore_index.log shows that the job has finished. I
>have installed the newest version of forks and forks::shared. but the
>version is 0.34 not 2.25, is that correct? The bad news is that the
>program still crashed at last, but it won't hurt.  I have tried the dpp
>and hsap data in data folder, and I have got 6 genes for hsap and 3 genes
>for dpp, is this number correct? I just want make sure everything works
>fine and I will begin to use it with my data. Thanks!
>
>Best,
>Alvin
>
>
>On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>
>> The "Maker is now finished" message occurs before the Segmentation fault
>> so it is finished.  The Segmentation fault is probably an issue with
>>your
>> system reaping the perl threads on completion.  You can try reinstalling
>> the forks and forks::shared from CPAN.  Also make sure you are using the
>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>> really not affecting the output.  MAKER puts the results for each contig
>> in a separate folder because some downstream programs like Apollo can
>>only
>> handle one contig at a time.  Use the
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file to see where each contigs output is stored.
>> 
>> 
>> If you want a merged output file for everything, use the merge_gff
>>script
>> in maker and give it the
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file and it will assemble a merged output file for
>>you.
>> There are two type of output GFF3 which gives detailed annotation
>> information and fasta which just produces sequence for each transcript.
>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>the
>> same 
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file).  The fiel you are interested will be the
>> maker.pteins.fasta and maker.transcripts.fasta file.
>> 
>> More information on MAKER's output here -->
>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>> 
>> Thanks,
>> Carson
>> 
>> 
>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>> 
>>> Hi Alvin,
>>> I am a relatively new user too. I too get "seg fault" even though,
>>>maker
>>> did finish making the gff file successfully.
>>> 
>>> GFFs are actually buried deep down. One possibility is that you were
>>> looking only in parent folders.
>>> If you have not done already,  you might want to check for gffs at:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/*/*/*. ie, three levels down your data store.
>>> 
>>> what does "dpp_contig_master_datastore_index.log" says?
>>>Failed/Finsihed ?
>>> 
>>> Gowthaman
>>> ________________________________________
>>> From: maker-devel-bounces at yandell-lab.org
>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>> [alvinchen2002 at gmail.com]
>>> Sent: Friday, June 15, 2012 12:41 PM
>>> To: maker-devel at yandell-lab.org
>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>> 
>>> Hi,
>>> 
>>>       This is my first time to use maker. I have installed everything
>>> that required by maker, and use the data in "data" folder to test this
>>> program. But I got a "Segmentation fault" message after "Maker is now
>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>clue
>>> of this?
>>> 
>>> Thanks,
>>> Alvin
>>> 
>>> Here is the output of the program:
>>> 
>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>maker_exe.ctl
>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>located
>>> The blast_type 'ncbi' will be used instead.
>>> 
>>> A data structure will be created for you at:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re
>>> 
>>> To access files for individual sequences use the datastore index:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_maste
>>>r_
>>> datastore_index.log
>>> 
>>> 
>>> 
>>> 
>>> --Next Contig--
>>> 
>>> #---------------------------------------------------------------------
>>> Now starting the contig!!
>>> SeqID: contig-dpp-500-500
>>> Length: 32156
>>> #---------------------------------------------------------------------
>>> 
>>> 
>>> running  repeat masker.
>>> #--------- command -------------#
>>> Widget::RepeatMasker:
>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .0.all.rb -species all -dir
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>> #-------------------------------#
>>> processing output:
>>> cycle 1
>>> cycle 2
>>> cycle 3
>>> cycle 4
>>> cycle 5
>>> cycle 6
>>> cycle 7
>>> cycle 8
>>> cycle 9
>>> cycle 10
>>> Generating output...
>>> masking
>>> done
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>0.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>1.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>2.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>3.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>4.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>5.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>6.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>7.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>8.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>9.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> in cluster:shadow cluster...
>>>   i_size:5 j_size:3
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:5   current i:0
>>> i_size:5   current i:1
>>> i_size:5   current i:2
>>> i_size:5   current i:3
>>> i_size:5   current i:4
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastn:
>>> /usr/bin/blastall -p blastn -d
>>>/tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>>> -o 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>> #-------------------------------#
>>> deleted:-1 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blast
>>>x
>>> #-------------------------------#
>>> deleted:0 hits
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>> #-------------------------------#
>>> cleaning blastn...
>>> cleaning tblastx...
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-5.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-4.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-3.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-2.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-1.p_exonerate
>>> #-------------------------------#
>>> cleaning blastx...
>>> Preparing evidence for hint based annotation
>>> in cluster:shadow cluster...
>>>   i_size:15 j_size:1
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:15   current i:0
>>> i_size:15   current i:1
>>> i_size:15   current i:2
>>> i_size:15   current i:3
>>> i_size:15   current i:4
>>> i_size:15   current i:5
>>> i_size:15   current i:6
>>> i_size:15   current i:7
>>> i_size:15   current i:8
>>> i_size:15   current i:9
>>> i_size:15   current i:10
>>> i_size:15   current i:11
>>> i_size:15   current i:12
>>> i_size:15   current i:13
>>> i_size:15   current i:14
>>> in cluster:shadow cluster...
>>>   i_size:0 j_size:0
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> ...processing 0 of 5
>>> ...processing 1 of 5
>>> ...processing 2 of 5
>>> ...processing 3 of 5
>>> Making transcripts
>>> Processing transcripts into genes
>>> in cluster:shadow cluster...
>>>   i_size:3 j_size:1
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:3   current i:0
>>> i_size:3   current i:1
>>> i_size:3   current i:2
>>> in cluster:shadow cluster...
>>>   i_size:0 j_size:0
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> now careful_clustering....
>>> getting Pairs
>>> doing single linkage clustering
>>> ...processing 0 of 3
>>> ...processing 1 of 3
>>> Calculating annotation quality statistics
>>> Choosing best annotations
>>> 
>>> 
>>> Maker is now finished!!!
>>> 
>>> Segmentation fault
>>> 
>>> 
>>> 
>>> 
>>> _______________________________________________
>>> maker-devel mailing list
>>> maker-devel at box290.bluehost.com
>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>> 
>>> _______________________________________________
>>> maker-devel mailing list
>>> maker-devel at box290.bluehost.com
>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> 
>





From alvinchen2002 at gmail.com  Wed Jun 20 00:15:24 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Wed, 20 Jun 2012 01:15:24 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC06A670.EACE%carsonhh@gmail.com>
References: <CC06A670.EACE%carsonhh@gmail.com>
Message-ID: <ACAA26CD-8208-4027-9831-2139093467A2@gmail.com>

Hey  Carson,

	I am still using 2.10, because 2.25 get crashed at the beginning. I think it may be caused by these codes:

Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up maintainers
Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up maintainers"

You have added them at the top of the scripts in the new version. 

Alvin

On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:

> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
> version 2.25 (type maker -v to see the version you are using).  The
> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
> process fails to respond to signals upstream in the code.  The 2.25
> version of MAKER does some extra things that should even further avoid the
> need for the call compared to MAKER 2.10.
> 
> Thanks,
> Carson
> 
> 
> 
> 
> 
> 
> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
> 
>> Hey Carson and Gowthaman,
>> 
>> 	Thanks for your replies! You are right, Carson, the problem caused by
>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>> dpp_contig_master_datastore_index.log shows that the job has finished. I
>> have installed the newest version of forks and forks::shared. but the
>> version is 0.34 not 2.25, is that correct? The bad news is that the
>> program still crashed at last, but it won't hurt.  I have tried the dpp
>> and hsap data in data folder, and I have got 6 genes for hsap and 3 genes
>> for dpp, is this number correct? I just want make sure everything works
>> fine and I will begin to use it with my data. Thanks!
>> 
>> Best,
>> Alvin
>> 
>> 
>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>> 
>>> The "Maker is now finished" message occurs before the Segmentation fault
>>> so it is finished.  The Segmentation fault is probably an issue with
>>> your
>>> system reaping the perl threads on completion.  You can try reinstalling
>>> the forks and forks::shared from CPAN.  Also make sure you are using the
>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>> really not affecting the output.  MAKER puts the results for each contig
>>> in a separate folder because some downstream programs like Apollo can
>>> only
>>> handle one contig at a time.  Use the
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file to see where each contigs output is stored.
>>> 
>>> 
>>> If you want a merged output file for everything, use the merge_gff
>>> script
>>> in maker and give it the
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file and it will assemble a merged output file for
>>> you.
>>> There are two type of output GFF3 which gives detailed annotation
>>> information and fasta which just produces sequence for each transcript.
>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>> the
>>> same 
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file).  The fiel you are interested will be the
>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>> 
>>> More information on MAKER's output here -->
>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>> 
>>> Thanks,
>>> Carson
>>> 
>>> 
>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>> 
>>>> Hi Alvin,
>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>> maker
>>>> did finish making the gff file successfully.
>>>> 
>>>> GFFs are actually buried deep down. One possibility is that you were
>>>> looking only in parent folders.
>>>> If you have not done already,  you might want to check for gffs at:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/*/*/*. ie, three levels down your data store.
>>>> 
>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>> Failed/Finsihed ?
>>>> 
>>>> Gowthaman
>>>> ________________________________________
>>>> From: maker-devel-bounces at yandell-lab.org
>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>> [alvinchen2002 at gmail.com]
>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>> To: maker-devel at yandell-lab.org
>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>> 
>>>> Hi,
>>>> 
>>>>      This is my first time to use maker. I have installed everything
>>>> that required by maker, and use the data in "data" folder to test this
>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>> clue
>>>> of this?
>>>> 
>>>> Thanks,
>>>> Alvin
>>>> 
>>>> Here is the output of the program:
>>>> 
>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>> maker_exe.ctl
>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>> located
>>>> The blast_type 'ncbi' will be used instead.
>>>> 
>>>> A data structure will be created for you at:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re
>>>> 
>>>> To access files for individual sequences use the datastore index:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_maste
>>>> r_
>>>> datastore_index.log
>>>> 
>>>> 
>>>> 
>>>> 
>>>> --Next Contig--
>>>> 
>>>> #---------------------------------------------------------------------
>>>> Now starting the contig!!
>>>> SeqID: contig-dpp-500-500
>>>> Length: 32156
>>>> #---------------------------------------------------------------------
>>>> 
>>>> 
>>>> running  repeat masker.
>>>> #--------- command -------------#
>>>> Widget::RepeatMasker:
>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .0.all.rb -species all -dir
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>> #-------------------------------#
>>>> processing output:
>>>> cycle 1
>>>> cycle 2
>>>> cycle 3
>>>> cycle 4
>>>> cycle 5
>>>> cycle 6
>>>> cycle 7
>>>> cycle 8
>>>> cycle 9
>>>> cycle 10
>>>> Generating output...
>>>> masking
>>>> done
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 0.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 1.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 2.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 3.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 4.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 5.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 6.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 7.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 8.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 9.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> in cluster:shadow cluster...
>>>>  i_size:5 j_size:3
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:5   current i:0
>>>> i_size:5   current i:1
>>>> i_size:5   current i:2
>>>> i_size:5   current i:3
>>>> i_size:5   current i:4
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastn:
>>>> /usr/bin/blastall -p blastn -d
>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>>>> -o 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>> #-------------------------------#
>>>> deleted:-1 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blast
>>>> x
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>> #-------------------------------#
>>>> cleaning blastn...
>>>> cleaning tblastx...
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>> #-------------------------------#
>>>> cleaning blastx...
>>>> Preparing evidence for hint based annotation
>>>> in cluster:shadow cluster...
>>>>  i_size:15 j_size:1
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:15   current i:0
>>>> i_size:15   current i:1
>>>> i_size:15   current i:2
>>>> i_size:15   current i:3
>>>> i_size:15   current i:4
>>>> i_size:15   current i:5
>>>> i_size:15   current i:6
>>>> i_size:15   current i:7
>>>> i_size:15   current i:8
>>>> i_size:15   current i:9
>>>> i_size:15   current i:10
>>>> i_size:15   current i:11
>>>> i_size:15   current i:12
>>>> i_size:15   current i:13
>>>> i_size:15   current i:14
>>>> in cluster:shadow cluster...
>>>>  i_size:0 j_size:0
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> ...processing 0 of 5
>>>> ...processing 1 of 5
>>>> ...processing 2 of 5
>>>> ...processing 3 of 5
>>>> Making transcripts
>>>> Processing transcripts into genes
>>>> in cluster:shadow cluster...
>>>>  i_size:3 j_size:1
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:3   current i:0
>>>> i_size:3   current i:1
>>>> i_size:3   current i:2
>>>> in cluster:shadow cluster...
>>>>  i_size:0 j_size:0
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> now careful_clustering....
>>>> getting Pairs
>>>> doing single linkage clustering
>>>> ...processing 0 of 3
>>>> ...processing 1 of 3
>>>> Calculating annotation quality statistics
>>>> Choosing best annotations
>>>> 
>>>> 
>>>> Maker is now finished!!!
>>>> 
>>>> Segmentation fault
>>>> 
>>>> 
>>>> 
>>>> 
>>>> _______________________________________________
>>>> maker-devel mailing list
>>>> maker-devel at box290.bluehost.com
>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>>> 
>>>> _______________________________________________
>>>> maker-devel mailing list
>>>> maker-devel at box290.bluehost.com
>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>> 
>>> 
>> 
> 
> 




From carsonhh at gmail.com  Wed Jun 20 00:21:22 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:21:22 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <ACAA26CD-8208-4027-9831-2139093467A2@gmail.com>
Message-ID: <CC06AB2D.EAE2%carsonhh@gmail.com>

Those are wrapped in an END block so they only run when perl exits (I.e.
post completion or failure).  If 2.25 is failing it would likely be for
another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
-debug).  Does it produce any output before failure?

Thanks,
Carson





On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey  Carson,
>
>	I am still using 2.10, because 2.25 get crashed at the beginning. I
>think it may be caused by these codes:
>
>Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>maintainers
>Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>maintainers"
>
>You have added them at the top of the scripts in the new version.
>
>Alvin
>
>On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>
>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
>> version 2.25 (type maker -v to see the version you are using).  The
>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>> process fails to respond to signals upstream in the code.  The 2.25
>> version of MAKER does some extra things that should even further avoid
>>the
>> need for the call compared to MAKER 2.10.
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> 
>> 
>> 
>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>> 
>>> Hey Carson and Gowthaman,
>>> 
>>> 	Thanks for your replies! You are right, Carson, the problem caused by
>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>> dpp_contig_master_datastore_index.log shows that the job has finished.
>>>I
>>> have installed the newest version of forks and forks::shared. but the
>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>> program still crashed at last, but it won't hurt.  I have tried the dpp
>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>genes
>>> for dpp, is this number correct? I just want make sure everything works
>>> fine and I will begin to use it with my data. Thanks!
>>> 
>>> Best,
>>> Alvin
>>> 
>>> 
>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>> 
>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>fault
>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>> your
>>>> system reaping the perl threads on completion.  You can try
>>>>reinstalling
>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>the
>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>> really not affecting the output.  MAKER puts the results for each
>>>>contig
>>>> in a separate folder because some downstream programs like Apollo can
>>>> only
>>>> handle one contig at a time.  Use the
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file to see where each contigs output is stored.
>>>> 
>>>> 
>>>> If you want a merged output file for everything, use the merge_gff
>>>> script
>>>> in maker and give it the
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file and it will assemble a merged output file for
>>>> you.
>>>> There are two type of output GFF3 which gives detailed annotation
>>>> information and fasta which just produces sequence for each
>>>>transcript.
>>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>>> the
>>>> same 
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file).  The fiel you are interested will be the
>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>> 
>>>> More information on MAKER's output here -->
>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>> 
>>>> Thanks,
>>>> Carson
>>>> 
>>>> 
>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>> 
>>>>> Hi Alvin,
>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>> maker
>>>>> did finish making the gff file successfully.
>>>>> 
>>>>> GFFs are actually buried deep down. One possibility is that you were
>>>>> looking only in parent folders.
>>>>> If you have not done already,  you might want to check for gffs at:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re/*/*/*. ie, three levels down your data store.
>>>>> 
>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>> Failed/Finsihed ?
>>>>> 
>>>>> Gowthaman
>>>>> ________________________________________
>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>> [alvinchen2002 at gmail.com]
>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>> To: maker-devel at yandell-lab.org
>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>> 
>>>>> Hi,
>>>>> 
>>>>>      This is my first time to use maker. I have installed everything
>>>>> that required by maker, and use the data in "data" folder to test
>>>>>this
>>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>>> clue
>>>>> of this?
>>>>> 
>>>>> Thanks,
>>>>> Alvin
>>>>> 
>>>>> Here is the output of the program:
>>>>> 
>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>> maker_exe.ctl
>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>> located
>>>>> The blast_type 'ncbi' will be used instead.
>>>>> 
>>>>> A data structure will be created for you at:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re
>>>>> 
>>>>> To access files for individual sequences use the datastore index:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mas
>>>>>te
>>>>> r_
>>>>> datastore_index.log
>>>>> 
>>>>> 
>>>>> 
>>>>> 
>>>>> --Next Contig--
>>>>> 
>>>>> 
>>>>>#---------------------------------------------------------------------
>>>>> Now starting the contig!!
>>>>> SeqID: contig-dpp-500-500
>>>>> Length: 32156
>>>>> 
>>>>>#---------------------------------------------------------------------
>>>>> 
>>>>> 
>>>>> running  repeat masker.
>>>>> #--------- command -------------#
>>>>> Widget::RepeatMasker:
>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .0.all.rb -species all -dir
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>> #-------------------------------#
>>>>> processing output:
>>>>> cycle 1
>>>>> cycle 2
>>>>> cycle 3
>>>>> cycle 4
>>>>> cycle 5
>>>>> cycle 6
>>>>> cycle 7
>>>>> cycle 8
>>>>> cycle 9
>>>>> cycle 10
>>>>> Generating output...
>>>>> masking
>>>>> done
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 0.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 1.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 2.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 3.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 4.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 5.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 6.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 7.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 8.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 9.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> in cluster:shadow cluster...
>>>>>  i_size:5 j_size:3
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:5   current i:0
>>>>> i_size:5   current i:1
>>>>> i_size:5   current i:2
>>>>> i_size:5   current i:3
>>>>> i_size:5   current i:4
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastn:
>>>>> /usr/bin/blastall -p blastn -d
>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>-e
>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>-I T
>>>>> -o 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>> #-------------------------------#
>>>>> deleted:-1 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>>/tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.bla
>>>>>st
>>>>> x
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>> #-------------------------------#
>>>>> cleaning blastn...
>>>>> cleaning tblastx...
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>> #-------------------------------#
>>>>> cleaning blastx...
>>>>> Preparing evidence for hint based annotation
>>>>> in cluster:shadow cluster...
>>>>>  i_size:15 j_size:1
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:15   current i:0
>>>>> i_size:15   current i:1
>>>>> i_size:15   current i:2
>>>>> i_size:15   current i:3
>>>>> i_size:15   current i:4
>>>>> i_size:15   current i:5
>>>>> i_size:15   current i:6
>>>>> i_size:15   current i:7
>>>>> i_size:15   current i:8
>>>>> i_size:15   current i:9
>>>>> i_size:15   current i:10
>>>>> i_size:15   current i:11
>>>>> i_size:15   current i:12
>>>>> i_size:15   current i:13
>>>>> i_size:15   current i:14
>>>>> in cluster:shadow cluster...
>>>>>  i_size:0 j_size:0
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> ...processing 0 of 5
>>>>> ...processing 1 of 5
>>>>> ...processing 2 of 5
>>>>> ...processing 3 of 5
>>>>> Making transcripts
>>>>> Processing transcripts into genes
>>>>> in cluster:shadow cluster...
>>>>>  i_size:3 j_size:1
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:3   current i:0
>>>>> i_size:3   current i:1
>>>>> i_size:3   current i:2
>>>>> in cluster:shadow cluster...
>>>>>  i_size:0 j_size:0
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> now careful_clustering....
>>>>> getting Pairs
>>>>> doing single linkage clustering
>>>>> ...processing 0 of 3
>>>>> ...processing 1 of 3
>>>>> Calculating annotation quality statistics
>>>>> Choosing best annotations
>>>>> 
>>>>> 
>>>>> Maker is now finished!!!
>>>>> 
>>>>> Segmentation fault
>>>>> 
>>>>> 
>>>>> 
>>>>> 
>>>>> _______________________________________________
>>>>> maker-devel mailing list
>>>>> maker-devel at box290.bluehost.com
>>>>> 
>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>g
>>>>> 
>>>>> _______________________________________________
>>>>> maker-devel mailing list
>>>>> maker-devel at box290.bluehost.com
>>>>> 
>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>g
>>>> 
>>>> 
>>> 
>> 
>> 
>





From alvinchen2002 at gmail.com  Wed Jun 20 00:48:10 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Wed, 20 Jun 2012 01:48:10 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC06AB2D.EAE2%carsonhh@gmail.com>
References: <CC06AB2D.EAE2%carsonhh@gmail.com>
Message-ID: <6C911ABF-19AF-4EBB-A990-1ECE85ADD7E3@gmail.com>

Hey Carson, 

	It seems like there is a bug in Proc-ProcessTable 0.45.  I solved the problem by downgraded Proc-ProcessTable from 0.45 to 0.44. I can run 2.25 without any problems now. 

Cheers,
Alvin

On Jun 20, 2012, at 1:21 AM, Carson Holt wrote:

> Those are wrapped in an END block so they only run when perl exits (I.e.
> post completion or failure).  If 2.25 is failing it would likely be for
> another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
> -debug).  Does it produce any output before failure?
> 
> Thanks,
> Carson
> 
> 
> 
> 
> 
> On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
> 
>> Hey  Carson,
>> 
>> 	I am still using 2.10, because 2.25 get crashed at the beginning. I
>> think it may be caused by these codes:
>> 
>> Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>> maintainers
>> Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>> maintainers"
>> 
>> You have added them at the top of the scripts in the new version.
>> 
>> Alvin
>> 
>> On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>> 
>>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
>>> version 2.25 (type maker -v to see the version you are using).  The
>>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>>> process fails to respond to signals upstream in the code.  The 2.25
>>> version of MAKER does some extra things that should even further avoid
>>> the
>>> need for the call compared to MAKER 2.10.
>>> 
>>> Thanks,
>>> Carson
>>> 
>>> 
>>> 
>>> 
>>> 
>>> 
>>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>>> 
>>>> Hey Carson and Gowthaman,
>>>> 
>>>> 	Thanks for your replies! You are right, Carson, the problem caused by
>>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>>> dpp_contig_master_datastore_index.log shows that the job has finished.
>>>> I
>>>> have installed the newest version of forks and forks::shared. but the
>>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>>> program still crashed at last, but it won't hurt.  I have tried the dpp
>>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>> genes
>>>> for dpp, is this number correct? I just want make sure everything works
>>>> fine and I will begin to use it with my data. Thanks!
>>>> 
>>>> Best,
>>>> Alvin
>>>> 
>>>> 
>>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>>> 
>>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>> fault
>>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>>> your
>>>>> system reaping the perl threads on completion.  You can try
>>>>> reinstalling
>>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>> the
>>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>>> really not affecting the output.  MAKER puts the results for each
>>>>> contig
>>>>> in a separate folder because some downstream programs like Apollo can
>>>>> only
>>>>> handle one contig at a time.  Use the
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file to see where each contigs output is stored.
>>>>> 
>>>>> 
>>>>> If you want a merged output file for everything, use the merge_gff
>>>>> script
>>>>> in maker and give it the
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file and it will assemble a merged output file for
>>>>> you.
>>>>> There are two type of output GFF3 which gives detailed annotation
>>>>> information and fasta which just produces sequence for each
>>>>> transcript.
>>>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>>>> the
>>>>> same 
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file).  The fiel you are interested will be the
>>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>>> 
>>>>> More information on MAKER's output here -->
>>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>>> 
>>>>> Thanks,
>>>>> Carson
>>>>> 
>>>>> 
>>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>>> 
>>>>>> Hi Alvin,
>>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>>> maker
>>>>>> did finish making the gff file successfully.
>>>>>> 
>>>>>> GFFs are actually buried deep down. One possibility is that you were
>>>>>> looking only in parent folders.
>>>>>> If you have not done already,  you might want to check for gffs at:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re/*/*/*. ie, three levels down your data store.
>>>>>> 
>>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>>> Failed/Finsihed ?
>>>>>> 
>>>>>> Gowthaman
>>>>>> ________________________________________
>>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>>> [alvinchen2002 at gmail.com]
>>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>>> To: maker-devel at yandell-lab.org
>>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>>> 
>>>>>> Hi,
>>>>>> 
>>>>>>     This is my first time to use maker. I have installed everything
>>>>>> that required by maker, and use the data in "data" folder to test
>>>>>> this
>>>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>>>> clue
>>>>>> of this?
>>>>>> 
>>>>>> Thanks,
>>>>>> Alvin
>>>>>> 
>>>>>> Here is the output of the program:
>>>>>> 
>>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>>> maker_exe.ctl
>>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>>> located
>>>>>> The blast_type 'ncbi' will be used instead.
>>>>>> 
>>>>>> A data structure will be created for you at:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re
>>>>>> 
>>>>>> To access files for individual sequences use the datastore index:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mas
>>>>>> te
>>>>>> r_
>>>>>> datastore_index.log
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> --Next Contig--
>>>>>> 
>>>>>> 
>>>>>> #---------------------------------------------------------------------
>>>>>> Now starting the contig!!
>>>>>> SeqID: contig-dpp-500-500
>>>>>> Length: 32156
>>>>>> 
>>>>>> #---------------------------------------------------------------------
>>>>>> 
>>>>>> 
>>>>>> running  repeat masker.
>>>>>> #--------- command -------------#
>>>>>> Widget::RepeatMasker:
>>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .0.all.rb -species all -dir
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>>> #-------------------------------#
>>>>>> processing output:
>>>>>> cycle 1
>>>>>> cycle 2
>>>>>> cycle 3
>>>>>> cycle 4
>>>>>> cycle 5
>>>>>> cycle 6
>>>>>> cycle 7
>>>>>> cycle 8
>>>>>> cycle 9
>>>>>> cycle 10
>>>>>> Generating output...
>>>>>> masking
>>>>>> done
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 0.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 1.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 2.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 3.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 4.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 5.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 6.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 7.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 8.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 9.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:5 j_size:3
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:5   current i:0
>>>>>> i_size:5   current i:1
>>>>>> i_size:5   current i:2
>>>>>> i_size:5   current i:3
>>>>>> i_size:5   current i:4
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastn:
>>>>>> /usr/bin/blastall -p blastn -d
>>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>> -e
>>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>> -I T
>>>>>> -o 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>>> #-------------------------------#
>>>>>> deleted:-1 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.bla
>>>>>> st
>>>>>> x
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>>> #-------------------------------#
>>>>>> cleaning blastn...
>>>>>> cleaning tblastx...
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>>> #-------------------------------#
>>>>>> cleaning blastx...
>>>>>> Preparing evidence for hint based annotation
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:15 j_size:1
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:15   current i:0
>>>>>> i_size:15   current i:1
>>>>>> i_size:15   current i:2
>>>>>> i_size:15   current i:3
>>>>>> i_size:15   current i:4
>>>>>> i_size:15   current i:5
>>>>>> i_size:15   current i:6
>>>>>> i_size:15   current i:7
>>>>>> i_size:15   current i:8
>>>>>> i_size:15   current i:9
>>>>>> i_size:15   current i:10
>>>>>> i_size:15   current i:11
>>>>>> i_size:15   current i:12
>>>>>> i_size:15   current i:13
>>>>>> i_size:15   current i:14
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:0 j_size:0
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> ...processing 0 of 5
>>>>>> ...processing 1 of 5
>>>>>> ...processing 2 of 5
>>>>>> ...processing 3 of 5
>>>>>> Making transcripts
>>>>>> Processing transcripts into genes
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:3 j_size:1
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:3   current i:0
>>>>>> i_size:3   current i:1
>>>>>> i_size:3   current i:2
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:0 j_size:0
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> now careful_clustering....
>>>>>> getting Pairs
>>>>>> doing single linkage clustering
>>>>>> ...processing 0 of 3
>>>>>> ...processing 1 of 3
>>>>>> Calculating annotation quality statistics
>>>>>> Choosing best annotations
>>>>>> 
>>>>>> 
>>>>>> Maker is now finished!!!
>>>>>> 
>>>>>> Segmentation fault
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> _______________________________________________
>>>>>> maker-devel mailing list
>>>>>> maker-devel at box290.bluehost.com
>>>>>> 
>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>> g
>>>>>> 
>>>>>> _______________________________________________
>>>>>> maker-devel mailing list
>>>>>> maker-devel at box290.bluehost.com
>>>>>> 
>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>> g
>>>>> 
>>>>> 
>>>> 
>>> 
>>> 
>> 
> 
> 




From carsonhh at gmail.com  Wed Jun 20 00:50:03 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:50:03 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <6C911ABF-19AF-4EBB-A990-1ECE85ADD7E3@gmail.com>
Message-ID: <CC06B280.EAF2%carsonhh@gmail.com>

Perfect.  And good to know.

Thanks,
Carson


On 12-06-19 10:48 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey Carson, 
>
>	It seems like there is a bug in Proc-ProcessTable 0.45.  I solved the
>problem by downgraded Proc-ProcessTable from 0.45 to 0.44. I can run 2.25
>without any problems now.
>
>Cheers,
>Alvin
>
>On Jun 20, 2012, at 1:21 AM, Carson Holt wrote:
>
>> Those are wrapped in an END block so they only run when perl exits (I.e.
>> post completion or failure).  If 2.25 is failing it would likely be for
>> another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
>> -debug).  Does it produce any output before failure?
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> 
>> 
>> On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>> 
>>> Hey  Carson,
>>> 
>>> 	I am still using 2.10, because 2.25 get crashed at the beginning. I
>>> think it may be caused by these codes:
>>> 
>>> Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>>> maintainers
>>> Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>>> maintainers"
>>> 
>>> You have added them at the top of the scripts in the new version.
>>> 
>>> Alvin
>>> 
>>> On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>>> 
>>>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant
>>>>MAKER
>>>> version 2.25 (type maker -v to see the version you are using).  The
>>>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>>>> process fails to respond to signals upstream in the code.  The 2.25
>>>> version of MAKER does some extra things that should even further avoid
>>>> the
>>>> need for the call compared to MAKER 2.10.
>>>> 
>>>> Thanks,
>>>> Carson
>>>> 
>>>> 
>>>> 
>>>> 
>>>> 
>>>> 
>>>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>>>> 
>>>>> Hey Carson and Gowthaman,
>>>>> 
>>>>> 	Thanks for your replies! You are right, Carson, the problem caused
>>>>>by
>>>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>>>> dpp_contig_master_datastore_index.log shows that the job has
>>>>>finished.
>>>>> I
>>>>> have installed the newest version of forks and forks::shared. but the
>>>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>>>> program still crashed at last, but it won't hurt.  I have tried the
>>>>>dpp
>>>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>>> genes
>>>>> for dpp, is this number correct? I just want make sure everything
>>>>>works
>>>>> fine and I will begin to use it with my data. Thanks!
>>>>> 
>>>>> Best,
>>>>> Alvin
>>>>> 
>>>>> 
>>>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>>>> 
>>>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>>> fault
>>>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>>>> your
>>>>>> system reaping the perl threads on completion.  You can try
>>>>>> reinstalling
>>>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>>> the
>>>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>>>> really not affecting the output.  MAKER puts the results for each
>>>>>> contig
>>>>>> in a separate folder because some downstream programs like Apollo
>>>>>>can
>>>>>> only
>>>>>> handle one contig at a time.  Use the
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file to see where each contigs output is stored.
>>>>>> 
>>>>>> 
>>>>>> If you want a merged output file for everything, use the merge_gff
>>>>>> script
>>>>>> in maker and give it the
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file and it will assemble a merged output file
>>>>>>for
>>>>>> you.
>>>>>> There are two type of output GFF3 which gives detailed annotation
>>>>>> information and fasta which just produces sequence for each
>>>>>> transcript.
>>>>>> Use fasta_merge to get a merged fasta file for all contigs (giving
>>>>>>it
>>>>>> the
>>>>>> same 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file).  The fiel you are interested will be the
>>>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>>>> 
>>>>>> More information on MAKER's output here -->
>>>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>>>> 
>>>>>> Thanks,
>>>>>> Carson
>>>>>> 
>>>>>> 
>>>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>>>> 
>>>>>>> Hi Alvin,
>>>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>>>> maker
>>>>>>> did finish making the gff file successfully.
>>>>>>> 
>>>>>>> GFFs are actually buried deep down. One possibility is that you
>>>>>>>were
>>>>>>> looking only in parent folders.
>>>>>>> If you have not done already,  you might want to check for gffs at:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re/*/*/*. ie, three levels down your data store.
>>>>>>> 
>>>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>>>> Failed/Finsihed ?
>>>>>>> 
>>>>>>> Gowthaman
>>>>>>> ________________________________________
>>>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>>>> [alvinchen2002 at gmail.com]
>>>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>>>> To: maker-devel at yandell-lab.org
>>>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>>>> 
>>>>>>> Hi,
>>>>>>> 
>>>>>>>     This is my first time to use maker. I have installed everything
>>>>>>> that required by maker, and use the data in "data" folder to test
>>>>>>> this
>>>>>>> program. But I got a "Segmentation fault" message after "Maker is
>>>>>>>now
>>>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have
>>>>>>>a
>>>>>>> clue
>>>>>>> of this?
>>>>>>> 
>>>>>>> Thanks,
>>>>>>> Alvin
>>>>>>> 
>>>>>>> Here is the output of the program:
>>>>>>> 
>>>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>>>> maker_exe.ctl
>>>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>>>> located
>>>>>>> The blast_type 'ncbi' will be used instead.
>>>>>>> 
>>>>>>> A data structure will be created for you at:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re
>>>>>>> 
>>>>>>> To access files for individual sequences use the datastore index:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_m
>>>>>>>as
>>>>>>> te
>>>>>>> r_
>>>>>>> datastore_index.log
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> --Next Contig--
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>#-------------------------------------------------------------------
>>>>>>>--
>>>>>>> Now starting the contig!!
>>>>>>> SeqID: contig-dpp-500-500
>>>>>>> Length: 32156
>>>>>>> 
>>>>>>> 
>>>>>>>#-------------------------------------------------------------------
>>>>>>>--
>>>>>>> 
>>>>>>> 
>>>>>>> running  repeat masker.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::RepeatMasker:
>>>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .0.all.rb -species all -dir
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>>>> #-------------------------------#
>>>>>>> processing output:
>>>>>>> cycle 1
>>>>>>> cycle 2
>>>>>>> cycle 3
>>>>>>> cycle 4
>>>>>>> cycle 5
>>>>>>> cycle 6
>>>>>>> cycle 7
>>>>>>> cycle 8
>>>>>>> cycle 9
>>>>>>> cycle 10
>>>>>>> Generating output...
>>>>>>> masking
>>>>>>> done
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 0.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 1.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 2.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 3.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 4.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 5.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 6.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 7.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 8.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 9.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:5 j_size:3
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:5   current i:0
>>>>>>> i_size:5   current i:1
>>>>>>> i_size:5   current i:2
>>>>>>> i_size:5   current i:3
>>>>>>> i_size:5   current i:4
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastn:
>>>>>>> /usr/bin/blastall -p blastn -d
>>>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>>> -e
>>>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>>> -I T
>>>>>>> -o 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>>>> #-------------------------------#
>>>>>>> deleted:-1 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.b
>>>>>>>la
>>>>>>> st
>>>>>>> x
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> cleaning blastn...
>>>>>>> cleaning tblastx...
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> cleaning blastx...
>>>>>>> Preparing evidence for hint based annotation
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:15 j_size:1
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:15   current i:0
>>>>>>> i_size:15   current i:1
>>>>>>> i_size:15   current i:2
>>>>>>> i_size:15   current i:3
>>>>>>> i_size:15   current i:4
>>>>>>> i_size:15   current i:5
>>>>>>> i_size:15   current i:6
>>>>>>> i_size:15   current i:7
>>>>>>> i_size:15   current i:8
>>>>>>> i_size:15   current i:9
>>>>>>> i_size:15   current i:10
>>>>>>> i_size:15   current i:11
>>>>>>> i_size:15   current i:12
>>>>>>> i_size:15   current i:13
>>>>>>> i_size:15   current i:14
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:0 j_size:0
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> ...processing 0 of 5
>>>>>>> ...processing 1 of 5
>>>>>>> ...processing 2 of 5
>>>>>>> ...processing 3 of 5
>>>>>>> Making transcripts
>>>>>>> Processing transcripts into genes
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:3 j_size:1
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:3   current i:0
>>>>>>> i_size:3   current i:1
>>>>>>> i_size:3   current i:2
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:0 j_size:0
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> now careful_clustering....
>>>>>>> getting Pairs
>>>>>>> doing single linkage clustering
>>>>>>> ...processing 0 of 3
>>>>>>> ...processing 1 of 3
>>>>>>> Calculating annotation quality statistics
>>>>>>> Choosing best annotations
>>>>>>> 
>>>>>>> 
>>>>>>> Maker is now finished!!!
>>>>>>> 
>>>>>>> Segmentation fault
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> _______________________________________________
>>>>>>> maker-devel mailing list
>>>>>>> maker-devel at box290.bluehost.com
>>>>>>> 
>>>>>>> 
>>>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.
>>>>>>>or
>>>>>>> g
>>>>>>> 
>>>>>>> _______________________________________________
>>>>>>> maker-devel mailing list
>>>>>>> maker-devel at box290.bluehost.com
>>>>>>> 
>>>>>>> 
>>>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.
>>>>>>>or
>>>>>>> g
>>>>>> 
>>>>>> 
>>>>> 
>>>> 
>>>> 
>>> 
>> 
>> 
>





From scott at scottcain.net  Fri Jun 22 09:55:56 2012
From: scott at scottcain.net (Scott Cain)
Date: Fri, 22 Jun 2012 10:55:56 -0400
Subject: [maker-devel] Applications open for GMOD Summer School 2012
Message-ID: <CA+JTaoz5z=hMqqpvRogmuTHdOrGBnqNHy510dxH0y68v0u1HNA@mail.gmail.com>

Applications are now being accepted for the 2012 GMOD Summer School
course, a five-day hands-on school aimed at teaching new GMOD
administrators how to install, configure and integrate popular GMOD
Components. The course will be held August 25-29 at the US National
Evolutionary Synthesis Center (NESCent) in Durham, North Carolina.

 https://docs.google.com/a/scottcain.net/spreadsheet/embeddedform?formkey=dG5hNGFiQ3UwYTV2LUZxZW04Qm1yZXc6MQ

These components will be covered at the school:

   Apollo or WebApollo - genome annotation editor
   Chado - biological database schema
   Galaxy - workflow system
   GBrowse - genome viewer
   GBrowse_syn - synteny viewer
   GFF3 - genome annotation file format and tools
   InterMine - biological data mining system
   JBrowse - next generation genome browser
   MAKER - genome annotation pipeline
   Tripal - web front end to Chado databases


The deadline for applying is the end of July 9, 2012. Admission is
competitive and is based on the strength of the application,
especially the statement of interest. The 2011 school had over 70
applicants for the 25 slots. Any application received after deadline
will be automatically placed on the waiting list.

The course requires some knowledge of Linux as a prerequisite. The
registration fee will be $300 (only $60 per day). There will be a
limited number of scholarships available.

Thanks,

Scott Cain

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
Ontario Institute for Cancer Research



From sajeet at gmail.com  Mon Jun 25 19:41:01 2012
From: sajeet at gmail.com (Sajeet Haridas)
Date: Mon, 25 Jun 2012 17:41:01 -0700
Subject: [maker-devel] ERROR: Chunk failed at level 20
Message-ID: <000001cd5334$5c955df0$15c019d0$@com>

Hello,

I am running Maker 2.10 on two versions (using two assembly programs) of a
fungal genome (~33Mbp). While one completes successfully, the other does
not. One of the scaffolds (out of 65) throws the following error.

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Calling translate without a seq argument!
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
STACK: Bio::Tools::CodonTable::translate
/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
STACK: PhatHit_utils::_adjust
/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
STACK: PhatHit_utils::adjust_start_stop
/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
STACK: maker::auto_annotator::load_transcript_struct
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
STACK: maker::auto_annotator::group_transcripts
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
STACK: maker::auto_annotator::annotate_genes
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
STACK: Process::MpiChunk::_go
/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
STACK: Process::MpiChunk::run
/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
STACK: Process::MpiTiers::run_all
/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
STACK: /opt/maker_2.10/bin/maker:276
-----------------------------------------------------------

FATAL ERROR
ERROR: Failed while clustering transcripts into genes for annotations!!

ERROR: Chunk failed at level 20
!!


Any help appreciated.

Thank you,

Sajeet




From carsonhh at gmail.com  Tue Jun 26 09:07:09 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 26 Jun 2012 10:07:09 -0400
Subject: [maker-devel] ERROR: Chunk failed at level 20
In-Reply-To: <000001cd5334$5c955df0$15c019d0$@com>
Message-ID: <CC0F3A2F.ED74%carsonhh@gmail.com>

Have you tried the most current version, 2.25?

Thanks,
Carson


On 12-06-25 8:41 PM, "Sajeet Haridas" <sajeet at gmail.com> wrote:

>Hello,
>
>I am running Maker 2.10 on two versions (using two assembly programs) of a
>fungal genome (~33Mbp). While one completes successfully, the other does
>not. One of the scaffolds (out of 65) throws the following error.
>
>------------- EXCEPTION: Bio::Root::Exception -------------
>MSG: Calling translate without a seq argument!
>STACK: Error::throw
>STACK: Bio::Root::Root::throw
>/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
>STACK: Bio::Tools::CodonTable::translate
>/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
>STACK: PhatHit_utils::_adjust
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
>STACK: PhatHit_utils::adjust_start_stop
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
>STACK: maker::auto_annotator::load_transcript_struct
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
>STACK: maker::auto_annotator::group_transcripts
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
>STACK: maker::auto_annotator::annotate_genes
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
>STACK: Process::MpiChunk::_go
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
>STACK: Process::MpiChunk::run
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
>STACK: Process::MpiTiers::run_all
>/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
>STACK: /opt/maker_2.10/bin/maker:276
>-----------------------------------------------------------
>
>FATAL ERROR
>ERROR: Failed while clustering transcripts into genes for annotations!!
>
>ERROR: Chunk failed at level 20
>!!
>
>
>Any help appreciated.
>
>Thank you,
>
>Sajeet
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From sajeet at gmail.com  Tue Jun 26 12:45:05 2012
From: sajeet at gmail.com (Sajeet Haridas)
Date: Tue, 26 Jun 2012 10:45:05 -0700
Subject: [maker-devel] ERROR: Chunk failed at level 20
In-Reply-To: <CC0F3A2F.ED74%carsonhh@gmail.com>
References: <000001cd5334$5c955df0$15c019d0$@com>
	<CC0F3A2F.ED74%carsonhh@gmail.com>
Message-ID: <000601cd53c3$6bed89f0$43c89dd0$@com>

Thank you.
It seems to work with 2.25.

Sajeet

-----Original Message-----
From: Carson Holt [mailto:carsonhh at gmail.com] 
Sent: June-26-12 7:07 AM
To: Sajeet Haridas; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] ERROR: Chunk failed at level 20

Have you tried the most current version, 2.25?

Thanks,
Carson


On 12-06-25 8:41 PM, "Sajeet Haridas" <sajeet at gmail.com> wrote:

>Hello,
>
>I am running Maker 2.10 on two versions (using two assembly programs) 
>of a fungal genome (~33Mbp). While one completes successfully, the 
>other does not. One of the scaffolds (out of 65) throws the following
error.
>
>------------- EXCEPTION: Bio::Root::Exception -------------
>MSG: Calling translate without a seq argument!
>STACK: Error::throw
>STACK: Bio::Root::Root::throw
>/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
>STACK: Bio::Tools::CodonTable::translate
>/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
>STACK: PhatHit_utils::_adjust
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
>STACK: PhatHit_utils::adjust_start_stop
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
>STACK: maker::auto_annotator::load_transcript_struct
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
>STACK: maker::auto_annotator::group_transcripts
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
>STACK: maker::auto_annotator::annotate_genes
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
>STACK: Process::MpiChunk::_go
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
>STACK: Process::MpiChunk::run
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
>STACK: Process::MpiTiers::run_all
>/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
>STACK: /opt/maker_2.10/bin/maker:276
>-----------------------------------------------------------
>
>FATAL ERROR
>ERROR: Failed while clustering transcripts into genes for annotations!!
>
>ERROR: Chunk failed at level 20
>!!
>
>
>Any help appreciated.
>
>Thank you,
>
>Sajeet
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org






From ranjani at uga.edu  Wed Jun 27 08:49:02 2012
From: ranjani at uga.edu (Sivaranjani Namasivayam)
Date: Wed, 27 Jun 2012 13:49:02 +0000
Subject: [maker-devel] Re-annotation
Message-ID: <A21F03FBB429334EB4D450CC75E8CBF3487DC468@CH1PRD0210MB384.namprd02.prod.outlook.com>

Hi,

I have a quick question about re-annotation. Under the re-annotation section, the provided maker's gff file from a previous run and set est_pass, altest_pass, protein_pass, rm_pass to 1.
I also provided some EST evidence (to the tag est) under the EST evidence section, but I don't see these ESTs being mapped to the genome (no blastn or est2genome) in the output gff files.
Is this expected?

Thanks,
Ranjani
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120627/f10008ce/attachment.html>

From carsonhh at gmail.com  Wed Jun 27 10:43:14 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 27 Jun 2012 11:43:14 -0400
Subject: [maker-devel] Re-annotation
In-Reply-To: <A21F03FBB429334EB4D450CC75E8CBF3487DC468@CH1PRD0210MB384.namprd02.prod.outlook.com>
Message-ID: <CC10A193.EDB9%carsonhh@gmail.com>

If the new ESTs don't map within the threshold parameters set in the
maker_bopt.ctl file, then you would not expect new results.  Don't be
surprised if the new results are just hard to identify within the context of
the ESTs already being passed back through.  If you want to test the new
ESTs, then set est_pass to 0 during your next run and see if there are still
no ESTs.

Thanks,
Carson



From:  Sivaranjani Namasivayam <ranjani at uga.edu>
Date:  Wednesday, 27 June, 2012 9:49 AM
To:  "maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  [maker-devel] Re-annotation

Hi,

I have a quick question about re-annotation. Under the re-annotation
section, the provided maker's gff file from a previous run and set est_pass,
altest_pass, protein_pass, rm_pass to 1.
I also provided some EST evidence (to the tag est) under the EST evidence
section, but I don't see these ESTs being mapped to the genome (no blastn or
est2genome) in the output gff files.
Is this expected?

Thanks,
Ranjani
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120627/4afce4ea/attachment.html>

From lei.liu.conze at slu.se  Wed Jun 27 09:26:35 2012
From: lei.liu.conze at slu.se (Lei Conze Liu)
Date: Wed, 27 Jun 2012 16:26:35 +0200
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
Message-ID: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>

Hi,

I just downloaded the recent version of maker-2.10.tgz but I can not
find the folder "bin" where contains the MAKER executables. Am I missing
something? It would be great if somebody can help me with that.

Greetings,

Lei

From carsonhh at gmail.com  Wed Jun 27 10:51:08 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 27 Jun 2012 11:51:08 -0400
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
Message-ID: <CC10A299.EDC3%carsonhh@gmail.com>

You need to go to the maker/src/ directory and run 'perl Build.PL'.  Then
run './Build install'.

Note that if you are by any chance are using the CPAN module 'local::lib'
on your system which redefines certain Perl installation parameters
affecting CPAN and Module::Build that those changes will cause MAKER (as
well as many other things in Perl) to install to a non-standard location
(in ~/perl5/bin usually) and if that is the case you should use maker
version 2.25 instead of 2.10 to get the install to complete correctly.

Thanks,
Carson





On 12-06-27 10:26 AM, "Lei Conze Liu" <lei.liu.conze at slu.se> wrote:

>Hi,
>
>I just downloaded the recent version of maker-2.10.tgz but I can not
>find the folder "bin" where contains the MAKER executables. Am I missing
>something? It would be great if somebody can help me with that.
>
>Greetings,
>
>Lei
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From lei.liu.conze at slu.se  Wed Jun 27 15:33:04 2012
From: lei.liu.conze at slu.se (Lei Conze Liu)
Date: Wed, 27 Jun 2012 22:33:04 +0200
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
References: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
Message-ID: <11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>

Dear all,

Thank you very much for the quick reply. I appreciate it very much.
I have indeed gone to the maker/src directory and have run 'perl Build.PL' and './Build install', but still misses the 'bin' folder.
As Carson have kindly pointed out that I might run into this kind of problem if I am using CPAN module 'local::lib' which I think I might be. So tomorrow I will try to install the 2.25 version and let you know how it goes.

Many thanks!

Greetings from Sweden

Lei


On 27 Jun 2012, at 16:26, Lei Conze Liu wrote:

Hi,

I just downloaded the recent version of maker-2.10.tgz but I can not
find the folder "bin" where contains the MAKER executables. Am I missing
something? It would be great if somebody can help me with that.

Greetings,

Lei
_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://box290.bluehost.com/pipermail/maker-devel_yandell-lab.org/attachments/20120627/44c08a8c/attachment.html>

From cjfields at illinois.edu  Wed Jun 27 15:41:25 2012
From: cjfields at illinois.edu (Fields, Christopher J)
Date: Wed, 27 Jun 2012 20:41:25 +0000
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>
References: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
	<11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>
Message-ID: <CC9C6F22-A8A4-4AE3-83BE-E0B5D20AD736@illinois.edu>

I got v2.25 working with local::lib myself.  I plan on using that along with a loadable module (via http://modules.sourceforge.net/) to make launching maker as easy as possible (and also allow us to keep separate contained versions on the cluster w/o having to bend over backwards with env settings).

chris

On Jun 27, 2012, at 3:33 PM, Lei Conze Liu wrote:

> Dear all,
> 
> Thank you very much for the quick reply. I appreciate it very much. 
> I have indeed gone to the maker/src directory and have run 'perl Build.PL' and './Build install', but still misses the 'bin' folder.
> As Carson have kindly pointed out that I might run into this kind of problem if I am using CPAN module 'local::lib' which I think I might be. So tomorrow I will try to install the 2.25 version and let you know how it goes. 
> 
> Many thanks!
> 
> Greetings from Sweden
> 
> Lei
> 
> 
> On 27 Jun 2012, at 16:26, Lei Conze Liu wrote:
> 
>> Hi,
>> 
>> I just downloaded the recent version of maker-2.10.tgz but I can not
>> find the folder "bin" where contains the MAKER executables. Am I missing
>> something? It would be great if somebody can help me with that.
>> 
>> Greetings,
>> 
>> Lei
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
> 
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org




From markus.ankenbrand at stud-mail.uni-wuerzburg.de  Thu Jun 28 09:03:20 2012
From: markus.ankenbrand at stud-mail.uni-wuerzburg.de (Markus Ankenbrand)
Date: Thu, 28 Jun 2012 16:03:20 +0200
Subject: [maker-devel] maker-2.24 fails while preparing evidence clusters
Message-ID: <4FEC6428.3010108@stud-mail.uni-wuerzburg.de>

Hi all,

I'm using maker-2.24 to annotate contigs of a procaryotic organism. I'm
only using coding sequences of a reference species as "altest". Without
any obvious reason annotation fails for some contigs. It seems to have
nothing to do with the contig length. I also tried to run maker with
different reference ESTs and GeneMark. Depending on the setup different
contigs fail.

In case of failure, the log is:
...
cleaning clusters....
total clusters:3 now processing 0
   ...processing 0 of 3
   ...processing 1 of 3
total clusters:3 now processing 0
total clusters:3 now processing 0
   ...processing 0 of 2
Can't call method "start" on an undefined valueERROR: Failed while
preparing evidence clusters for annotations
ERROR: Chunk failed at level:0, tier_type:3
FAILED CONTIG:contig1

ERROR: Chunk failed at level:7, tier_type:0
FAILED CONTIG:contig1

--Next Contig--
...

If someone has any idea how to solve this problem, help would be very
much apriciated.

Greetings,
Markus



From fourie.joubert at up.ac.za  Thu Jun 28 10:11:31 2012
From: fourie.joubert at up.ac.za (Fourie Joubert)
Date: Thu, 28 Jun 2012 17:11:31 +0200
Subject: [maker-devel] Advice for optimizing augustus training on fungal
	genome?
Message-ID: <4FEC7423.3050001@up.ac.za>

Hi Everyone

Apologies if this is not the relevant list to mail to.

I am looking for advice in training augustus for a novel fungal genome.

I generated a gene set using CEGMA (below), and have subsequently been 
following the instructions at 
http://www.molecularevolution.org/molevolfiles/exercises/augustus/scipio.html 
and at 
http://www.molecularevolution.org/molevolfiles/exercises/augustus/training.html.

My training set is 339 genes and the test set is 100 genes.

My initial output is below.

It does not improve much with optimize_augustus.

When using the training paramters to predict genes in the genome, I seem 
to only find around 2,000 of the known ~16,000 genes. When I use the 
training data from a distantly related fungus (Neurospora), I get 
roughly the correct number of genes.

I am obviously doing something wrong here... (commands below).

I would really appreciate any advice on where to start looking for 
improvement.

Kindest regards!

Fourie





Augustus commands (Editedmyspecies_parameters.cfg  and setstopCodonExcludedFromCDS  to true.):

>  etraining --species=myspecies genes.gb.train

>  augustus --species=myspecies genes.gb.test | tee firsttest.out

>  grep -A 22 Evaluation firsttest.out

>  optimize_augustus.pl --species=myspecies genes.gb.train

>  etraining --species=myspecies genes.gb.train

>  augustus --species=myspecies genes.gb.test | tee secondtest.out

>  grep -A 22 Evaluation secondtest.out



CEGMA output:

#      Statistics of the completeness of the genome based on 248 CEGs      #

               #Prots  %Completeness  -  #Total  Average  %Ortho

   Complete      240       96.77      -   278     1.16     11.67

    Group 1       64       96.97      -    72     1.12      7.81
    Group 2       54       96.43      -    66     1.22     18.52
    Group 3       58       95.08      -    70     1.21     13.79
    Group 4       64       98.46      -    70     1.09      7.81

    Partial      245       98.79      -   290     1.18     13.88

    Group 1       65       98.48      -    73     1.12      7.69
    Group 2       56      100.00      -    70     1.25     21.43
    Group 3       59       96.72      -    75     1.27     18.64
    Group 4       65      100.00      -    72     1.11      9.23




Augustus output:

*******      Evaluation of gene prediction     *******

---------------------------------------------\

                  | sensitivity | specificity |

---------------------------------------------|

nucleotide level |       0.933 |       0.772 |

---------------------------------------------/

----------------------------------------------------------------------------------------------------------\

            |  #pred |  #anno |      |    FP = false pos. |    FN = false neg. |             |             |

            | total/ | total/ |   TP |--------------------|--------------------| sensitivity | specificity |

            | unique | unique |      | part | ovlp | wrng | part | ovlp | wrng |             |             |

----------------------------------------------------------------------------------------------------------|

            |        |        |      |                229 |                 85 |             |             |

exon level |    475 |    331 |  246 | ------------------ | ------------------ |       0.743 |       0.518 |

            |    475 |    331 |      |   59 |    9 |  161 |   56 |    2 |   27 |             |             |

----------------------------------------------------------------------------------------------------------/

----------------------------------------------------------------------------\

transcript | #pred | #anno |   TP |   FP |   FN | sensitivity | specificity |

----------------------------------------------------------------------------|

gene level |   158 |   100 |   45 |  113 |   55 |        0.45 |       0.285 |

----------------------------------------------------------------------------/




-- 
--------------
Prof Fourie Joubert
Bioinformatics and Computational Biology Unit
Department of Biochemistry
University of Pretoria
fourie.joubert at up.ac.za
http://www.bi.up.ac.za
Tel. +27-12-420-5825
Fax. +27-12-420-5800

-------------------------------------------------------------------------
This message and attachments are subject to a disclaimer. Please refer
to www.it.up.ac.za/documentation/governance/disclaimer/ for full details.




From yogeshp08 at gmail.com  Fri Jun  1 10:56:13 2012
From: yogeshp08 at gmail.com (Yogesh)
Date: Fri, 1 Jun 2012 11:56:13 -0500
Subject: [maker-devel] tblastn Cleanup?
In-Reply-To: <CBDBD0A5.C8CD%carsonhh@gmail.com>
References: <CBDBD0A5.C8CD%carsonhh@gmail.com>
Message-ID: <E782BA7523C145C994B5BE8509009476@gmail.com>

Hi Carson,

Thanks a lot. This is helpful.

Also I wanted to ask how can I follow this up with exonerate polishing. Is there a module in MAKER that can run this separately on my BLAST results?

-Yogesh


On Friday, May 18, 2012 at 9:22 AM, Carson Holt wrote:

> There are several things.  I set several filtering options directly on the BLAST command line.  These are things like maximum intron length, an e-value filter, and simple repeat filtering (called dust filter in NCBI blast and seg filter in WUBLAST).
> 
> I also run repeat masker over the genome first.  This allows simple and complex repeats to be removed before running BLAST (otherwise you get many false alignments).
> 
> Last I filter the results based on percent coverage of the hit to the original database sequence and percent identity.  I think you can set percent identity as a flag in BLAST, but the percent coverage filter is being calculated by MAKER, so to do this outside of MAKER would require that you write your own filtering script to compare the length of the alignment to the length of the sequence in the database.
> 
> I also have an HSP depth overlap filter.  This removes weird low complexity hits that escape repeatmasking.  They show up as multiple HSPs overlapping multiple times in the same region (usually very high numbers like 90 HSPs all 100 bp long in the same region).  I calculate the number of base pairs in the alignment on the hit then divide by the number of base pairs in the query alignment.  If it's greater than 3, I throw the hit out.
> 
> Thanks,
> Carson
> 
> 
> 
> From: Yogesh <yogeshp08 at gmail.com (mailto:yogeshp08 at gmail.com)>
> Date: Tuesday, 15 May, 2012 12:07 PM
> To: <maker-devel at yandell-lab.org (mailto:maker-devel at yandell-lab.org)>
> Subject: [maker-devel] tblastn Cleanup?
> 
> Hello,
> 
> I have a few tblastn alignments with a lot of low quality hits. I have to clean that up. Can you please suggest how Maker pipeline does it? Also can I run it directly on my data without having to go through the whole pipeline?
> 
> Thanks,
> 
> -Yogesh
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/71d95d76/attachment-0001.html>

From carsonhh at gmail.com  Fri Jun  1 11:01:50 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 13:01:50 -0400
Subject: [maker-devel] tblastn Cleanup?
In-Reply-To: <E782BA7523C145C994B5BE8509009476@gmail.com>
Message-ID: <CBEE6CF1.D401%carsonhh@gmail.com>

MAKER does this in the GI library file (function --> GI::polish_exonerate).
You might have to do some coding to modify it to work in your own scripts.
It has multiple dependencies on other MAKER library files including
exonerate::splice_info, Widget::exonerate::est2genome, and
Widget::exonerate::protein2genome.

Thanks,
Carson

From:  Yogesh <yogeshp08 at gmail.com>
Date:  Friday, 1 June, 2012 12:56 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] tblastn Cleanup?

 
Hi Carson,

Thanks a lot. This is helpful.

Also I wanted to ask how can I follow this up with exonerate polishing. Is
there a module in MAKER that can run this separately on my BLAST results?

-Yogesh

  

On Friday, May 18, 2012 at 9:22 AM, Carson Holt wrote:
> 
>  
> There are several things.  I set several filtering options directly on the
> BLAST command line.  These are things like maximum intron length, an e-value
> filter, and simple repeat filtering (called dust filter in NCBI blast and seg
> filter in WUBLAST).
> 
> I also run repeat masker over the genome first.  This allows simple and
> complex repeats to be removed before running BLAST (otherwise you get many
> false alignments).
> 
> Last I filter the results based on percent coverage of the hit to the original
> database sequence and percent identity.  I think you can set percent identity
> as a flag in BLAST, but the percent coverage filter is being calculated by
> MAKER, so to do this outside of MAKER would require that you write your own
> filtering script to compare the length of the alignment to the length of the
> sequence in the database.
> 
> I also have an HSP depth overlap filter.  This removes weird low complexity
> hits that escape repeatmasking.  They show up as multiple HSPs overlapping
> multiple times in the same region (usually very high numbers like 90 HSPs all
> 100 bp long in the same region).  I calculate the number of base pairs in the
> alignment on the hit then divide by the number of base pairs in the query
> alignment.  If it's greater than 3, I throw the hit out.
> 
> Thanks,
> Carson
> 
> 
> 
> From:  Yogesh <yogeshp08 at gmail.com>
> Date:  Tuesday, 15 May, 2012 12:07 PM
> To:  <maker-devel at yandell-lab.org>
> Subject:  [maker-devel] tblastn Cleanup?
> 
>  
> Hello,
> 
> I have a few tblastn alignments with a lot of low quality hits. I have to
> clean that up. Can you please suggest how Maker pipeline does it? Also can I
> run it directly on my data without having to go through the whole pipeline?
> 
> Thanks,
> 
> -Yogesh


-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/e145c056/attachment-0001.html>

From barry.moore at genetics.utah.edu  Fri Jun  1 12:22:56 2012
From: barry.moore at genetics.utah.edu (Barry Moore)
Date: Fri, 1 Jun 2012 12:22:56 -0600
Subject: [maker-devel] Can maker select a gene model based
	on	#algoritham predicted it
In-Reply-To: <CBEB8E25.D097%carsonhh@gmail.com>
References: <CBEB8E25.D097%carsonhh@gmail.com>
Message-ID: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543




-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/1a78f472/attachment-0001.html>

From carsonhh at gmail.com  Fri Jun  1 12:41:53 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 14:41:53 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>
Message-ID: <CBEE8148.D418%carsonhh@gmail.com>

While I could add an option to keep them if there are more than one, the
actual implementation is not as trivial as it seems.  On some organisms like
fungi and oomycetes, the predictions that don't overlap evidence tend to be
similar to each other across predictors, but on other eukaryotes with
difficult and complex intron/exon structure like lamprey or even planaria
about the only time two predictors will produce similar results coorelated
with when there is evidence supporting them, and all the unsupported regions
are messy with weird partial overlaps (sometimes even conflicting reading
frames).  I have a figure in the MAKER2 paper showing how poorly these
algorithms perform on such organisms and how additional evidence based
feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant
non-overlapping proteins recorded at the end of a MAKER run uses a complex
variant of the AED calculation across the alternate predictions to build a
consensus.  So in short it's not exactly as simple as just saying there are
two predictions at a given locus.  It would require some thought (as well as
good documentation), but it could probably be done.

--Carson

From:  Barry Moore <barry.moore at genetics.utah.edu>
Date:  Friday, 1 June, 2012 2:22 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

Carson,

How hard would it be to have maker take an option something like
'require_abinits=2' that would instruct maker to promote predictions that
overlap with (2, 3 or more) other predictions?  Seems like the maker might
have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.
I've got an offline copy of a newer tutorial wiki that is more up to date
than the GMOD version.  It's on a server right now that we've got locked
behind a firewall, but I'm hoping to move that to a public facing server in
the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/a3ab059e/attachment-0001.html>

From carsonhh at gmail.com  Fri Jun  1 12:52:46 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 14:52:46 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8543.D43A%carsonhh@gmail.com>
Message-ID: <CBEE8622.D43F%carsonhh@gmail.com>

One idea related to this.  I could have keep_preds be a floating point value
between 0 and 1.  This would then represent a threshold for an internal
MAKER value called the ab-initio AED (it already exists internally deep in
MAKER).  0 would turn keep_preds off (as it does now), 1 would keep
everything (as it does now), and values in between would allow the user to
dial in the degree of consensus among overlapping predictions when
considering them without evidence.  The ab-initio AED already works similar
to AED, with 0 being perfect concordance and 1 being complete discordance.

--Carson



From:  Carson Holt <carsonhh at gmail.com>
Date:  Friday, 1 June, 2012 2:41 PM
To:  Barry Moore <barry.moore at genetics.utah.edu>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

While I could add an option to keep them if there are more than one, the
actual implementation is not as trivial as it seems.  On some organisms like
fungi and oomycetes, the predictions that don't overlap evidence tend to be
similar to each other across predictors, but on other eukaryotes with
difficult and complex intron/exon structure like lamprey or even planaria
about the only time two predictors will produce similar results coorelated
with when there is evidence supporting them, and all the unsupported regions
are messy with weird partial overlaps (sometimes even conflicting reading
frames).  I have a figure in the MAKER2 paper showing how poorly these
algorithms perform on such organisms and how additional evidence based
feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant
non-overlapping proteins recorded at the end of a MAKER run uses a complex
variant of the AED calculation across the alternate predictions to build a
consensus.  So in short it's not exactly as simple as just saying there are
two predictions at a given locus.  It would require some thought (as well as
good documentation), but it could probably be done.

--Carson

From:  Barry Moore <barry.moore at genetics.utah.edu>
Date:  Friday, 1 June, 2012 2:22 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

Carson,

How hard would it be to have maker take an option something like
'require_abinits=2' that would instruct maker to promote predictions that
overlap with (2, 3 or more) other predictions?  Seems like the maker might
have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.
I've got an offline copy of a newer tutorial wiki that is more up to date
than the GMOD version.  It's on a server right now that we've got locked
behind a firewall, but I'm hoping to move that to a public facing server in
the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/11d85f8f/attachment-0001.html>

From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 13:06:30 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:06:30 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8148.D418%carsonhh@gmail.com>
References: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>,
	<CBEE8148.D418%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F903@mail02.sbri.org>

Hi Carson,
I agree with you mostly. Its better to have some form of evidence (blast, pfam etc) to call something as a coding gene. Genes that dont have evidence are hard to interpret anyway. But, in the organism we work on (Malaria and Leishmania parasites) we tend to see 100s of genus specific genes. Of course, as you would suspect, their biological/functional significance is not known. They remain as hypothetical proteins for years. But, the researchers still would like to lean towards slight over prediction over under prediction. 

Here is the approach i follow. I collect NON redundant set of proteins from all the related genus to supply as evidence in Maker. I run Augustus and Genemark inside Maker. Also supply gene models from another ab-initio gene prediction suite (automagi-our parasite specific). Automagi in-trun runs 3 algorithm and chooses a consensus gene model.  In short i run 5 gene predictors and chose anything that is predicted by 3. And predictions need NOT overlap to their entire length (this helps us to pull genes that are separated into two due to frame shifts). 

Yesterday, I wrote a small script, that takes all features predicted by MAKER compares them with 3 gffs (of Automagi=3, Augustus, Genemark). I keep_pred=1. It counts if a Maker chosen gene overlaps with prediction from at least 3 of 5 algorithms.

Hi Barry,
Thanks for letting me contribute to the wiki. Most of the edits i thought of is from discussing with Carson. I thought, doing so will save him bit more time from emailing in future. Its possible you got most of it already in latest wiki.  Something like, how to train Genemark. Its really hard to find it in their documentation. I learned it from one of Carson's earlier discussion.  My two cents.

Thanks,
Gowthaman

Carson: Thanks for the great tool. And thanks for every GREATER support. 

  
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 11:41 AM
To: Barry Moore
Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

While I could add an option to keep them if there are more than one, the actual implementation is not as trivial as it seems.  On some organisms like fungi and oomycetes, the predictions that don't overlap evidence tend to be similar to each other across predictors, but on other eukaryotes with difficult and complex intron/exon structure like lamprey or even planaria about the only time two predictors will produce similar results coorelated with when there is evidence supporting them, and all the unsupported regions are messy with weird partial overlaps (sometimes even conflicting reading frames).  I have a figure in the MAKER2 paper showing how poorly these algorithms perform on such organisms and how additional evidence based feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant non-overlapping proteins recorded at the end of a MAKER run uses a complex variant of the AED calculation across the alternate predictions to build a consensus.  So in short it's not exactly as simple as just saying there are two predictions at a given locus.  It would require some thought (as well as good documentation), but it could probably be done.

--Carson

From: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Date: Friday, 1 June, 2012 2:22 PM
To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

It's not an option in exactly the way you are specifying, but there is
something I usually do for annotation that works well.  I run interproscan
or rpsblast on the non_overlapping.proteins.fasta file and select just
those non-overlapping models that have a recognizable protein domain (just
searching the pfam doamin space is more than sufficient).  Then I provide
the selected results to model_gff, and provide the previous maker results
to the maker_gff option with (all reannotation pass options set to 1 and
all analysis options turned off).  This adds models with at least
recognizable domains (as even multiple gene predictors can overpredict in
a similar way).

Attached is a script to help select predictions and upgrade them to models
in GFF3 format.  If you have question let me know.

Thanks,
Carson



On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>> wrote:

Hi Carson,
Thanks for all the help during the long weekend, in spite of that long
drive. I am still trying to imagine that.

I now have maker to consider our own prediction via pred_gff, and use
augustus and gene mark (with our training model). And i was able to use
altest and protein evidences. Maker happily picks one gene model when
there is a overlap between three different predictions. But, when I look
at the gff, it seems like it picks a gene model only when there is an
est/protein evidence. It leaves out some genes even though, they are
predicted by all three algorithms. Of course, keep_pred=1 helps to keep
all the models. This kind of leads to over prediction.

But, I am looking for something in between. And would like to know if
that is possible?
1) Pick a gene model if it has an evidence from (est/prot etc...)
irrespective of how many algorithms predicted it
2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
if that is predicted by at least two algorithms.

Or even simpler:
I have ab-initio predictions from three algorithms, Can I output, those
genes that is supported by at least two of them. I care less about
exactness of gene boundaries.

Thanks,
Gowthaman

PS: With my recent attempts, i learned couple things about maker/other
associated tools that is not documented in gmod-maker wiki. Is it
possible/ok if I add contents to it. I am okay with running it by you
before making it public.

<gff3_preds2models>_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 13:07:18 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:07:18 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8622.D43F%carsonhh@gmail.com>
References: <CBEE8543.D43A%carsonhh@gmail.com>,
	<CBEE8622.D43F%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>

That sounds really good. 

Just wondering what would that float point mean? 

fraction of gene prediction algorithms predicted that region to contain a gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms predicted it?? 
Or 
it just indicates lever of concordance (in maker language) and user has to try different values before settling on one?

Thanks,
gowthaman
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 11:52 AM
To: Barry Moore
Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

One idea related to this.  I could have keep_preds be a floating point value between 0 and 1.  This would then represent a threshold for an internal MAKER value called the ab-initio AED (it already exists internally deep in MAKER).  0 would turn keep_preds off (as it does now), 1 would keep everything (as it does now), and values in between would allow the user to dial in the degree of consensus among overlapping predictions when considering them without evidence.  The ab-initio AED already works similar to AED, with 0 being perfect concordance and 1 being complete discordance.

--Carson



From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Date: Friday, 1 June, 2012 2:41 PM
To: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

While I could add an option to keep them if there are more than one, the actual implementation is not as trivial as it seems.  On some organisms like fungi and oomycetes, the predictions that don't overlap evidence tend to be similar to each other across predictors, but on other eukaryotes with difficult and complex intron/exon structure like lamprey or even planaria about the only time two predictors will produce similar results coorelated with when there is evidence supporting them, and all the unsupported regions are messy with weird partial overlaps (sometimes even conflicting reading frames).  I have a figure in the MAKER2 paper showing how poorly these algorithms perform on such organisms and how additional evidence based feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant non-overlapping proteins recorded at the end of a MAKER run uses a complex variant of the AED calculation across the alternate predictions to build a consensus.  So in short it's not exactly as simple as just saying there are two predictions at a given locus.  It would require some thought (as well as good documentation), but it could probably be done.

--Carson

From: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Date: Friday, 1 June, 2012 2:22 PM
To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

It's not an option in exactly the way you are specifying, but there is
something I usually do for annotation that works well.  I run interproscan
or rpsblast on the non_overlapping.proteins.fasta file and select just
those non-overlapping models that have a recognizable protein domain (just
searching the pfam doamin space is more than sufficient).  Then I provide
the selected results to model_gff, and provide the previous maker results
to the maker_gff option with (all reannotation pass options set to 1 and
all analysis options turned off).  This adds models with at least
recognizable domains (as even multiple gene predictors can overpredict in
a similar way).

Attached is a script to help select predictions and upgrade them to models
in GFF3 format.  If you have question let me know.

Thanks,
Carson



On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>> wrote:

Hi Carson,
Thanks for all the help during the long weekend, in spite of that long
drive. I am still trying to imagine that.

I now have maker to consider our own prediction via pred_gff, and use
augustus and gene mark (with our training model). And i was able to use
altest and protein evidences. Maker happily picks one gene model when
there is a overlap between three different predictions. But, when I look
at the gff, it seems like it picks a gene model only when there is an
est/protein evidence. It leaves out some genes even though, they are
predicted by all three algorithms. Of course, keep_pred=1 helps to keep
all the models. This kind of leads to over prediction.

But, I am looking for something in between. And would like to know if
that is possible?
1) Pick a gene model if it has an evidence from (est/prot etc...)
irrespective of how many algorithms predicted it
2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
if that is predicted by at least two algorithms.

Or even simpler:
I have ab-initio predictions from three algorithms, Can I output, those
genes that is supported by at least two of them. I care less about
exactness of gene boundaries.

Thanks,
Gowthaman

PS: With my recent attempts, i learned couple things about maker/other
associated tools that is not documented in gmod-maker wiki. Is it
possible/ok if I add contents to it. I am okay with running it by you
before making it public.

<gff3_preds2models>_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543







From carsonhh at gmail.com  Fri Jun  1 13:23:59 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 15:23:59 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>
Message-ID: <CBEE8C00.D465%carsonhh@gmail.com>

The metric AED is Annotation Edit Distance (original paper -->
http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
the sensitivity/specificity measure used to quantify the performance of
gene predictors and can be used to measure changes in gene models across
releases, and I further adapted use it for some slightly different purpose
than given in the original paper above.

This is copied from the MAKER2 paper -->
"Given a gene prediction i and a reference j, the base pair level
sensitivity can be calculated using the formula SN = |i?j|/|j|; where
|i?j| represents the number overlapping nucleotides between i and j, and
|j| represents the total number of nucleotides in the reference j.
Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
and accuracy is the average of the two.  Because we are not comparing to a
high quality reference (reference is arbitrary for AED), it is more
correct to refer to the average of sensitivity and specificity as the
congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
distance between i and j, then becomes D = 1-C, with a value of 0
indicating complete agreement of an annotation to the evidence, and values
at or near 1 indicating disagreement or no evidence support."



The ab-initio AED in comparison is the pairwise AED calculated between
each overlapping prediction and then averaged.  Each pair then have a
score representing it's average distance from the overlapping set of
predictions as a whole.  So a value of .1 would be 10% average
incongruency or 90% average congruency.

Thanks,
Carson



On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>That sounds really good.
>
>Just wondering what would that float point mean?
>
>fraction of gene prediction algorithms predicted that region to contain a
>gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>predicted it?? 
>Or 
>it just indicates lever of concordance (in maker language) and user has
>to try different values before settling on one?
>
>Thanks,
>gowthaman
>________________________________________
>From: Carson Holt [carsonhh at gmail.com]
>Sent: Friday, June 01, 2012 11:52 AM
>To: Barry Moore
>Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>One idea related to this.  I could have keep_preds be a floating point
>value between 0 and 1.  This would then represent a threshold for an
>internal MAKER value called the ab-initio AED (it already exists
>internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>1 would keep everything (as it does now), and values in between would
>allow the user to dial in the degree of consensus among overlapping
>predictions when considering them without evidence.  The ab-initio AED
>already works similar to AED, with 0 being perfect concordance and 1
>being complete discordance.
>
>--Carson
>
>
>
>From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Date: Friday, 1 June, 2012 2:41 PM
>To: Barry Moore 
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>, 
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>While I could add an option to keep them if there are more than one, the
>actual implementation is not as trivial as it seems.  On some organisms
>like fungi and oomycetes, the predictions that don't overlap evidence
>tend to be similar to each other across predictors, but on other
>eukaryotes with difficult and complex intron/exon structure like lamprey
>or even planaria about the only time two predictors will produce similar
>results coorelated with when there is evidence supporting them, and all
>the unsupported regions are messy with weird partial overlaps (sometimes
>even conflicting reading frames).  I have a figure in the MAKER2 paper
>showing how poorly these algorithms perform on such organisms and how
>additional evidence based feedback provided by MAKER produces
>dramatically improved results.
>
>The way I get around the issues when choosing the non-redundant
>non-overlapping proteins recorded at the end of a MAKER run uses a
>complex variant of the AED calculation across the alternate predictions
>to build a consensus.  So in short it's not exactly as simple as just
>saying there are two predictions at a given locus.  It would require some
>thought (as well as good documentation), but it could probably be done.
>
>--Carson
>
>From: Barry Moore 
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Date: Friday, 1 June, 2012 2:22 PM
>To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>, 
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>Carson,
>
>How hard would it be to have maker take an option something like
>'require_abinits=2' that would instruct maker to promote predictions that
>overlap with (2, 3 or more) other predictions?  Seems like the maker
>might have all that info in one place at some point already?
>
>Gowthaman, your contributions to the maker tutorial would be most
>welcome.  I've got an offline copy of a newer tutorial wiki that is more
>up to date than the GMOD version.  It's on a server right now that we've
>got locked behind a firewall, but I'm hoping to move that to a public
>facing server in the next week and I'd be happy to give you an account on
>the wiki.
>
>B
>
>On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>
>It's not an option in exactly the way you are specifying, but there is
>something I usually do for annotation that works well.  I run interproscan
>or rpsblast on the non_overlapping.proteins.fasta file and select just
>those non-overlapping models that have a recognizable protein domain (just
>searching the pfam doamin space is more than sufficient).  Then I provide
>the selected results to model_gff, and provide the previous maker results
>to the maker_gff option with (all reannotation pass options set to 1 and
>all analysis options turned off).  This adds models with at least
>recognizable domains (as even multiple gene predictors can overpredict in
>a similar way).
>
>Attached is a script to help select predictions and upgrade them to models
>in GFF3 format.  If you have question let me know.
>
>Thanks,
>Carson
>
>
>
>On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>> wrote:
>
>Hi Carson,
>Thanks for all the help during the long weekend, in spite of that long
>drive. I am still trying to imagine that.
>
>I now have maker to consider our own prediction via pred_gff, and use
>augustus and gene mark (with our training model). And i was able to use
>altest and protein evidences. Maker happily picks one gene model when
>there is a overlap between three different predictions. But, when I look
>at the gff, it seems like it picks a gene model only when there is an
>est/protein evidence. It leaves out some genes even though, they are
>predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>all the models. This kind of leads to over prediction.
>
>But, I am looking for something in between. And would like to know if
>that is possible?
>1) Pick a gene model if it has an evidence from (est/prot etc...)
>irrespective of how many algorithms predicted it
>2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>if that is predicted by at least two algorithms.
>
>Or even simpler:
>I have ab-initio predictions from three algorithms, Can I output, those
>genes that is supported by at least two of them. I care less about
>exactness of gene boundaries.
>
>Thanks,
>Gowthaman
>
>PS: With my recent attempts, i learned couple things about maker/other
>associated tools that is not documented in gmod-maker wiki. Is it
>possible/ok if I add contents to it. I am okay with running it by you
>before making it public.
>
><gff3_preds2models>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>Barry Moore
>Research Scientist
>Dept. of Human Genetics
>University of Utah
>Salt Lake City, UT 84112
>--------------------------------------------
>(801) 585-3543
>
>
>
>





From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 13:28:21 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:28:21 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8C00.D465%carsonhh@gmail.com>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>,
	<CBEE8C00.D465%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F906@mail02.sbri.org>

That sounds really neat. I will read those papers. Thanks for sharing.

Gowthaman
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 12:23 PM
To: Gowthaman Ramasamy; Barry Moore
Cc: maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

The metric AED is Annotation Edit Distance (original paper -->
http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
the sensitivity/specificity measure used to quantify the performance of
gene predictors and can be used to measure changes in gene models across
releases, and I further adapted use it for some slightly different purpose
than given in the original paper above.

This is copied from the MAKER2 paper -->
"Given a gene prediction i and a reference j, the base pair level
sensitivity can be calculated using the formula SN = |i?j|/|j|; where
|i?j| represents the number overlapping nucleotides between i and j, and
|j| represents the total number of nucleotides in the reference j.
Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
and accuracy is the average of the two.  Because we are not comparing to a
high quality reference (reference is arbitrary for AED), it is more
correct to refer to the average of sensitivity and specificity as the
congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
distance between i and j, then becomes D = 1-C, with a value of 0
indicating complete agreement of an annotation to the evidence, and values
at or near 1 indicating disagreement or no evidence support."



The ab-initio AED in comparison is the pairwise AED calculated between
each overlapping prediction and then averaged.  Each pair then have a
score representing it's average distance from the overlapping set of
predictions as a whole.  So a value of .1 would be 10% average
incongruency or 90% average congruency.

Thanks,
Carson



On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>That sounds really good.
>
>Just wondering what would that float point mean?
>
>fraction of gene prediction algorithms predicted that region to contain a
>gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>predicted it??
>Or
>it just indicates lever of concordance (in maker language) and user has
>to try different values before settling on one?
>
>Thanks,
>gowthaman
>________________________________________
>From: Carson Holt [carsonhh at gmail.com]
>Sent: Friday, June 01, 2012 11:52 AM
>To: Barry Moore
>Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>One idea related to this.  I could have keep_preds be a floating point
>value between 0 and 1.  This would then represent a threshold for an
>internal MAKER value called the ab-initio AED (it already exists
>internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>1 would keep everything (as it does now), and values in between would
>allow the user to dial in the degree of consensus among overlapping
>predictions when considering them without evidence.  The ab-initio AED
>already works similar to AED, with 0 being perfect concordance and 1
>being complete discordance.
>
>--Carson
>
>
>
>From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Date: Friday, 1 June, 2012 2:41 PM
>To: Barry Moore
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>,
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>While I could add an option to keep them if there are more than one, the
>actual implementation is not as trivial as it seems.  On some organisms
>like fungi and oomycetes, the predictions that don't overlap evidence
>tend to be similar to each other across predictors, but on other
>eukaryotes with difficult and complex intron/exon structure like lamprey
>or even planaria about the only time two predictors will produce similar
>results coorelated with when there is evidence supporting them, and all
>the unsupported regions are messy with weird partial overlaps (sometimes
>even conflicting reading frames).  I have a figure in the MAKER2 paper
>showing how poorly these algorithms perform on such organisms and how
>additional evidence based feedback provided by MAKER produces
>dramatically improved results.
>
>The way I get around the issues when choosing the non-redundant
>non-overlapping proteins recorded at the end of a MAKER run uses a
>complex variant of the AED calculation across the alternate predictions
>to build a consensus.  So in short it's not exactly as simple as just
>saying there are two predictions at a given locus.  It would require some
>thought (as well as good documentation), but it could probably be done.
>
>--Carson
>
>From: Barry Moore
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Date: Friday, 1 June, 2012 2:22 PM
>To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>,
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>Carson,
>
>How hard would it be to have maker take an option something like
>'require_abinits=2' that would instruct maker to promote predictions that
>overlap with (2, 3 or more) other predictions?  Seems like the maker
>might have all that info in one place at some point already?
>
>Gowthaman, your contributions to the maker tutorial would be most
>welcome.  I've got an offline copy of a newer tutorial wiki that is more
>up to date than the GMOD version.  It's on a server right now that we've
>got locked behind a firewall, but I'm hoping to move that to a public
>facing server in the next week and I'd be happy to give you an account on
>the wiki.
>
>B
>
>On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>
>It's not an option in exactly the way you are specifying, but there is
>something I usually do for annotation that works well.  I run interproscan
>or rpsblast on the non_overlapping.proteins.fasta file and select just
>those non-overlapping models that have a recognizable protein domain (just
>searching the pfam doamin space is more than sufficient).  Then I provide
>the selected results to model_gff, and provide the previous maker results
>to the maker_gff option with (all reannotation pass options set to 1 and
>all analysis options turned off).  This adds models with at least
>recognizable domains (as even multiple gene predictors can overpredict in
>a similar way).
>
>Attached is a script to help select predictions and upgrade them to models
>in GFF3 format.  If you have question let me know.
>
>Thanks,
>Carson
>
>
>
>On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>> wrote:
>
>Hi Carson,
>Thanks for all the help during the long weekend, in spite of that long
>drive. I am still trying to imagine that.
>
>I now have maker to consider our own prediction via pred_gff, and use
>augustus and gene mark (with our training model). And i was able to use
>altest and protein evidences. Maker happily picks one gene model when
>there is a overlap between three different predictions. But, when I look
>at the gff, it seems like it picks a gene model only when there is an
>est/protein evidence. It leaves out some genes even though, they are
>predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>all the models. This kind of leads to over prediction.
>
>But, I am looking for something in between. And would like to know if
>that is possible?
>1) Pick a gene model if it has an evidence from (est/prot etc...)
>irrespective of how many algorithms predicted it
>2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>if that is predicted by at least two algorithms.
>
>Or even simpler:
>I have ab-initio predictions from three algorithms, Can I output, those
>genes that is supported by at least two of them. I care less about
>exactness of gene boundaries.
>
>Thanks,
>Gowthaman
>
>PS: With my recent attempts, i learned couple things about maker/other
>associated tools that is not documented in gmod-maker wiki. Is it
>possible/ok if I add contents to it. I am okay with running it by you
>before making it public.
>
><gff3_preds2models>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>Barry Moore
>Research Scientist
>Dept. of Human Genetics
>University of Utah
>Salt Lake City, UT 84112
>--------------------------------------------
>(801) 585-3543
>
>
>
>





From barry.moore at genetics.utah.edu  Fri Jun  1 14:39:25 2012
From: barry.moore at genetics.utah.edu (Barry Moore)
Date: Fri, 1 Jun 2012 14:39:25 -0600
Subject: [maker-devel] Can maker select a gene model based on
	#algoritham predicted it
In-Reply-To: <CBEE8C00.D465%carsonhh@gmail.com>
References: <CBEE8C00.D465%carsonhh@gmail.com>
Message-ID: <B876750E-47CD-4DEC-81F1-5E5EC5F6B754@genetics.utah.edu>

I like this a lot Carson - for two reasons:  First, it sounds like it's fairly easy to implement with that data and code that already exists within MAKER! And second it sounds like the right way to be doing this - the more the abintis agree the more likely to they are to be correct.

B

On Jun 1, 2012, at 1:23 PM, Carson Holt wrote:

> The metric AED is Annotation Edit Distance (original paper -->
> http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
> the sensitivity/specificity measure used to quantify the performance of
> gene predictors and can be used to measure changes in gene models across
> releases, and I further adapted use it for some slightly different purpose
> than given in the original paper above.
> 
> This is copied from the MAKER2 paper -->
> "Given a gene prediction i and a reference j, the base pair level
> sensitivity can be calculated using the formula SN = |i?j|/|j|; where
> |i?j| represents the number overlapping nucleotides between i and j, and
> |j| represents the total number of nucleotides in the reference j.
> Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
> and accuracy is the average of the two.  Because we are not comparing to a
> high quality reference (reference is arbitrary for AED), it is more
> correct to refer to the average of sensitivity and specificity as the
> congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
> distance between i and j, then becomes D = 1-C, with a value of 0
> indicating complete agreement of an annotation to the evidence, and values
> at or near 1 indicating disagreement or no evidence support."
> 
> 
> 
> The ab-initio AED in comparison is the pairwise AED calculated between
> each overlapping prediction and then averaged.  Each pair then have a
> score representing it's average distance from the overlapping set of
> predictions as a whole.  So a value of .1 would be 10% average
> incongruency or 90% average congruency.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> That sounds really good.
>> 
>> Just wondering what would that float point mean?
>> 
>> fraction of gene prediction algorithms predicted that region to contain a
>> gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>> predicted it?? 
>> Or 
>> it just indicates lever of concordance (in maker language) and user has
>> to try different values before settling on one?
>> 
>> Thanks,
>> gowthaman
>> ________________________________________
>> From: Carson Holt [carsonhh at gmail.com]
>> Sent: Friday, June 01, 2012 11:52 AM
>> To: Barry Moore
>> Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> One idea related to this.  I could have keep_preds be a floating point
>> value between 0 and 1.  This would then represent a threshold for an
>> internal MAKER value called the ab-initio AED (it already exists
>> internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>> 1 would keep everything (as it does now), and values in between would
>> allow the user to dial in the degree of consensus among overlapping
>> predictions when considering them without evidence.  The ab-initio AED
>> already works similar to AED, with 0 being perfect concordance and 1
>> being complete discordance.
>> 
>> --Carson
>> 
>> 
>> 
>> From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>> Date: Friday, 1 June, 2012 2:41 PM
>> To: Barry Moore 
>> <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>> Cc: Gowthaman Ramasamy
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>>, 
>> "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
>> <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> While I could add an option to keep them if there are more than one, the
>> actual implementation is not as trivial as it seems.  On some organisms
>> like fungi and oomycetes, the predictions that don't overlap evidence
>> tend to be similar to each other across predictors, but on other
>> eukaryotes with difficult and complex intron/exon structure like lamprey
>> or even planaria about the only time two predictors will produce similar
>> results coorelated with when there is evidence supporting them, and all
>> the unsupported regions are messy with weird partial overlaps (sometimes
>> even conflicting reading frames).  I have a figure in the MAKER2 paper
>> showing how poorly these algorithms perform on such organisms and how
>> additional evidence based feedback provided by MAKER produces
>> dramatically improved results.
>> 
>> The way I get around the issues when choosing the non-redundant
>> non-overlapping proteins recorded at the end of a MAKER run uses a
>> complex variant of the AED calculation across the alternate predictions
>> to build a consensus.  So in short it's not exactly as simple as just
>> saying there are two predictions at a given locus.  It would require some
>> thought (as well as good documentation), but it could probably be done.
>> 
>> --Carson
>> 
>> From: Barry Moore 
>> <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>> Date: Friday, 1 June, 2012 2:22 PM
>> To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>> Cc: Gowthaman Ramasamy
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>>, 
>> "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
>> <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> Carson,
>> 
>> How hard would it be to have maker take an option something like
>> 'require_abinits=2' that would instruct maker to promote predictions that
>> overlap with (2, 3 or more) other predictions?  Seems like the maker
>> might have all that info in one place at some point already?
>> 
>> Gowthaman, your contributions to the maker tutorial would be most
>> welcome.  I've got an offline copy of a newer tutorial wiki that is more
>> up to date than the GMOD version.  It's on a server right now that we've
>> got locked behind a firewall, but I'm hoping to move that to a public
>> facing server in the next week and I'd be happy to give you an account on
>> the wiki.
>> 
>> B
>> 
>> On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>> 
>> It's not an option in exactly the way you are specifying, but there is
>> something I usually do for annotation that works well.  I run interproscan
>> or rpsblast on the non_overlapping.proteins.fasta file and select just
>> those non-overlapping models that have a recognizable protein domain (just
>> searching the pfam doamin space is more than sufficient).  Then I provide
>> the selected results to model_gff, and provide the previous maker results
>> to the maker_gff option with (all reannotation pass options set to 1 and
>> all analysis options turned off).  This adds models with at least
>> recognizable domains (as even multiple gene predictors can overpredict in
>> a similar way).
>> 
>> Attached is a script to help select predictions and upgrade them to models
>> in GFF3 format.  If you have question let me know.
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>> wrote:
>> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
>> 
>> <gff3_preds2models>_______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> Barry Moore
>> Research Scientist
>> Dept. of Human Genetics
>> University of Utah
>> Salt Lake City, UT 84112
>> --------------------------------------------
>> (801) 585-3543
>> 
>> 
>> 
>> 
> 
> 

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543




-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/c444140d/attachment-0001.html>

From weckalba at asu.edu  Mon Jun  4 11:41:14 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Mon, 4 Jun 2012 10:41:14 -0700
Subject: [maker-devel] question regarding alternate splicing annotation
Message-ID: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>

Hi Maker developers,

I am trying to expand on some current annotations that are already quite
good, but only predict protein coding sequence and one isoform per gene, to
add UTRs and alternative splice forms from cufflinks data.  To do this I
put the current annotations in both the model_gff and pred_gff field, plus
the cufflinks gff3 for the ests (as I noticed was suggested in a previous
email).  I've left everything else as default, except changing
alt_splice=1. I am watching the progress of the *.gff.ann files, but I'm
not noticing alternate splicing being added, while UTRs are being picked up
(exons being added, etc.).  This is a vertebrate genome, so run times are
fairly long and I just wanted to double check if I wasn't missing
something.  Will maker go back through a second step to annotate
alternative splicing?  Or should I be trying something a little different.

Thanks,

Walter
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120604/80ac7225/attachment-0001.html>

From carsonhh at gmail.com  Mon Jun  4 12:02:19 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Mon, 04 Jun 2012 14:02:19 -0400
Subject: [maker-devel] question regarding alternate splicing annotation
In-Reply-To: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>
Message-ID: <CBF26EB9.D534%carsonhh@gmail.com>

Using GFF3 pass-through options alone won't allow for the alternate splice
prediction to work.  You have to also allow gene predictors like SNAP and
Augustus to run.  MAKER uses mutually exclusive EST data to produce separate
hint files in some cases that can produce alternate splice forms from the ab
initio predictors.  The EST evidence must be very long in general or they
will not produce alternate forms.  These alternate splice model can then
compete against your existing gene models based on scoring statistics MAKER
produces and potentially replace them.  This may not be what you want
though.  The alternate splice prediction works better De Novo than for
re-annotation.

The alternate splicing option still needs more work, but I would appreciate
any feedback.

Thanks,
Carson




From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Monday, 4 June, 2012 1:41 PM
To:  <maker-devel at yandell-lab.org>
Subject:  [maker-devel] question regarding alternate splicing annotation

Hi Maker developers,

I am trying to expand on some current annotations that are already quite
good, but only predict protein coding sequence and one isoform per gene, to
add UTRs and alternative splice forms from cufflinks data.  To do this I put
the current annotations in both the model_gff andusing the gff_field, plus
the cufflinks gff3 for the ests (as I noticed was suggested in a previous
email).  I've left everything else as default, except changing alt_splice=1.
I am watching the progress of the *.gff.ann files, but I'm not noticing
alternate splicing being added, while UTRs are being picked up (exons being
added, etc.).  This is a vertebrate genome, so run times are fairly long and
I just wanted to double check if I wasn't missing something.  Will maker go
back through a second step to annotate alternative splicing?  Or should I be
trying something a little different.

Thanks,

Walter
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120604/01844803/attachment-0001.html>

From weckalba at asu.edu  Mon Jun  4 12:23:18 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Mon, 4 Jun 2012 11:23:18 -0700
Subject: [maker-devel] question regarding alternate splicing annotation
In-Reply-To: <CBF26EB9.D534%carsonhh@gmail.com>
References: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>
	<CBF26EB9.D534%carsonhh@gmail.com>
Message-ID: <CANRPJSfXK1Py7297bTg3_nQXuUkce4c0WueSM_iYA0MLvXP_OQ@mail.gmail.com>

Hi Carson,

Thanks for the quick reply.  I have already trained SNAP and Augustus based
on the de novo assembly from the same RNA-seq data used to generate the
cufflinks annotations.  Those SNAP and Augustus predictions were part of my
initial annotation, along with the de novo assembled transcripts, previous
reference annotations, and related species protein alignments.  I had
broken this up because of run time issues, and thought it might speed
things along.  I will switch gears to add in the SNAP and Augustus ab
initio predictions.

As you might infer, I have a great deal of formats this transcript data
could come in (ie outputs from cufflinks for each sample, cuffmerge,
tophat, trinity, or raw).  Do you have any suggestions for what might be a
good balance between speed and completeness?  I also can not for life of me
get Maker install on our cluster, but I do have Augustus and SNAP installed
there.  I have a massive amount of RNA-seq data I'm trying to incorporate,
so I'm confident plenty of alternative splicing could be found, but I'm
hitting time issues due to the scale (ie four day wall limit on the cluster
and only having an 8-core in house).

I've tried other programs to do this, but obviously cufflinks gives you way
too much, and I'm finding EVM, while fast, is too happy to shorten gene
models based on partial transcript evidence, which requires way more manual
correction than we are capable of doing.

I'll start with just letting Maker run SNAP and Augustus, and let you know
how it goes.

Walter


On 4 June 2012 11:02, Carson Holt <carsonhh at gmail.com> wrote:

> Using GFF3 pass-through options alone won't allow for the alternate splice
> prediction to work.  You have to also allow gene predictors like SNAP and
> Augustus to run.  MAKER uses mutually exclusive EST data to produce
> separate hint files in some cases that can produce alternate splice forms
> from the ab initio predictors.  The EST evidence must be very long in
> general or they will not produce alternate forms.  These alternate splice
> model can then compete against your existing gene models based on scoring
> statistics MAKER produces and potentially replace them.  This may not be
> what you want though.  The alternate splice prediction works better De Novo
> than for re-annotation.
>
> The alternate splicing option still needs more work, but I would
> appreciate any feedback.
>
> Thanks,
> Carson
>
>
>
>
> From: Walter Eckalbar <weckalba at asu.edu>
> Date: Monday, 4 June, 2012 1:41 PM
> To: <maker-devel at yandell-lab.org>
> Subject: [maker-devel] question regarding alternate splicing annotation
>
> Hi Maker developers,
>
> I am trying to expand on some current annotations that are already quite
> good, but only predict protein coding sequence and one isoform per gene, to
> add UTRs and alternative splice forms from cufflinks data.  To do this I
> put the current annotations in both the model_gff andusing the gff_field,
> plus the cufflinks gff3 for the ests (as I noticed was suggested in a
> previous email).  I've left everything else as default, except changing
> alt_splice=1. I am watching the progress of the *.gff.ann files, but I'm
> not noticing alternate splicing being added, while UTRs are being picked up
> (exons being added, etc.).  This is a vertebrate genome, so run times are
> fairly long and I just wanted to double check if I wasn't missing
> something.  Will maker go back through a second step to annotate
> alternative splicing?  Or should I be trying something a little different.
>
> Thanks,
>
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120604/7e44220c/attachment-0001.html>

From jrliberto at yahoo.com  Wed Jun  6 12:22:46 2012
From: jrliberto at yahoo.com (Jennifer Liberto)
Date: Wed, 6 Jun 2012 11:22:46 -0700 (PDT)
Subject: [maker-devel] MAKER output concerns
Message-ID: <1339006966.41760.YahooMailNeo@web110112.mail.gq1.yahoo.com>

To whom this may concern,
?
I am brand new to MAKER and I am concerned about the output
files that I am receiving.? My
partner and I were able to run the dpp test with no errors, all the files and
directories were accounted for.? However, when we tried to run it on our own small dataset of 5 genes,
and a surfperch genome, we were missing 2 files in the output of every contig:
?
Snig2_XXXXXXX.maker.proteins.fasta
Snig2_XXXXXXX.maker.transcripts.fasta
?
When I look at the run log for each of the contigs, I see that
blastx, blastn, tblastx, augustus, snap, and repeatrunner were called but not
exonerate; I have attached a sample run log with this post. Also, our gff files
contain only short 52 bp repeat sequences (I have attached one of these here as
well in a .txt format) and looks nothing like the gff file we received in out
dpp test.? If you could give any
pointers or hints as to why we are not receiving the two files, why exonerate
is not being called, and why our gff files contain only uniformly small repeat
sequences, the help would be greatly appreciated.? 
?
Thank you for your time,
Jennifer Liberto
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/3394c6ed/attachment-0001.html>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: run.log
Type: application/octet-stream
Size: 5078 bytes
Desc: not available
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/3394c6ed/attachment-0001.obj>
-------------- next part --------------
An embedded and charset-unspecified text was scrubbed...
Name: Snig2_1983881.gff.txt
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/3394c6ed/attachment-0001.txt>

From carsonhh at gmail.com  Wed Jun  6 12:39:42 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 06 Jun 2012 14:39:42 -0400
Subject: [maker-devel] MAKER output concerns
In-Reply-To: <1339006966.41760.YahooMailNeo@web110112.mail.gq1.yahoo.com>
Message-ID: <CBF51A5C.D620%carsonhh@gmail.com>

Hi Jennifer,

The contig you ran with was only 52 bp in length and contained only
repetitive sequence.  Exonerate only runs if there are BLAST results that
need polishing, which there weren't.
The Snig2_XXXXXXX.maker.proteins.fasta and
Snig2_XXXXXXX.maker.transcripts.fasta were not produced because there were
no proteins or transcripts to report.

In general running on sequence shorter than 10,000 bp isn't useful.  This is
because programs like SNAP and Augustus need sequence flanking the actual
gene to make their calls, and with intron/exon structure you are unlikely to
fully capture a gene (end to end) at random in under 10kb for many
eukaryotic organisms.

If you are trying to use raw reads, you will need to assemble them first
before running MAKER.  Let us know specifically what you are trying to do,
and we can give you pointers on how to proceed.

Thanks,
Carson



From:  Jennifer Liberto <jrliberto at yahoo.com>
Reply-To:  Jennifer Liberto <jrliberto at yahoo.com>
Date:  Wednesday, 6 June, 2012 2:22 PM
To:  "maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  [maker-devel] MAKER output concerns

To whom this may concern,
 
I am brand new to MAKER and I am concerned about the output files that I am
receiving.  My partner and I were able to run the dpp test with no errors,
all the files and directories were accounted for. However, when we tried to
run it on our own small dataset of 5 genes, and a surfperch genome, we were
missing 2 files in the output of every contig:
 
Snig2_XXXXXXX.maker.proteins.fasta
Snig2_XXXXXXX.maker.transcripts.fasta
 
When I look at the run log for each of the contigs, I see that blastx,
blastn, tblastx, augustus, snap, and repeatrunner were called but not
exonerate; I have attached a sample run log with this post. Also, our gff
files contain only short 52 bp repeat sequences (I have attached one of
these here as well in a .txt format) and looks nothing like the gff file we
received in out dpp test.  If you could give any pointers or hints as to why
we are not receiving the two files, why exonerate is not being called, and
why our gff files contain only uniformly small repeat sequences, the help
would be greatly appreciated.
 
Thank you for your time,
Jennifer Liberto
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/237aa6e6/attachment-0001.html>

From gowthaman.ramasamy at seattlebiomed.org  Thu Jun  7 07:36:38 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Thu, 7 Jun 2012 06:36:38 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <CBF61973.D683%carson.holt@oicr.on.ca>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>,
	<CBF61973.D683%carson.holt@oicr.on.ca>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F928@mail02.sbri.org>

Thats a very nice catch. I will adjust parent to Parent and try. 

Its nice idea to run maker first with prok. mode. I will keep that in mind.

Thanks,
Gowtham

_____________________________
From: Carson Holt [Carson.Holt at oicr.on.ca]
Sent: Thursday, June 07, 2012 6:28 AM
To: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: GFF3 file format not accepted by pred_gff options

You have parent= instead of Parent=.  In GFF3, attribute tags are case
sensitive.  Those starting with uppercase letters represent reserved
words, and all others represent ad hoc tags.
The modencode validator would not check parent= for validity because it
sees it as an ad hoc tag (thus not producing an error).

Try changing parent= to some invalid value and compare with what you get
when Parent= is set to an invalid value in the modencode validator, and
you will see what I mean.


The fixed version is attached.


Also the genemark_gtf2gff script was made for converting the GeneMark-ES
output, so I'm not surprised it didn't work on the prokaryote version, but
you should
be fine just by fixing the parent= tag on the conversion you made.  You
could also have run MAKER once in prokaryote mode with the prokaryotic
parameter file to get it to produce a GFF3 for you.

Thanks,
Carson




On 12-06-06 9:53 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Carson,
>As I wrote to you earlier, I was able to successfully create a gff3 file
>from our predictor to be used in pred_gff option. But, now, I am trying
>to add another abinitio prediction (GeneMark-prokaryotic).  For some
>weird reasons,  I would like to run GeneMark-prokaryote and
>Augustus-eukaryotes. So, i am not able to run both inside maker.
>
>But, that gff3 was not used by pred_gff. I tried to make it as similar to
>the working gffs as possible. Still in vein. Would you mind having look
>at the attached gff file. I even run it by gff validator at
>modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All
>passed.
>
>In the maker produced gff i just see one pair of match-matchpart that
>corresponds to entire supercontig from GeneMark. Not corresponding to
>genes.
>
>I really appreciate your time and help.
>
>Gowthaman




From gowthaman.ramasamy at seattlebiomed.org  Wed Jun  6 19:53:20 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Wed, 6 Jun 2012 18:53:20 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>

Hi Carson,
As I wrote to you earlier, I was able to successfully create a gff3 file from our predictor to be used in pred_gff option. But, now, I am trying to add another abinitio prediction (GeneMark-prokaryotic).  For some weird reasons,  I would like to run GeneMark-prokaryote and Augustus-eukaryotes. So, i am not able to run both inside maker.

But, that gff3 was not used by pred_gff. I tried to make it as similar to the working gffs as possible. Still in vein. Would you mind having look at the attached gff file. I even run it by gff validator at modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All passed.

In the maker produced gff i just see one pair of match-matchpart that corresponds to entire supercontig from GeneMark. Not corresponding to genes.

I really appreciate your time and help. 

Gowthaman

-------------- next part --------------
A non-text attachment was scrubbed...
Name: Contig23.GMprok.gff
Type: application/octet-stream
Size: 291755 bytes
Desc: Contig23.GMprok.gff
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/2c5bf543/attachment-0001.obj>

From gowthaman.ramasamy at seattlebiomed.org  Wed Jun  6 19:59:33 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Wed, 6 Jun 2012 18:59:33 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F927@mail02.sbri.org>

Carson,
I also tried to use maker's genemart_gtf2gff script to create valid gff3 file. I seem to have problems with it too.
Here is what I see...

-bash-3.2$ ~/software/maker/bin/genemark_gtf2gff3 CrfA_v13.3.5_supercontigs.gff2
ERROR: Cannot understand format
expecting -> gene_id "xxxx"; transcript_id "xxxx";

Attached is first 10000 lines of the GTF output from genemark.

Any help/pointers will be really appreciated.

Thanks again,
Gowthaman
________________________________________
From: Gowthaman Ramasamy
Sent: Wednesday, June 06, 2012 6:53 PM
To: Carson Holt; maker-devel at yandell-lab.org
Subject: GFF3 file format not accepted by pred_gff options

Hi Carson,
As I wrote to you earlier, I was able to successfully create a gff3 file from our predictor to be used in pred_gff option. But, now, I am trying to add another abinitio prediction (GeneMark-prokaryotic).  For some weird reasons,  I would like to run GeneMark-prokaryote and Augustus-eukaryotes. So, i am not able to run both inside maker.

But, that gff3 was not used by pred_gff. I tried to make it as similar to the working gffs as possible. Still in vein. Would you mind having look at the attached gff file. I even run it by gff validator at modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All passed.

In the maker produced gff i just see one pair of match-matchpart that corresponds to entire supercontig from GeneMark. Not corresponding to genes.

I really appreciate your time and help.

Gowthaman
-------------- next part --------------
A non-text attachment was scrubbed...
Name: tiny_genemark-prok.gtf.bz2
Type: application/x-bzip2
Size: 209923 bytes
Desc: tiny_genemark-prok.gtf.bz2
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/ace7deee/attachment-0001.bin>

From Carson.Holt at oicr.on.ca  Thu Jun  7 07:28:06 2012
From: Carson.Holt at oicr.on.ca (Carson Holt)
Date: Thu, 7 Jun 2012 13:28:06 +0000
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
Message-ID: <CBF61973.D683%carson.holt@oicr.on.ca>

You have parent= instead of Parent=.  In GFF3, attribute tags are case
sensitive.  Those starting with uppercase letters represent reserved
words, and all others represent ad hoc tags.
The modencode validator would not check parent= for validity because it
sees it as an ad hoc tag (thus not producing an error).

Try changing parent= to some invalid value and compare with what you get
when Parent= is set to an invalid value in the modencode validator, and
you will see what I mean.


The fixed version is attached.


Also the genemark_gtf2gff script was made for converting the GeneMark-ES
output, so I'm not surprised it didn't work on the prokaryote version, but
you should 
be fine just by fixing the parent= tag on the conversion you made.  You
could also have run MAKER once in prokaryote mode with the prokaryotic
parameter file to get it to produce a GFF3 for you.

Thanks,
Carson




On 12-06-06 9:53 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Carson,
>As I wrote to you earlier, I was able to successfully create a gff3 file
>from our predictor to be used in pred_gff option. But, now, I am trying
>to add another abinitio prediction (GeneMark-prokaryotic).  For some
>weird reasons,  I would like to run GeneMark-prokaryote and
>Augustus-eukaryotes. So, i am not able to run both inside maker.
>
>But, that gff3 was not used by pred_gff. I tried to make it as similar to
>the working gffs as possible. Still in vein. Would you mind having look
>at the attached gff file. I even run it by gff validator at
>modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All
>passed.
>
>In the maker produced gff i just see one pair of match-matchpart that
>corresponds to entire supercontig from GeneMark. Not corresponding to
>genes.
>
>I really appreciate your time and help.
>
>Gowthaman

-------------- next part --------------
A non-text attachment was scrubbed...
Name: Contig23.GMprok.gff
Type: application/octet-stream
Size: 291755 bytes
Desc: Contig23.GMprok.gff
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120607/685ec79a/attachment-0001.obj>

From weckalba at asu.edu  Thu Jun  7 14:40:20 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Thu, 7 Jun 2012 13:40:20 -0700
Subject: [maker-devel] cluster error running maker
Message-ID: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>

Hi everyone,

I have been retrying installing maker on our university cluster, everything
seems to install correctly, but when I run maker I find the following error
message:

Ran into unknown state (hex char: 29) at
/home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
A data structure will be created for you at:
/scratch/weckalba/Maker/genome.maker.output/genome_datastore

To access files for individual sequences use the datastore index:
/scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log

DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.


Seems to have something to do with permissions and DBD::SQLite.  I
installed DBD::SQLite on my own home directories and routed the perl path
to it (and other CPAN installs in the same directories).

I was wondering if anyone ever encountered this before and knew a work
around.  The admins for our cluster are unfortunately very slow to respond.

Thanks

Walter
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120607/b3459baf/attachment-0001.html>

From carsonhh at gmail.com  Fri Jun  8 06:45:42 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 08 Jun 2012 08:45:42 -0400
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>
Message-ID: <CBF76A49.D740%carsonhh@gmail.com>

Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to Volker
Brendel at Iowa State for this one.

> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
> 646785-and-handle-Hex29.patch
> 
> This adds to previously posted 646785 patch.  At least on some systems,
> commands can contain "(" and ")".  See comments in the code.
> 

Download Proc-ProcessTable-0.45 to reinstall before applying the patch.


I'll also send you a link in a separate e-mail to download a maker 2.26 test
version where I've replaced Proc::ProcessTable with a different module
because of the failure on some systems.

Thanks,
Carson




From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Thursday, 7 June, 2012 4:40 PM
To:  <maker-devel at yandell-lab.org>
Subject:  [maker-devel] cluster error running maker

Hi everyone,

I have been retrying installing maker on our university cluster, everything
seems to install correctly, but when I run maker I find the following error
message:

Ran into unknown state (hex char: 29) at
/home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
A data structure will be created for you at:
/scratch/weckalba/Maker/genome.maker.output/genome_datastore

To access files for individual sequences use the datastore index:
/scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.lo
g

DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.


Seems to have something to do with permissions and DBD::SQLite.  I installed
DBD::SQLite on my own home directories and routed the perl path to it (and
other CPAN installs in the same directories).

I was wondering if anyone ever encountered this before and knew a work
around.  The admins for our cluster are unfortunately very slow to respond.

Thanks

Walter
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/87256d43/attachment-0001.html>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: 646785-and-handle-Hex29.patch
Type: application/octet-stream
Size: 4618 bytes
Desc: not available
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/87256d43/attachment-0001.obj>

From weckalba at asu.edu  Fri Jun  8 10:15:38 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Fri, 8 Jun 2012 09:15:38 -0700
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CBF76A49.D740%carsonhh@gmail.com>
References: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>
	<CBF76A49.D740%carsonhh@gmail.com>
Message-ID: <CANRPJScgVoFkm2-fO5Y7MUyFngSgMjN71fPJL3tfr5k-dPDDYA@mail.gmail.com>

Hi Carson,

I will try this as well to get my 2.25 version of maker running.

I have hit another error on my local machine.  This only seems to come up
with scaffolds > 5Mbp.  And am hitting this same error with version 2.10
and 2.25.

  [0] = Make
  [1] = 0
  [2] = additional
  [3] = prediction
  [4] = runs.
dead in Widget::augustus::parse_gene unknown feature type:additional
ERROR: Failed while preparing ab-inits
ERROR: Chunk failed at level:4, tier_type:0
FAILED CONTIG:GL343198.1

Do you have a suggestion for this one?

Thanks for all your help,

Walter


On 8 June 2012 05:45, Carson Holt <carsonhh at gmail.com> wrote:

> Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to
> Volker Brendel at Iowa State for this one.
>
> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
> 646785-and-handle-Hex29.patch
>
> This adds to previously posted 646785 patch.  At least on some
> systems, commands can contain "(" and ")".  See comments in the code.
>
>
> Download Proc-ProcessTable-0.45 to reinstall before applying the patch.
>
>
> I'll also send you a link in a separate e-mail to download a maker 2.26
> test version where I've replaced Proc::ProcessTable with a different module
> because of the failure on some systems.
>
> Thanks,
> Carson
>
>
>
>
> From: Walter Eckalbar <weckalba at asu.edu>
> Date: Thursday, 7 June, 2012 4:40 PM
> To: <maker-devel at yandell-lab.org>
> Subject: [maker-devel] cluster error running maker
>
> Hi everyone,
>
> I have been retrying installing maker on our university cluster,
> everything seems to install correctly, but when I run maker I find the
> following error message:
>
> Ran into unknown state (hex char: 29) at
> /home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
> A data structure will be created for you at:
> /scratch/weckalba/Maker/genome.maker.output/genome_datastore
>
> To access files for individual sequences use the datastore index:
>
> /scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log
>
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
> DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.
>
>
> Seems to have something to do with permissions and DBD::SQLite.  I
> installed DBD::SQLite on my own home directories and routed the perl path
> to it (and other CPAN installs in the same directories).
>
> I was wondering if anyone ever encountered this before and knew a work
> around.  The admins for our cluster are unfortunately very slow to respond.
>
> Thanks
>
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/f5a6a74f/attachment-0001.html>

From carsonhh at gmail.com  Fri Jun  8 10:28:36 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 08 Jun 2012 12:28:36 -0400
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CANRPJScgVoFkm2-fO5Y7MUyFngSgMjN71fPJL3tfr5k-dPDDYA@mail.gmail.com>
Message-ID: <CBF79DE3.D7AE%carsonhh@gmail.com>

That is one I haven't seen before (including on large multi-megabase contigs
).

Right before the error, it will say the location of the file that is being
read.  It will terminate in  ".augustus".  Could you send that file to me?
Augustus seems to be producing something weird in it's output.

Thanks,
Carson



From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Friday, 8 June, 2012 12:15 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] cluster error running maker

Hi Carson,

I will try this as well to get my 2.25 version of maker running.

I have hit another error on my local machine.  This only seems to come up
with scaffolds > 5Mbp.  And am hitting this same error with version 2.10 and
2.25.

  [0] = Make
  [1] = 0
  [2] = additional
  [3] = prediction
  [4] = runs.
dead in Widget::augustus::parse_gene unknown feature type:additional
ERROR: Failed while preparing ab-inits
ERROR: Chunk failed at level:4, tier_type:0
FAILED CONTIG:GL343198.1

Do you have a suggestion for this one?

Thanks for all your help,

Walter


On 8 June 2012 05:45, Carson Holt <carsonhh at gmail.com> wrote:
> Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to Volker
> Brendel at Iowa State for this one.
> 
>> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
>> 646785-and-handle-Hex29.patch
>> 
>> This adds to previously posted 646785 patch.  At least on some systems,
>> commands can contain "(" and ")".  See comments in the code.
>> 
> 
> Download Proc-ProcessTable-0.45 to reinstall before applying the patch.
> 
> 
> I'll also send you a link in a separate e-mail to download a maker 2.26 test
> version where I've replaced Proc::ProcessTable with a different module because
> of the failure on some systems.
> 
> Thanks,
> Carson
> 
> 
> 
> 
> From:  Walter Eckalbar <weckalba at asu.edu>
> Date:  Thursday, 7 June, 2012 4:40 PM
> To:  <maker-devel at yandell-lab.org>
> Subject:  [maker-devel] cluster error running maker
> 
> Hi everyone,
> 
> I have been retrying installing maker on our university cluster, everything
> seems to install correctly, but when I run maker I find the following error
> message:
> 
> Ran into unknown state (hex char: 29) at
> /home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
> A data structure will be created for you at:
> /scratch/weckalba/Maker/genome.maker.output/genome_datastore
> 
> To access files for individual sequences use the datastore index:
> /scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log
> 
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
> DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.
> 
> 
> Seems to have something to do with permissions and DBD::SQLite.  I installed
> DBD::SQLite on my own home directories and routed the perl path to it (and
> other CPAN installs in the same directories).
> 
> I was wondering if anyone ever encountered this before and knew a work around.
> The admins for our cluster are unfortunately very slow to respond.
> 
> Thanks
> 
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.comhttp://box290.bluehost.com/mailman/listinfo/mak
> er-devel_yandell-lab.org



-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/8b777a77/attachment-0001.html>

From daniel.standage at gmail.com  Thu Jun 14 12:26:18 2012
From: daniel.standage at gmail.com (Daniel Standage)
Date: Thu, 14 Jun 2012 13:26:18 -0500
Subject: [maker-devel] Quick question about re-annotation
Message-ID: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>

Greetings!

I have a quick question about re-annotation with Maker. I have successfully
completed a Maker run, but now I would like to re-run Maker with some
additional EST evidence (from a related organism, aligned and in GFF3
format). I simply added the file to the *altest_gff* configuration setting
and re-ran Maker. However, from  the log messages it looked like Maker was
starting from scratch rather than using what had already been completed in
the initial run. Luckily, I had made a backup of the complete Maker data
structure, so I killed the job, deleted the data structure, and restored
from the backup.

Before I try to run this again, do I need to change any other configuration
settings to do this re-annotation? The stanza under *Re-annotation Using
MAKER Derived GFF3* looks relevant, but it is not clear to me which
settings need to be set.

Thanks!

--
Daniel S. Standage
Ph.D. Candidate
Bioinformatics and Computational Biology Program
Department of Genetics, Development, and Cell Biology
Iowa State University
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120614/13e8189c/attachment-0001.html>

From gowthaman.ramasamy at seattlebiomed.org  Thu Jun 14 12:48:01 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Thu, 14 Jun 2012 11:48:01 -0700
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
References: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>

Of course, Carson knows the best answer.

But, I think, you need to grab the GFFs from your previous maker run, and pass it as model_gff= option. That way, gene models in GFFs are used as a starting point and now will check for evidences from your alt_est dataset....

-Gowthaman
________________________________________
From: maker-devel-bounces at yandell-lab.org [maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage [daniel.standage at gmail.com]
Sent: Thursday, June 14, 2012 11:26 AM
To: Maker Mailing List
Subject: [maker-devel] Quick question about re-annotation

Greetings!

I have a quick question about re-annotation with Maker. I have successfully completed a Maker run, but now I would like to re-run Maker with some additional EST evidence (from a related organism, aligned and in GFF3 format). I simply added the file to the altest_gff configuration setting and re-ran Maker. However, from  the log messages it looked like Maker was starting from scratch rather than using what had already been completed in the initial run. Luckily, I had made a backup of the complete Maker data structure, so I killed the job, deleted the data structure, and restored from the backup.

Before I try to run this again, do I need to change any other configuration settings to do this re-annotation? The stanza under Re-annotation Using MAKER Derived GFF3 looks relevant, but it is not clear to me which settings need to be set.

Thanks!

--
Daniel S. Standage
Ph.D. Candidate
Bioinformatics and Computational Biology Program
Department of Genetics, Development, and Cell Biology
Iowa State University




From jason.stajich at gmail.com  Sun Jun 17 01:30:20 2012
From: jason.stajich at gmail.com (Jason Stajich)
Date: Sun, 17 Jun 2012 08:30:20 +0100
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>
References: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
	<89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>
Message-ID: <CALf8Lpwq4kQu2-VrviAKK9R7EG2vRG3ATQo8g_LjM=stO1tLpA@mail.gmail.com>

Well remember that ESTs are used as extra helper information to the ab
initio gene predictors so it will want to run all those predictions again
and re-call the gene structures from the combined output with this extra
info added in. So you will need to decide how you want these to be
incorporated and if you are willing to wait for the analysis to complete
again with this info. The pass through of the previous run will allow you
to keep the names from that previous run if they are important to you.

Jason Stajich


On Thu, Jun 14, 2012 at 7:48 PM, Gowthaman Ramasamy <
gowthaman.ramasamy at seattlebiomed.org> wrote:

> Of course, Carson knows the best answer.
>
> But, I think, you need to grab the GFFs from your previous maker run, and
> pass it as model_gff= option. That way, gene models in GFFs are used as a
> starting point and now will check for evidences from your alt_est
> dataset....
>
> -Gowthaman
> ________________________________________
> From: maker-devel-bounces at yandell-lab.org [
> maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage [
> daniel.standage at gmail.com]
> Sent: Thursday, June 14, 2012 11:26 AM
> To: Maker Mailing List
> Subject: [maker-devel] Quick question about re-annotation
>
> Greetings!
>
> I have a quick question about re-annotation with Maker. I have
> successfully completed a Maker run, but now I would like to re-run Maker
> with some additional EST evidence (from a related organism, aligned and in
> GFF3 format). I simply added the file to the altest_gff configuration
> setting and re-ran Maker. However, from  the log messages it looked like
> Maker was starting from scratch rather than using what had already been
> completed in the initial run. Luckily, I had made a backup of the complete
> Maker data structure, so I killed the job, deleted the data structure, and
> restored from the backup.
>
> Before I try to run this again, do I need to change any other
> configuration settings to do this re-annotation? The stanza under
> Re-annotation Using MAKER Derived GFF3 looks relevant, but it is not clear
> to me which settings need to be set.
>
> Thanks!
>
> --
> Daniel S. Standage
> Ph.D. Candidate
> Bioinformatics and Computational Biology Program
> Department of Genetics, Development, and Cell Biology
> Iowa State University
>
>
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120617/522b4820/attachment-0001.html>

From alvinchen2002 at gmail.com  Fri Jun 15 13:41:52 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Fri, 15 Jun 2012 15:41:52 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
Message-ID: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>

Hi, 

	This is my first time to use maker. I have installed everything that required by maker, and use the data in "data" folder to test this program. But I got a "Segmentation fault" message after "Maker is now finished!!!". And I can't find gff file anywhere. Does anyone have a clue of this?

Thanks, 
Alvin

Here is the output of the program:

[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
WARNING: blast_type is set to 'wublast' but executables cannot be located
The blast_type 'ncbi' will be used instead.

A data structure will be created for you at:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore

To access files for individual sequences use the datastore index:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_datastore_index.log




--Next Contig--

#---------------------------------------------------------------------
Now starting the contig!!
SeqID: contig-dpp-500-500
Length: 32156
#---------------------------------------------------------------------


running  repeat masker.
#--------- command -------------#
Widget::RepeatMasker:
/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.all.rb -species all -dir /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
#-------------------------------#
processing output: 
cycle 1 
cycle 2 
cycle 3 
cycle 4 
cycle 5 
cycle 6 
cycle 7 
cycle 8 
cycle 9 
cycle 10 
Generating output... 
masking
done
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.repeatrunner
#-------------------------------#
deleted:0 hits
 in cluster:shadow cluster...
    i_size:5 j_size:3
 sorting hits in shadow cluster...
... finished.
 i_size:5   current i:0
 i_size:5   current i:1
 i_size:5   current i:2
 i_size:5   current i:3
 i_size:5   current i:4
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastn:
/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
#-------------------------------#
deleted:-1 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
#-------------------------------#
deleted:0 hits
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.dpp-mRNA-5.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.dpp-mRNA-4.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.dpp-mRNA-3.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.dpp-mRNA-2.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.dpp-mRNA-1.est_exonerate
#-------------------------------#
cleaning blastn...
cleaning tblastx...
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-5.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-4.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-3.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-2.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-1.p_exonerate
#-------------------------------#
cleaning blastx...
Preparing evidence for hint based annotation
 in cluster:shadow cluster...
    i_size:15 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:15   current i:0
 i_size:15   current i:1
 i_size:15   current i:2
 i_size:15   current i:3
 i_size:15   current i:4
 i_size:15   current i:5
 i_size:15   current i:6
 i_size:15   current i:7
 i_size:15   current i:8
 i_size:15   current i:9
 i_size:15   current i:10
 i_size:15   current i:11
 i_size:15   current i:12
 i_size:15   current i:13
 i_size:15   current i:14
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
 ...processing 0 of 5
 ...processing 1 of 5
 ...processing 2 of 5
 ...processing 3 of 5
Making transcripts
Processing transcripts into genes
 in cluster:shadow cluster...
    i_size:3 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:3   current i:0
 i_size:3   current i:1
 i_size:3   current i:2
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
now careful_clustering....
getting Pairs
doing single linkage clustering
 ...processing 0 of 3
 ...processing 1 of 3
Calculating annotation quality statistics
Choosing best annotations


Maker is now finished!!!

Segmentation fault






From gowthaman.ramasamy at seattlebiomed.org  Mon Jun 18 12:16:00 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Mon, 18 Jun 2012 11:16:00 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>
References: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C9EAEDA1E@mail02.sbri.org>

Hi Alvin,
I am a relatively new user too. I too get "seg fault" even though, maker did finish making the gff file successfully.

GFFs are actually buried deep down. One possibility is that you were looking only in parent folders.
If you have not done already,  you might want to check for gffs at: /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/*/*/*. ie, three levels down your data store.

what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?

Gowthaman
________________________________________
From: maker-devel-bounces at yandell-lab.org [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen [alvinchen2002 at gmail.com]
Sent: Friday, June 15, 2012 12:41 PM
To: maker-devel at yandell-lab.org
Subject: [maker-devel] maker 2.10 Segmentation fault

Hi,

        This is my first time to use maker. I have installed everything that required by maker, and use the data in "data" folder to test this program. But I got a "Segmentation fault" message after "Maker is now finished!!!". And I can't find gff file anywhere. Does anyone have a clue of this?

Thanks,
Alvin

Here is the output of the program:

[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
WARNING: blast_type is set to 'wublast' but executables cannot be located
The blast_type 'ncbi' will be used instead.

A data structure will be created for you at:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore

To access files for individual sequences use the datastore index:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_datastore_index.log




--Next Contig--

#---------------------------------------------------------------------
Now starting the contig!!
SeqID: contig-dpp-500-500
Length: 32156
#---------------------------------------------------------------------


running  repeat masker.
#--------- command -------------#
Widget::RepeatMasker:
/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.all.rb -species all -dir /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
#-------------------------------#
processing output:
cycle 1
cycle 2
cycle 3
cycle 4
cycle 5
cycle 6
cycle 7
cycle 8
cycle 9
cycle 10
Generating output...
masking
done
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.repeatrunner
#-------------------------------#
deleted:0 hits
 in cluster:shadow cluster...
    i_size:5 j_size:3
 sorting hits in shadow cluster...
... finished.
 i_size:5   current i:0
 i_size:5   current i:1
 i_size:5   current i:2
 i_size:5   current i:3
 i_size:5   current i:4
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastn:
/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
#-------------------------------#
deleted:-1 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
#-------------------------------#
deleted:0 hits
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.dpp-mRNA-5.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.dpp-mRNA-4.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.dpp-mRNA-3.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.dpp-mRNA-2.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.dpp-mRNA-1.est_exonerate
#-------------------------------#
cleaning blastn...
cleaning tblastx...
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-5.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-4.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-3.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-2.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-1.p_exonerate
#-------------------------------#
cleaning blastx...
Preparing evidence for hint based annotation
 in cluster:shadow cluster...
    i_size:15 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:15   current i:0
 i_size:15   current i:1
 i_size:15   current i:2
 i_size:15   current i:3
 i_size:15   current i:4
 i_size:15   current i:5
 i_size:15   current i:6
 i_size:15   current i:7
 i_size:15   current i:8
 i_size:15   current i:9
 i_size:15   current i:10
 i_size:15   current i:11
 i_size:15   current i:12
 i_size:15   current i:13
 i_size:15   current i:14
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
 ...processing 0 of 5
 ...processing 1 of 5
 ...processing 2 of 5
 ...processing 3 of 5
Making transcripts
Processing transcripts into genes
 in cluster:shadow cluster...
    i_size:3 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:3   current i:0
 i_size:3   current i:1
 i_size:3   current i:2
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
now careful_clustering....
getting Pairs
doing single linkage clustering
 ...processing 0 of 3
 ...processing 1 of 3
Calculating annotation quality statistics
Choosing best annotations


Maker is now finished!!!

Segmentation fault




_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org



From carsonhh at gmail.com  Tue Jun 19 09:30:28 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 08:30:28 -0700
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <CALf8Lpwq4kQu2-VrviAKK9R7EG2vRG3ATQo8g_LjM=stO1tLpA@mail.gmail.com>
Message-ID: <CC05E879.EA7E%carsonhh@gmail.com>

Yes the advice given so far is correct.  You can pass back through old
evidence using the maker_gff option and setting est_pass, protein_pass, etc.
to 1.  Set the pred_pass=0 so as to ignore old predictions.  Let MAKER
generate those again to reflect the additional evidence (added to the
alt_est= option).  If you have model_pass=1 and map_forward=1 set then if
any model changes, you can at least maintain the name.

Thanks,
Carson


From:  Jason Stajich <jason.stajich at gmail.com>
Date:  Sunday, 17 June, 2012 12:30 AM
To:  Daniel Standage <daniel.standage at gmail.com>
Cc:  Maker Mailing List <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Quick question about re-annotation

Well remember that ESTs are used as extra helper information to the ab
initio gene predictors so it will want to run all those predictions again
and re-call the gene structures from the combined output with this extra
info added in. So you will need to decide how you want these to be
incorporated and if you are willing to wait for the analysis to complete
again with this info. The pass through of the previous run will allow you to
keep the names from that previous run if they are important to you.

Jason Stajich


On Thu, Jun 14, 2012 at 7:48 PM, Gowthaman Ramasamy
<gowthaman.ramasamy at seattlebiomed.org> wrote:
> Of course, Carson knows the best answer.
> 
> But, I think, you need to grab the GFFs from your previous maker run, and pass
> it as model_gff= option. That way, gene models in GFFs are used as a starting
> point and now will check for evidences from your alt_est dataset....
> 
> -Gowthaman
> ________________________________________
> From: maker-devel-bounces at yandell-lab.org
> [maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage
> [daniel.standage at gmail.com]
> Sent: Thursday, June 14, 2012 11:26 AM
> To: Maker Mailing List
> Subject: [maker-devel] Quick question about re-annotation
> 
> Greetings!
> 
> I have a quick question about re-annotation with Maker. I have successfully
> completed a Maker run, but now I would like to re-run Maker with some
> additional EST evidence (from a related organism, aligned and in GFF3 format).
> I simply added the file to the altest_gff configuration setting and re-ran
> Maker. However, from  the log messages it looked like Maker was starting from
> scratch rather than using what had already been completed in the initial run.
> Luckily, I had made a backup of the complete Maker data structure, so I killed
> the job, deleted the data structure, and restored from the backup.
> 
> Before I try to run this again, do I need to change any other configuration
> settings to do this re-annotation? The stanza under Re-annotation Using MAKER
> Derived GFF3 looks relevant, but it is not clear to me which settings need to
> be set.
> 
> Thanks!
> 
> --
> Daniel S. Standage
> Ph.D. Candidate
> Bioinformatics and Computational Biology Program
> Department of Genetics, Development, and Cell Biology
> Iowa State University
> 
> 
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120619/039e29b4/attachment-0001.html>

From carsonhh at gmail.com  Tue Jun 19 09:39:55 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 08:39:55 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C9EAEDA1E@mail02.sbri.org>
Message-ID: <CC05E9A6.EA88%carsonhh@gmail.com>

The "Maker is now finished" message occurs before the Segmentation fault
so it is finished.  The Segmentation fault is probably an issue with your
system reaping the perl threads on completion.  You can try reinstalling
the forks and forks::shared from CPAN.  Also make sure you are using the
2.25 version and no 2.10.  But your job is finished anyways, so it's
really not affecting the output.  MAKER puts the results for each contig
in a separate folder because some downstream programs like Apollo can only
handle one contig at a time.  Use the
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file to see where each contigs output is stored.


If you want a merged output file for everything, use the merge_gff script
in maker and give it the
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file and it will assemble a merged output file for you.
 There are two type of output GFF3 which gives detailed annotation
information and fasta which just produces sequence for each transcript.
Use fasta_merge to get a merged fasta file for all contigs (giving it the
same 
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file).  The fiel you are interested will be the
maker.pteins.fasta and maker.transcripts.fasta file.

More information on MAKER's output here -->
http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output

Thanks,
Carson


On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Alvin,
>I am a relatively new user too. I too get "seg fault" even though, maker
>did finish making the gff file successfully.
>
>GFFs are actually buried deep down. One possibility is that you were
>looking only in parent folders.
>If you have not done already,  you might want to check for gffs at:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/*/*/*. ie, three levels down your data store.
>
>what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?
>
>Gowthaman
>________________________________________
>From: maker-devel-bounces at yandell-lab.org
>[maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>[alvinchen2002 at gmail.com]
>Sent: Friday, June 15, 2012 12:41 PM
>To: maker-devel at yandell-lab.org
>Subject: [maker-devel] maker 2.10 Segmentation fault
>
>Hi,
>
>        This is my first time to use maker. I have installed everything
>that required by maker, and use the data in "data" folder to test this
>program. But I got a "Segmentation fault" message after "Maker is now
>finished!!!". And I can't find gff file anywhere. Does anyone have a clue
>of this?
>
>Thanks,
>Alvin
>
>Here is the output of the program:
>
>[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
>WARNING: blast_type is set to 'wublast' but executables cannot be located
>The blast_type 'ncbi' will be used instead.
>
>A data structure will be created for you at:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re
>
>To access files for individual sequences use the datastore index:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_
>datastore_index.log
>
>
>
>
>--Next Contig--
>
>#---------------------------------------------------------------------
>Now starting the contig!!
>SeqID: contig-dpp-500-500
>Length: 32156
>#---------------------------------------------------------------------
>
>
>running  repeat masker.
>#--------- command -------------#
>Widget::RepeatMasker:
>/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.all.rb -species all -dir
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>#-------------------------------#
>processing output:
>cycle 1
>cycle 2
>cycle 3
>cycle 4
>cycle 5
>cycle 6
>cycle 7
>cycle 8
>cycle 9
>cycle 10
>Generating output...
>masking
>done
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
> in cluster:shadow cluster...
>    i_size:5 j_size:3
> sorting hits in shadow cluster...
>... finished.
> i_size:5   current i:0
> i_size:5   current i:1
> i_size:5   current i:2
> i_size:5   current i:3
> i_size:5   current i:4
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastn:
>/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>-i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>-o 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>#-------------------------------#
>deleted:-1 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
>#-------------------------------#
>deleted:0 hits
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26586-31847.dpp-mRNA-5.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.23089-31847.dpp-mRNA-4.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.22854-31847.dpp-mRNA-3.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.20908-31847.dpp-mRNA-2.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26901-31847.dpp-mRNA-1.est_exonerate
>#-------------------------------#
>cleaning blastn...
>cleaning tblastx...
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-5.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-4.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-3.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-2.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-1.p_exonerate
>#-------------------------------#
>cleaning blastx...
>Preparing evidence for hint based annotation
> in cluster:shadow cluster...
>    i_size:15 j_size:1
> sorting hits in shadow cluster...
>... finished.
> i_size:15   current i:0
> i_size:15   current i:1
> i_size:15   current i:2
> i_size:15   current i:3
> i_size:15   current i:4
> i_size:15   current i:5
> i_size:15   current i:6
> i_size:15   current i:7
> i_size:15   current i:8
> i_size:15   current i:9
> i_size:15   current i:10
> i_size:15   current i:11
> i_size:15   current i:12
> i_size:15   current i:13
> i_size:15   current i:14
> in cluster:shadow cluster...
>    i_size:0 j_size:0
> sorting hits in shadow cluster...
>... finished.
> ...processing 0 of 5
> ...processing 1 of 5
> ...processing 2 of 5
> ...processing 3 of 5
>Making transcripts
>Processing transcripts into genes
> in cluster:shadow cluster...
>    i_size:3 j_size:1
> sorting hits in shadow cluster...
>... finished.
> i_size:3   current i:0
> i_size:3   current i:1
> i_size:3   current i:2
> in cluster:shadow cluster...
>    i_size:0 j_size:0
> sorting hits in shadow cluster...
>... finished.
>now careful_clustering....
>getting Pairs
>doing single linkage clustering
> ...processing 0 of 3
> ...processing 1 of 3
>Calculating annotation quality statistics
>Choosing best annotations
>
>
>Maker is now finished!!!
>
>Segmentation fault
>
>
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From alvinchen2002 at gmail.com  Tue Jun 19 21:57:33 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Tue, 19 Jun 2012 23:57:33 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC05E9A6.EA88%carsonhh@gmail.com>
References: <CC05E9A6.EA88%carsonhh@gmail.com>
Message-ID: <3C1B46A3-09B2-4BFC-9CDE-BBCFF2B74073@gmail.com>

Hey Carson and Gowthaman, 

	Thanks for your replies! You are right, Carson, the problem caused by "Proc::Signal::reap_children_by_name(9, 'maintain.pl');". dpp_contig_master_datastore_index.log shows that the job has finished. I have installed the newest version of forks and forks::shared. but the version is 0.34 not 2.25, is that correct? The bad news is that the program still crashed at last, but it won't hurt.  I have tried the dpp and hsap data in data folder, and I have got 6 genes for hsap and 3 genes for dpp, is this number correct? I just want make sure everything works fine and I will begin to use it with my data. Thanks!

Best,
Alvin


On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:

> The "Maker is now finished" message occurs before the Segmentation fault
> so it is finished.  The Segmentation fault is probably an issue with your
> system reaping the perl threads on completion.  You can try reinstalling
> the forks and forks::shared from CPAN.  Also make sure you are using the
> 2.25 version and no 2.10.  But your job is finished anyways, so it's
> really not affecting the output.  MAKER puts the results for each contig
> in a separate folder because some downstream programs like Apollo can only
> handle one contig at a time.  Use the
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file to see where each contigs output is stored.
> 
> 
> If you want a merged output file for everything, use the merge_gff script
> in maker and give it the
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file and it will assemble a merged output file for you.
> There are two type of output GFF3 which gives detailed annotation
> information and fasta which just produces sequence for each transcript.
> Use fasta_merge to get a merged fasta file for all contigs (giving it the
> same 
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file).  The fiel you are interested will be the
> maker.pteins.fasta and maker.transcripts.fasta file.
> 
> More information on MAKER's output here -->
> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
> 
> Thanks,
> Carson
> 
> 
> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Alvin,
>> I am a relatively new user too. I too get "seg fault" even though, maker
>> did finish making the gff file successfully.
>> 
>> GFFs are actually buried deep down. One possibility is that you were
>> looking only in parent folders.
>> If you have not done already,  you might want to check for gffs at:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/*/*/*. ie, three levels down your data store.
>> 
>> what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?
>> 
>> Gowthaman
>> ________________________________________
>> From: maker-devel-bounces at yandell-lab.org
>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>> [alvinchen2002 at gmail.com]
>> Sent: Friday, June 15, 2012 12:41 PM
>> To: maker-devel at yandell-lab.org
>> Subject: [maker-devel] maker 2.10 Segmentation fault
>> 
>> Hi,
>> 
>>       This is my first time to use maker. I have installed everything
>> that required by maker, and use the data in "data" folder to test this
>> program. But I got a "Segmentation fault" message after "Maker is now
>> finished!!!". And I can't find gff file anywhere. Does anyone have a clue
>> of this?
>> 
>> Thanks,
>> Alvin
>> 
>> Here is the output of the program:
>> 
>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
>> WARNING: blast_type is set to 'wublast' but executables cannot be located
>> The blast_type 'ncbi' will be used instead.
>> 
>> A data structure will be created for you at:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re
>> 
>> To access files for individual sequences use the datastore index:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_
>> datastore_index.log
>> 
>> 
>> 
>> 
>> --Next Contig--
>> 
>> #---------------------------------------------------------------------
>> Now starting the contig!!
>> SeqID: contig-dpp-500-500
>> Length: 32156
>> #---------------------------------------------------------------------
>> 
>> 
>> running  repeat masker.
>> #--------- command -------------#
>> Widget::RepeatMasker:
>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.all.rb -species all -dir
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>> #-------------------------------#
>> processing output:
>> cycle 1
>> cycle 2
>> cycle 3
>> cycle 4
>> cycle 5
>> cycle 6
>> cycle 7
>> cycle 8
>> cycle 9
>> cycle 10
>> Generating output...
>> masking
>> done
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> in cluster:shadow cluster...
>>   i_size:5 j_size:3
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:5   current i:0
>> i_size:5   current i:1
>> i_size:5   current i:2
>> i_size:5   current i:3
>> i_size:5   current i:4
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastn:
>> /usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>> -o 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>> #-------------------------------#
>> deleted:-1 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
>> #-------------------------------#
>> deleted:0 hits
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26586-31847.dpp-mRNA-5.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .23089-31847.dpp-mRNA-4.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .22854-31847.dpp-mRNA-3.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .20908-31847.dpp-mRNA-2.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26901-31847.dpp-mRNA-1.est_exonerate
>> #-------------------------------#
>> cleaning blastn...
>> cleaning tblastx...
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-5.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-4.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-3.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-2.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-1.p_exonerate
>> #-------------------------------#
>> cleaning blastx...
>> Preparing evidence for hint based annotation
>> in cluster:shadow cluster...
>>   i_size:15 j_size:1
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:15   current i:0
>> i_size:15   current i:1
>> i_size:15   current i:2
>> i_size:15   current i:3
>> i_size:15   current i:4
>> i_size:15   current i:5
>> i_size:15   current i:6
>> i_size:15   current i:7
>> i_size:15   current i:8
>> i_size:15   current i:9
>> i_size:15   current i:10
>> i_size:15   current i:11
>> i_size:15   current i:12
>> i_size:15   current i:13
>> i_size:15   current i:14
>> in cluster:shadow cluster...
>>   i_size:0 j_size:0
>> sorting hits in shadow cluster...
>> ... finished.
>> ...processing 0 of 5
>> ...processing 1 of 5
>> ...processing 2 of 5
>> ...processing 3 of 5
>> Making transcripts
>> Processing transcripts into genes
>> in cluster:shadow cluster...
>>   i_size:3 j_size:1
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:3   current i:0
>> i_size:3   current i:1
>> i_size:3   current i:2
>> in cluster:shadow cluster...
>>   i_size:0 j_size:0
>> sorting hits in shadow cluster...
>> ... finished.
>> now careful_clustering....
>> getting Pairs
>> doing single linkage clustering
>> ...processing 0 of 3
>> ...processing 1 of 3
>> Calculating annotation quality statistics
>> Choosing best annotations
>> 
>> 
>> Maker is now finished!!!
>> 
>> Segmentation fault
>> 
>> 
>> 
>> 
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
> 
> 




From carsonhh at gmail.com  Tue Jun 19 23:03:14 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:03:14 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <3C1B46A3-09B2-4BFC-9CDE-BBCFF2B74073@gmail.com>
Message-ID: <CC06A670.EACE%carsonhh@gmail.com>

Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
version 2.25 (type maker -v to see the version you are using).  The
reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
process fails to respond to signals upstream in the code.  The 2.25
version of MAKER does some extra things that should even further avoid the
need for the call compared to MAKER 2.10.

Thanks,
Carson






On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey Carson and Gowthaman,
>
>	Thanks for your replies! You are right, Carson, the problem caused by
>"Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>dpp_contig_master_datastore_index.log shows that the job has finished. I
>have installed the newest version of forks and forks::shared. but the
>version is 0.34 not 2.25, is that correct? The bad news is that the
>program still crashed at last, but it won't hurt.  I have tried the dpp
>and hsap data in data folder, and I have got 6 genes for hsap and 3 genes
>for dpp, is this number correct? I just want make sure everything works
>fine and I will begin to use it with my data. Thanks!
>
>Best,
>Alvin
>
>
>On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>
>> The "Maker is now finished" message occurs before the Segmentation fault
>> so it is finished.  The Segmentation fault is probably an issue with
>>your
>> system reaping the perl threads on completion.  You can try reinstalling
>> the forks and forks::shared from CPAN.  Also make sure you are using the
>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>> really not affecting the output.  MAKER puts the results for each contig
>> in a separate folder because some downstream programs like Apollo can
>>only
>> handle one contig at a time.  Use the
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file to see where each contigs output is stored.
>> 
>> 
>> If you want a merged output file for everything, use the merge_gff
>>script
>> in maker and give it the
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file and it will assemble a merged output file for
>>you.
>> There are two type of output GFF3 which gives detailed annotation
>> information and fasta which just produces sequence for each transcript.
>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>the
>> same 
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file).  The fiel you are interested will be the
>> maker.pteins.fasta and maker.transcripts.fasta file.
>> 
>> More information on MAKER's output here -->
>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>> 
>> Thanks,
>> Carson
>> 
>> 
>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>> 
>>> Hi Alvin,
>>> I am a relatively new user too. I too get "seg fault" even though,
>>>maker
>>> did finish making the gff file successfully.
>>> 
>>> GFFs are actually buried deep down. One possibility is that you were
>>> looking only in parent folders.
>>> If you have not done already,  you might want to check for gffs at:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/*/*/*. ie, three levels down your data store.
>>> 
>>> what does "dpp_contig_master_datastore_index.log" says?
>>>Failed/Finsihed ?
>>> 
>>> Gowthaman
>>> ________________________________________
>>> From: maker-devel-bounces at yandell-lab.org
>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>> [alvinchen2002 at gmail.com]
>>> Sent: Friday, June 15, 2012 12:41 PM
>>> To: maker-devel at yandell-lab.org
>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>> 
>>> Hi,
>>> 
>>>       This is my first time to use maker. I have installed everything
>>> that required by maker, and use the data in "data" folder to test this
>>> program. But I got a "Segmentation fault" message after "Maker is now
>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>clue
>>> of this?
>>> 
>>> Thanks,
>>> Alvin
>>> 
>>> Here is the output of the program:
>>> 
>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>maker_exe.ctl
>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>located
>>> The blast_type 'ncbi' will be used instead.
>>> 
>>> A data structure will be created for you at:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re
>>> 
>>> To access files for individual sequences use the datastore index:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_maste
>>>r_
>>> datastore_index.log
>>> 
>>> 
>>> 
>>> 
>>> --Next Contig--
>>> 
>>> #---------------------------------------------------------------------
>>> Now starting the contig!!
>>> SeqID: contig-dpp-500-500
>>> Length: 32156
>>> #---------------------------------------------------------------------
>>> 
>>> 
>>> running  repeat masker.
>>> #--------- command -------------#
>>> Widget::RepeatMasker:
>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .0.all.rb -species all -dir
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>> #-------------------------------#
>>> processing output:
>>> cycle 1
>>> cycle 2
>>> cycle 3
>>> cycle 4
>>> cycle 5
>>> cycle 6
>>> cycle 7
>>> cycle 8
>>> cycle 9
>>> cycle 10
>>> Generating output...
>>> masking
>>> done
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>0.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>1.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>2.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>3.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>4.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>5.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>6.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>7.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>8.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>9.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> in cluster:shadow cluster...
>>>   i_size:5 j_size:3
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:5   current i:0
>>> i_size:5   current i:1
>>> i_size:5   current i:2
>>> i_size:5   current i:3
>>> i_size:5   current i:4
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastn:
>>> /usr/bin/blastall -p blastn -d
>>>/tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>>> -o 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>> #-------------------------------#
>>> deleted:-1 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blast
>>>x
>>> #-------------------------------#
>>> deleted:0 hits
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>> #-------------------------------#
>>> cleaning blastn...
>>> cleaning tblastx...
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-5.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-4.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-3.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-2.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-1.p_exonerate
>>> #-------------------------------#
>>> cleaning blastx...
>>> Preparing evidence for hint based annotation
>>> in cluster:shadow cluster...
>>>   i_size:15 j_size:1
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:15   current i:0
>>> i_size:15   current i:1
>>> i_size:15   current i:2
>>> i_size:15   current i:3
>>> i_size:15   current i:4
>>> i_size:15   current i:5
>>> i_size:15   current i:6
>>> i_size:15   current i:7
>>> i_size:15   current i:8
>>> i_size:15   current i:9
>>> i_size:15   current i:10
>>> i_size:15   current i:11
>>> i_size:15   current i:12
>>> i_size:15   current i:13
>>> i_size:15   current i:14
>>> in cluster:shadow cluster...
>>>   i_size:0 j_size:0
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> ...processing 0 of 5
>>> ...processing 1 of 5
>>> ...processing 2 of 5
>>> ...processing 3 of 5
>>> Making transcripts
>>> Processing transcripts into genes
>>> in cluster:shadow cluster...
>>>   i_size:3 j_size:1
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:3   current i:0
>>> i_size:3   current i:1
>>> i_size:3   current i:2
>>> in cluster:shadow cluster...
>>>   i_size:0 j_size:0
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> now careful_clustering....
>>> getting Pairs
>>> doing single linkage clustering
>>> ...processing 0 of 3
>>> ...processing 1 of 3
>>> Calculating annotation quality statistics
>>> Choosing best annotations
>>> 
>>> 
>>> Maker is now finished!!!
>>> 
>>> Segmentation fault
>>> 
>>> 
>>> 
>>> 
>>> _______________________________________________
>>> maker-devel mailing list
>>> maker-devel at box290.bluehost.com
>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>> 
>>> _______________________________________________
>>> maker-devel mailing list
>>> maker-devel at box290.bluehost.com
>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> 
>





From alvinchen2002 at gmail.com  Tue Jun 19 23:15:24 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Wed, 20 Jun 2012 01:15:24 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC06A670.EACE%carsonhh@gmail.com>
References: <CC06A670.EACE%carsonhh@gmail.com>
Message-ID: <ACAA26CD-8208-4027-9831-2139093467A2@gmail.com>

Hey  Carson,

	I am still using 2.10, because 2.25 get crashed at the beginning. I think it may be caused by these codes:

Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up maintainers
Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up maintainers"

You have added them at the top of the scripts in the new version. 

Alvin

On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:

> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
> version 2.25 (type maker -v to see the version you are using).  The
> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
> process fails to respond to signals upstream in the code.  The 2.25
> version of MAKER does some extra things that should even further avoid the
> need for the call compared to MAKER 2.10.
> 
> Thanks,
> Carson
> 
> 
> 
> 
> 
> 
> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
> 
>> Hey Carson and Gowthaman,
>> 
>> 	Thanks for your replies! You are right, Carson, the problem caused by
>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>> dpp_contig_master_datastore_index.log shows that the job has finished. I
>> have installed the newest version of forks and forks::shared. but the
>> version is 0.34 not 2.25, is that correct? The bad news is that the
>> program still crashed at last, but it won't hurt.  I have tried the dpp
>> and hsap data in data folder, and I have got 6 genes for hsap and 3 genes
>> for dpp, is this number correct? I just want make sure everything works
>> fine and I will begin to use it with my data. Thanks!
>> 
>> Best,
>> Alvin
>> 
>> 
>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>> 
>>> The "Maker is now finished" message occurs before the Segmentation fault
>>> so it is finished.  The Segmentation fault is probably an issue with
>>> your
>>> system reaping the perl threads on completion.  You can try reinstalling
>>> the forks and forks::shared from CPAN.  Also make sure you are using the
>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>> really not affecting the output.  MAKER puts the results for each contig
>>> in a separate folder because some downstream programs like Apollo can
>>> only
>>> handle one contig at a time.  Use the
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file to see where each contigs output is stored.
>>> 
>>> 
>>> If you want a merged output file for everything, use the merge_gff
>>> script
>>> in maker and give it the
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file and it will assemble a merged output file for
>>> you.
>>> There are two type of output GFF3 which gives detailed annotation
>>> information and fasta which just produces sequence for each transcript.
>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>> the
>>> same 
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file).  The fiel you are interested will be the
>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>> 
>>> More information on MAKER's output here -->
>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>> 
>>> Thanks,
>>> Carson
>>> 
>>> 
>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>> 
>>>> Hi Alvin,
>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>> maker
>>>> did finish making the gff file successfully.
>>>> 
>>>> GFFs are actually buried deep down. One possibility is that you were
>>>> looking only in parent folders.
>>>> If you have not done already,  you might want to check for gffs at:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/*/*/*. ie, three levels down your data store.
>>>> 
>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>> Failed/Finsihed ?
>>>> 
>>>> Gowthaman
>>>> ________________________________________
>>>> From: maker-devel-bounces at yandell-lab.org
>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>> [alvinchen2002 at gmail.com]
>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>> To: maker-devel at yandell-lab.org
>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>> 
>>>> Hi,
>>>> 
>>>>      This is my first time to use maker. I have installed everything
>>>> that required by maker, and use the data in "data" folder to test this
>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>> clue
>>>> of this?
>>>> 
>>>> Thanks,
>>>> Alvin
>>>> 
>>>> Here is the output of the program:
>>>> 
>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>> maker_exe.ctl
>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>> located
>>>> The blast_type 'ncbi' will be used instead.
>>>> 
>>>> A data structure will be created for you at:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re
>>>> 
>>>> To access files for individual sequences use the datastore index:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_maste
>>>> r_
>>>> datastore_index.log
>>>> 
>>>> 
>>>> 
>>>> 
>>>> --Next Contig--
>>>> 
>>>> #---------------------------------------------------------------------
>>>> Now starting the contig!!
>>>> SeqID: contig-dpp-500-500
>>>> Length: 32156
>>>> #---------------------------------------------------------------------
>>>> 
>>>> 
>>>> running  repeat masker.
>>>> #--------- command -------------#
>>>> Widget::RepeatMasker:
>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .0.all.rb -species all -dir
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>> #-------------------------------#
>>>> processing output:
>>>> cycle 1
>>>> cycle 2
>>>> cycle 3
>>>> cycle 4
>>>> cycle 5
>>>> cycle 6
>>>> cycle 7
>>>> cycle 8
>>>> cycle 9
>>>> cycle 10
>>>> Generating output...
>>>> masking
>>>> done
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 0.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 1.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 2.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 3.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 4.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 5.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 6.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 7.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 8.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 9.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> in cluster:shadow cluster...
>>>>  i_size:5 j_size:3
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:5   current i:0
>>>> i_size:5   current i:1
>>>> i_size:5   current i:2
>>>> i_size:5   current i:3
>>>> i_size:5   current i:4
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastn:
>>>> /usr/bin/blastall -p blastn -d
>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>>>> -o 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>> #-------------------------------#
>>>> deleted:-1 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blast
>>>> x
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>> #-------------------------------#
>>>> cleaning blastn...
>>>> cleaning tblastx...
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>> #-------------------------------#
>>>> cleaning blastx...
>>>> Preparing evidence for hint based annotation
>>>> in cluster:shadow cluster...
>>>>  i_size:15 j_size:1
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:15   current i:0
>>>> i_size:15   current i:1
>>>> i_size:15   current i:2
>>>> i_size:15   current i:3
>>>> i_size:15   current i:4
>>>> i_size:15   current i:5
>>>> i_size:15   current i:6
>>>> i_size:15   current i:7
>>>> i_size:15   current i:8
>>>> i_size:15   current i:9
>>>> i_size:15   current i:10
>>>> i_size:15   current i:11
>>>> i_size:15   current i:12
>>>> i_size:15   current i:13
>>>> i_size:15   current i:14
>>>> in cluster:shadow cluster...
>>>>  i_size:0 j_size:0
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> ...processing 0 of 5
>>>> ...processing 1 of 5
>>>> ...processing 2 of 5
>>>> ...processing 3 of 5
>>>> Making transcripts
>>>> Processing transcripts into genes
>>>> in cluster:shadow cluster...
>>>>  i_size:3 j_size:1
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:3   current i:0
>>>> i_size:3   current i:1
>>>> i_size:3   current i:2
>>>> in cluster:shadow cluster...
>>>>  i_size:0 j_size:0
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> now careful_clustering....
>>>> getting Pairs
>>>> doing single linkage clustering
>>>> ...processing 0 of 3
>>>> ...processing 1 of 3
>>>> Calculating annotation quality statistics
>>>> Choosing best annotations
>>>> 
>>>> 
>>>> Maker is now finished!!!
>>>> 
>>>> Segmentation fault
>>>> 
>>>> 
>>>> 
>>>> 
>>>> _______________________________________________
>>>> maker-devel mailing list
>>>> maker-devel at box290.bluehost.com
>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>>> 
>>>> _______________________________________________
>>>> maker-devel mailing list
>>>> maker-devel at box290.bluehost.com
>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>> 
>>> 
>> 
> 
> 




From carsonhh at gmail.com  Tue Jun 19 23:21:22 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:21:22 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <ACAA26CD-8208-4027-9831-2139093467A2@gmail.com>
Message-ID: <CC06AB2D.EAE2%carsonhh@gmail.com>

Those are wrapped in an END block so they only run when perl exits (I.e.
post completion or failure).  If 2.25 is failing it would likely be for
another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
-debug).  Does it produce any output before failure?

Thanks,
Carson





On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey  Carson,
>
>	I am still using 2.10, because 2.25 get crashed at the beginning. I
>think it may be caused by these codes:
>
>Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>maintainers
>Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>maintainers"
>
>You have added them at the top of the scripts in the new version.
>
>Alvin
>
>On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>
>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
>> version 2.25 (type maker -v to see the version you are using).  The
>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>> process fails to respond to signals upstream in the code.  The 2.25
>> version of MAKER does some extra things that should even further avoid
>>the
>> need for the call compared to MAKER 2.10.
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> 
>> 
>> 
>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>> 
>>> Hey Carson and Gowthaman,
>>> 
>>> 	Thanks for your replies! You are right, Carson, the problem caused by
>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>> dpp_contig_master_datastore_index.log shows that the job has finished.
>>>I
>>> have installed the newest version of forks and forks::shared. but the
>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>> program still crashed at last, but it won't hurt.  I have tried the dpp
>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>genes
>>> for dpp, is this number correct? I just want make sure everything works
>>> fine and I will begin to use it with my data. Thanks!
>>> 
>>> Best,
>>> Alvin
>>> 
>>> 
>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>> 
>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>fault
>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>> your
>>>> system reaping the perl threads on completion.  You can try
>>>>reinstalling
>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>the
>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>> really not affecting the output.  MAKER puts the results for each
>>>>contig
>>>> in a separate folder because some downstream programs like Apollo can
>>>> only
>>>> handle one contig at a time.  Use the
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file to see where each contigs output is stored.
>>>> 
>>>> 
>>>> If you want a merged output file for everything, use the merge_gff
>>>> script
>>>> in maker and give it the
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file and it will assemble a merged output file for
>>>> you.
>>>> There are two type of output GFF3 which gives detailed annotation
>>>> information and fasta which just produces sequence for each
>>>>transcript.
>>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>>> the
>>>> same 
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file).  The fiel you are interested will be the
>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>> 
>>>> More information on MAKER's output here -->
>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>> 
>>>> Thanks,
>>>> Carson
>>>> 
>>>> 
>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>> 
>>>>> Hi Alvin,
>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>> maker
>>>>> did finish making the gff file successfully.
>>>>> 
>>>>> GFFs are actually buried deep down. One possibility is that you were
>>>>> looking only in parent folders.
>>>>> If you have not done already,  you might want to check for gffs at:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re/*/*/*. ie, three levels down your data store.
>>>>> 
>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>> Failed/Finsihed ?
>>>>> 
>>>>> Gowthaman
>>>>> ________________________________________
>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>> [alvinchen2002 at gmail.com]
>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>> To: maker-devel at yandell-lab.org
>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>> 
>>>>> Hi,
>>>>> 
>>>>>      This is my first time to use maker. I have installed everything
>>>>> that required by maker, and use the data in "data" folder to test
>>>>>this
>>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>>> clue
>>>>> of this?
>>>>> 
>>>>> Thanks,
>>>>> Alvin
>>>>> 
>>>>> Here is the output of the program:
>>>>> 
>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>> maker_exe.ctl
>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>> located
>>>>> The blast_type 'ncbi' will be used instead.
>>>>> 
>>>>> A data structure will be created for you at:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re
>>>>> 
>>>>> To access files for individual sequences use the datastore index:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mas
>>>>>te
>>>>> r_
>>>>> datastore_index.log
>>>>> 
>>>>> 
>>>>> 
>>>>> 
>>>>> --Next Contig--
>>>>> 
>>>>> 
>>>>>#---------------------------------------------------------------------
>>>>> Now starting the contig!!
>>>>> SeqID: contig-dpp-500-500
>>>>> Length: 32156
>>>>> 
>>>>>#---------------------------------------------------------------------
>>>>> 
>>>>> 
>>>>> running  repeat masker.
>>>>> #--------- command -------------#
>>>>> Widget::RepeatMasker:
>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .0.all.rb -species all -dir
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>> #-------------------------------#
>>>>> processing output:
>>>>> cycle 1
>>>>> cycle 2
>>>>> cycle 3
>>>>> cycle 4
>>>>> cycle 5
>>>>> cycle 6
>>>>> cycle 7
>>>>> cycle 8
>>>>> cycle 9
>>>>> cycle 10
>>>>> Generating output...
>>>>> masking
>>>>> done
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 0.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 1.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 2.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 3.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 4.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 5.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 6.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 7.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 8.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 9.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> in cluster:shadow cluster...
>>>>>  i_size:5 j_size:3
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:5   current i:0
>>>>> i_size:5   current i:1
>>>>> i_size:5   current i:2
>>>>> i_size:5   current i:3
>>>>> i_size:5   current i:4
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastn:
>>>>> /usr/bin/blastall -p blastn -d
>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>-e
>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>-I T
>>>>> -o 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>> #-------------------------------#
>>>>> deleted:-1 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>>/tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.bla
>>>>>st
>>>>> x
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>> #-------------------------------#
>>>>> cleaning blastn...
>>>>> cleaning tblastx...
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>> #-------------------------------#
>>>>> cleaning blastx...
>>>>> Preparing evidence for hint based annotation
>>>>> in cluster:shadow cluster...
>>>>>  i_size:15 j_size:1
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:15   current i:0
>>>>> i_size:15   current i:1
>>>>> i_size:15   current i:2
>>>>> i_size:15   current i:3
>>>>> i_size:15   current i:4
>>>>> i_size:15   current i:5
>>>>> i_size:15   current i:6
>>>>> i_size:15   current i:7
>>>>> i_size:15   current i:8
>>>>> i_size:15   current i:9
>>>>> i_size:15   current i:10
>>>>> i_size:15   current i:11
>>>>> i_size:15   current i:12
>>>>> i_size:15   current i:13
>>>>> i_size:15   current i:14
>>>>> in cluster:shadow cluster...
>>>>>  i_size:0 j_size:0
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> ...processing 0 of 5
>>>>> ...processing 1 of 5
>>>>> ...processing 2 of 5
>>>>> ...processing 3 of 5
>>>>> Making transcripts
>>>>> Processing transcripts into genes
>>>>> in cluster:shadow cluster...
>>>>>  i_size:3 j_size:1
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:3   current i:0
>>>>> i_size:3   current i:1
>>>>> i_size:3   current i:2
>>>>> in cluster:shadow cluster...
>>>>>  i_size:0 j_size:0
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> now careful_clustering....
>>>>> getting Pairs
>>>>> doing single linkage clustering
>>>>> ...processing 0 of 3
>>>>> ...processing 1 of 3
>>>>> Calculating annotation quality statistics
>>>>> Choosing best annotations
>>>>> 
>>>>> 
>>>>> Maker is now finished!!!
>>>>> 
>>>>> Segmentation fault
>>>>> 
>>>>> 
>>>>> 
>>>>> 
>>>>> _______________________________________________
>>>>> maker-devel mailing list
>>>>> maker-devel at box290.bluehost.com
>>>>> 
>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>g
>>>>> 
>>>>> _______________________________________________
>>>>> maker-devel mailing list
>>>>> maker-devel at box290.bluehost.com
>>>>> 
>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>g
>>>> 
>>>> 
>>> 
>> 
>> 
>





From alvinchen2002 at gmail.com  Tue Jun 19 23:48:10 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Wed, 20 Jun 2012 01:48:10 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC06AB2D.EAE2%carsonhh@gmail.com>
References: <CC06AB2D.EAE2%carsonhh@gmail.com>
Message-ID: <6C911ABF-19AF-4EBB-A990-1ECE85ADD7E3@gmail.com>

Hey Carson, 

	It seems like there is a bug in Proc-ProcessTable 0.45.  I solved the problem by downgraded Proc-ProcessTable from 0.45 to 0.44. I can run 2.25 without any problems now. 

Cheers,
Alvin

On Jun 20, 2012, at 1:21 AM, Carson Holt wrote:

> Those are wrapped in an END block so they only run when perl exits (I.e.
> post completion or failure).  If 2.25 is failing it would likely be for
> another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
> -debug).  Does it produce any output before failure?
> 
> Thanks,
> Carson
> 
> 
> 
> 
> 
> On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
> 
>> Hey  Carson,
>> 
>> 	I am still using 2.10, because 2.25 get crashed at the beginning. I
>> think it may be caused by these codes:
>> 
>> Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>> maintainers
>> Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>> maintainers"
>> 
>> You have added them at the top of the scripts in the new version.
>> 
>> Alvin
>> 
>> On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>> 
>>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
>>> version 2.25 (type maker -v to see the version you are using).  The
>>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>>> process fails to respond to signals upstream in the code.  The 2.25
>>> version of MAKER does some extra things that should even further avoid
>>> the
>>> need for the call compared to MAKER 2.10.
>>> 
>>> Thanks,
>>> Carson
>>> 
>>> 
>>> 
>>> 
>>> 
>>> 
>>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>>> 
>>>> Hey Carson and Gowthaman,
>>>> 
>>>> 	Thanks for your replies! You are right, Carson, the problem caused by
>>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>>> dpp_contig_master_datastore_index.log shows that the job has finished.
>>>> I
>>>> have installed the newest version of forks and forks::shared. but the
>>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>>> program still crashed at last, but it won't hurt.  I have tried the dpp
>>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>> genes
>>>> for dpp, is this number correct? I just want make sure everything works
>>>> fine and I will begin to use it with my data. Thanks!
>>>> 
>>>> Best,
>>>> Alvin
>>>> 
>>>> 
>>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>>> 
>>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>> fault
>>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>>> your
>>>>> system reaping the perl threads on completion.  You can try
>>>>> reinstalling
>>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>> the
>>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>>> really not affecting the output.  MAKER puts the results for each
>>>>> contig
>>>>> in a separate folder because some downstream programs like Apollo can
>>>>> only
>>>>> handle one contig at a time.  Use the
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file to see where each contigs output is stored.
>>>>> 
>>>>> 
>>>>> If you want a merged output file for everything, use the merge_gff
>>>>> script
>>>>> in maker and give it the
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file and it will assemble a merged output file for
>>>>> you.
>>>>> There are two type of output GFF3 which gives detailed annotation
>>>>> information and fasta which just produces sequence for each
>>>>> transcript.
>>>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>>>> the
>>>>> same 
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file).  The fiel you are interested will be the
>>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>>> 
>>>>> More information on MAKER's output here -->
>>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>>> 
>>>>> Thanks,
>>>>> Carson
>>>>> 
>>>>> 
>>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>>> 
>>>>>> Hi Alvin,
>>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>>> maker
>>>>>> did finish making the gff file successfully.
>>>>>> 
>>>>>> GFFs are actually buried deep down. One possibility is that you were
>>>>>> looking only in parent folders.
>>>>>> If you have not done already,  you might want to check for gffs at:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re/*/*/*. ie, three levels down your data store.
>>>>>> 
>>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>>> Failed/Finsihed ?
>>>>>> 
>>>>>> Gowthaman
>>>>>> ________________________________________
>>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>>> [alvinchen2002 at gmail.com]
>>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>>> To: maker-devel at yandell-lab.org
>>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>>> 
>>>>>> Hi,
>>>>>> 
>>>>>>     This is my first time to use maker. I have installed everything
>>>>>> that required by maker, and use the data in "data" folder to test
>>>>>> this
>>>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>>>> clue
>>>>>> of this?
>>>>>> 
>>>>>> Thanks,
>>>>>> Alvin
>>>>>> 
>>>>>> Here is the output of the program:
>>>>>> 
>>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>>> maker_exe.ctl
>>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>>> located
>>>>>> The blast_type 'ncbi' will be used instead.
>>>>>> 
>>>>>> A data structure will be created for you at:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re
>>>>>> 
>>>>>> To access files for individual sequences use the datastore index:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mas
>>>>>> te
>>>>>> r_
>>>>>> datastore_index.log
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> --Next Contig--
>>>>>> 
>>>>>> 
>>>>>> #---------------------------------------------------------------------
>>>>>> Now starting the contig!!
>>>>>> SeqID: contig-dpp-500-500
>>>>>> Length: 32156
>>>>>> 
>>>>>> #---------------------------------------------------------------------
>>>>>> 
>>>>>> 
>>>>>> running  repeat masker.
>>>>>> #--------- command -------------#
>>>>>> Widget::RepeatMasker:
>>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .0.all.rb -species all -dir
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>>> #-------------------------------#
>>>>>> processing output:
>>>>>> cycle 1
>>>>>> cycle 2
>>>>>> cycle 3
>>>>>> cycle 4
>>>>>> cycle 5
>>>>>> cycle 6
>>>>>> cycle 7
>>>>>> cycle 8
>>>>>> cycle 9
>>>>>> cycle 10
>>>>>> Generating output...
>>>>>> masking
>>>>>> done
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 0.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 1.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 2.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 3.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 4.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 5.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 6.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 7.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 8.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 9.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:5 j_size:3
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:5   current i:0
>>>>>> i_size:5   current i:1
>>>>>> i_size:5   current i:2
>>>>>> i_size:5   current i:3
>>>>>> i_size:5   current i:4
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastn:
>>>>>> /usr/bin/blastall -p blastn -d
>>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>> -e
>>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>> -I T
>>>>>> -o 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>>> #-------------------------------#
>>>>>> deleted:-1 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.bla
>>>>>> st
>>>>>> x
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>>> #-------------------------------#
>>>>>> cleaning blastn...
>>>>>> cleaning tblastx...
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>>> #-------------------------------#
>>>>>> cleaning blastx...
>>>>>> Preparing evidence for hint based annotation
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:15 j_size:1
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:15   current i:0
>>>>>> i_size:15   current i:1
>>>>>> i_size:15   current i:2
>>>>>> i_size:15   current i:3
>>>>>> i_size:15   current i:4
>>>>>> i_size:15   current i:5
>>>>>> i_size:15   current i:6
>>>>>> i_size:15   current i:7
>>>>>> i_size:15   current i:8
>>>>>> i_size:15   current i:9
>>>>>> i_size:15   current i:10
>>>>>> i_size:15   current i:11
>>>>>> i_size:15   current i:12
>>>>>> i_size:15   current i:13
>>>>>> i_size:15   current i:14
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:0 j_size:0
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> ...processing 0 of 5
>>>>>> ...processing 1 of 5
>>>>>> ...processing 2 of 5
>>>>>> ...processing 3 of 5
>>>>>> Making transcripts
>>>>>> Processing transcripts into genes
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:3 j_size:1
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:3   current i:0
>>>>>> i_size:3   current i:1
>>>>>> i_size:3   current i:2
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:0 j_size:0
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> now careful_clustering....
>>>>>> getting Pairs
>>>>>> doing single linkage clustering
>>>>>> ...processing 0 of 3
>>>>>> ...processing 1 of 3
>>>>>> Calculating annotation quality statistics
>>>>>> Choosing best annotations
>>>>>> 
>>>>>> 
>>>>>> Maker is now finished!!!
>>>>>> 
>>>>>> Segmentation fault
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> _______________________________________________
>>>>>> maker-devel mailing list
>>>>>> maker-devel at box290.bluehost.com
>>>>>> 
>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>> g
>>>>>> 
>>>>>> _______________________________________________
>>>>>> maker-devel mailing list
>>>>>> maker-devel at box290.bluehost.com
>>>>>> 
>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>> g
>>>>> 
>>>>> 
>>>> 
>>> 
>>> 
>> 
> 
> 




From carsonhh at gmail.com  Tue Jun 19 23:50:03 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:50:03 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <6C911ABF-19AF-4EBB-A990-1ECE85ADD7E3@gmail.com>
Message-ID: <CC06B280.EAF2%carsonhh@gmail.com>

Perfect.  And good to know.

Thanks,
Carson


On 12-06-19 10:48 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey Carson, 
>
>	It seems like there is a bug in Proc-ProcessTable 0.45.  I solved the
>problem by downgraded Proc-ProcessTable from 0.45 to 0.44. I can run 2.25
>without any problems now.
>
>Cheers,
>Alvin
>
>On Jun 20, 2012, at 1:21 AM, Carson Holt wrote:
>
>> Those are wrapped in an END block so they only run when perl exits (I.e.
>> post completion or failure).  If 2.25 is failing it would likely be for
>> another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
>> -debug).  Does it produce any output before failure?
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> 
>> 
>> On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>> 
>>> Hey  Carson,
>>> 
>>> 	I am still using 2.10, because 2.25 get crashed at the beginning. I
>>> think it may be caused by these codes:
>>> 
>>> Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>>> maintainers
>>> Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>>> maintainers"
>>> 
>>> You have added them at the top of the scripts in the new version.
>>> 
>>> Alvin
>>> 
>>> On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>>> 
>>>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant
>>>>MAKER
>>>> version 2.25 (type maker -v to see the version you are using).  The
>>>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>>>> process fails to respond to signals upstream in the code.  The 2.25
>>>> version of MAKER does some extra things that should even further avoid
>>>> the
>>>> need for the call compared to MAKER 2.10.
>>>> 
>>>> Thanks,
>>>> Carson
>>>> 
>>>> 
>>>> 
>>>> 
>>>> 
>>>> 
>>>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>>>> 
>>>>> Hey Carson and Gowthaman,
>>>>> 
>>>>> 	Thanks for your replies! You are right, Carson, the problem caused
>>>>>by
>>>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>>>> dpp_contig_master_datastore_index.log shows that the job has
>>>>>finished.
>>>>> I
>>>>> have installed the newest version of forks and forks::shared. but the
>>>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>>>> program still crashed at last, but it won't hurt.  I have tried the
>>>>>dpp
>>>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>>> genes
>>>>> for dpp, is this number correct? I just want make sure everything
>>>>>works
>>>>> fine and I will begin to use it with my data. Thanks!
>>>>> 
>>>>> Best,
>>>>> Alvin
>>>>> 
>>>>> 
>>>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>>>> 
>>>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>>> fault
>>>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>>>> your
>>>>>> system reaping the perl threads on completion.  You can try
>>>>>> reinstalling
>>>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>>> the
>>>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>>>> really not affecting the output.  MAKER puts the results for each
>>>>>> contig
>>>>>> in a separate folder because some downstream programs like Apollo
>>>>>>can
>>>>>> only
>>>>>> handle one contig at a time.  Use the
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file to see where each contigs output is stored.
>>>>>> 
>>>>>> 
>>>>>> If you want a merged output file for everything, use the merge_gff
>>>>>> script
>>>>>> in maker and give it the
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file and it will assemble a merged output file
>>>>>>for
>>>>>> you.
>>>>>> There are two type of output GFF3 which gives detailed annotation
>>>>>> information and fasta which just produces sequence for each
>>>>>> transcript.
>>>>>> Use fasta_merge to get a merged fasta file for all contigs (giving
>>>>>>it
>>>>>> the
>>>>>> same 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file).  The fiel you are interested will be the
>>>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>>>> 
>>>>>> More information on MAKER's output here -->
>>>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>>>> 
>>>>>> Thanks,
>>>>>> Carson
>>>>>> 
>>>>>> 
>>>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>>>> 
>>>>>>> Hi Alvin,
>>>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>>>> maker
>>>>>>> did finish making the gff file successfully.
>>>>>>> 
>>>>>>> GFFs are actually buried deep down. One possibility is that you
>>>>>>>were
>>>>>>> looking only in parent folders.
>>>>>>> If you have not done already,  you might want to check for gffs at:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re/*/*/*. ie, three levels down your data store.
>>>>>>> 
>>>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>>>> Failed/Finsihed ?
>>>>>>> 
>>>>>>> Gowthaman
>>>>>>> ________________________________________
>>>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>>>> [alvinchen2002 at gmail.com]
>>>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>>>> To: maker-devel at yandell-lab.org
>>>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>>>> 
>>>>>>> Hi,
>>>>>>> 
>>>>>>>     This is my first time to use maker. I have installed everything
>>>>>>> that required by maker, and use the data in "data" folder to test
>>>>>>> this
>>>>>>> program. But I got a "Segmentation fault" message after "Maker is
>>>>>>>now
>>>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have
>>>>>>>a
>>>>>>> clue
>>>>>>> of this?
>>>>>>> 
>>>>>>> Thanks,
>>>>>>> Alvin
>>>>>>> 
>>>>>>> Here is the output of the program:
>>>>>>> 
>>>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>>>> maker_exe.ctl
>>>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>>>> located
>>>>>>> The blast_type 'ncbi' will be used instead.
>>>>>>> 
>>>>>>> A data structure will be created for you at:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re
>>>>>>> 
>>>>>>> To access files for individual sequences use the datastore index:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_m
>>>>>>>as
>>>>>>> te
>>>>>>> r_
>>>>>>> datastore_index.log
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> --Next Contig--
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>#-------------------------------------------------------------------
>>>>>>>--
>>>>>>> Now starting the contig!!
>>>>>>> SeqID: contig-dpp-500-500
>>>>>>> Length: 32156
>>>>>>> 
>>>>>>> 
>>>>>>>#-------------------------------------------------------------------
>>>>>>>--
>>>>>>> 
>>>>>>> 
>>>>>>> running  repeat masker.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::RepeatMasker:
>>>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .0.all.rb -species all -dir
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>>>> #-------------------------------#
>>>>>>> processing output:
>>>>>>> cycle 1
>>>>>>> cycle 2
>>>>>>> cycle 3
>>>>>>> cycle 4
>>>>>>> cycle 5
>>>>>>> cycle 6
>>>>>>> cycle 7
>>>>>>> cycle 8
>>>>>>> cycle 9
>>>>>>> cycle 10
>>>>>>> Generating output...
>>>>>>> masking
>>>>>>> done
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 0.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 1.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 2.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 3.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 4.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 5.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 6.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 7.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 8.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 9.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:5 j_size:3
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:5   current i:0
>>>>>>> i_size:5   current i:1
>>>>>>> i_size:5   current i:2
>>>>>>> i_size:5   current i:3
>>>>>>> i_size:5   current i:4
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastn:
>>>>>>> /usr/bin/blastall -p blastn -d
>>>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>>> -e
>>>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>>> -I T
>>>>>>> -o 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>>>> #-------------------------------#
>>>>>>> deleted:-1 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.b
>>>>>>>la
>>>>>>> st
>>>>>>> x
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> cleaning blastn...
>>>>>>> cleaning tblastx...
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> cleaning blastx...
>>>>>>> Preparing evidence for hint based annotation
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:15 j_size:1
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:15   current i:0
>>>>>>> i_size:15   current i:1
>>>>>>> i_size:15   current i:2
>>>>>>> i_size:15   current i:3
>>>>>>> i_size:15   current i:4
>>>>>>> i_size:15   current i:5
>>>>>>> i_size:15   current i:6
>>>>>>> i_size:15   current i:7
>>>>>>> i_size:15   current i:8
>>>>>>> i_size:15   current i:9
>>>>>>> i_size:15   current i:10
>>>>>>> i_size:15   current i:11
>>>>>>> i_size:15   current i:12
>>>>>>> i_size:15   current i:13
>>>>>>> i_size:15   current i:14
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:0 j_size:0
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> ...processing 0 of 5
>>>>>>> ...processing 1 of 5
>>>>>>> ...processing 2 of 5
>>>>>>> ...processing 3 of 5
>>>>>>> Making transcripts
>>>>>>> Processing transcripts into genes
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:3 j_size:1
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:3   current i:0
>>>>>>> i_size:3   current i:1
>>>>>>> i_size:3   current i:2
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:0 j_size:0
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> now careful_clustering....
>>>>>>> getting Pairs
>>>>>>> doing single linkage clustering
>>>>>>> ...processing 0 of 3
>>>>>>> ...processing 1 of 3
>>>>>>> Calculating annotation quality statistics
>>>>>>> Choosing best annotations
>>>>>>> 
>>>>>>> 
>>>>>>> Maker is now finished!!!
>>>>>>> 
>>>>>>> Segmentation fault
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> _______________________________________________
>>>>>>> maker-devel mailing list
>>>>>>> maker-devel at box290.bluehost.com
>>>>>>> 
>>>>>>> 
>>>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.
>>>>>>>or
>>>>>>> g
>>>>>>> 
>>>>>>> _______________________________________________
>>>>>>> maker-devel mailing list
>>>>>>> maker-devel at box290.bluehost.com
>>>>>>> 
>>>>>>> 
>>>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.
>>>>>>>or
>>>>>>> g
>>>>>> 
>>>>>> 
>>>>> 
>>>> 
>>>> 
>>> 
>> 
>> 
>





From scott at scottcain.net  Fri Jun 22 08:55:56 2012
From: scott at scottcain.net (Scott Cain)
Date: Fri, 22 Jun 2012 10:55:56 -0400
Subject: [maker-devel] Applications open for GMOD Summer School 2012
Message-ID: <CA+JTaoz5z=hMqqpvRogmuTHdOrGBnqNHy510dxH0y68v0u1HNA@mail.gmail.com>

Applications are now being accepted for the 2012 GMOD Summer School
course, a five-day hands-on school aimed at teaching new GMOD
administrators how to install, configure and integrate popular GMOD
Components. The course will be held August 25-29 at the US National
Evolutionary Synthesis Center (NESCent) in Durham, North Carolina.

 https://docs.google.com/a/scottcain.net/spreadsheet/embeddedform?formkey=dG5hNGFiQ3UwYTV2LUZxZW04Qm1yZXc6MQ

These components will be covered at the school:

   Apollo or WebApollo - genome annotation editor
   Chado - biological database schema
   Galaxy - workflow system
   GBrowse - genome viewer
   GBrowse_syn - synteny viewer
   GFF3 - genome annotation file format and tools
   InterMine - biological data mining system
   JBrowse - next generation genome browser
   MAKER - genome annotation pipeline
   Tripal - web front end to Chado databases


The deadline for applying is the end of July 9, 2012. Admission is
competitive and is based on the strength of the application,
especially the statement of interest. The 2011 school had over 70
applicants for the 25 slots. Any application received after deadline
will be automatically placed on the waiting list.

The course requires some knowledge of Linux as a prerequisite. The
registration fee will be $300 (only $60 per day). There will be a
limited number of scholarships available.

Thanks,

Scott Cain

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
Ontario Institute for Cancer Research



From sajeet at gmail.com  Mon Jun 25 18:41:01 2012
From: sajeet at gmail.com (Sajeet Haridas)
Date: Mon, 25 Jun 2012 17:41:01 -0700
Subject: [maker-devel] ERROR: Chunk failed at level 20
Message-ID: <000001cd5334$5c955df0$15c019d0$@com>

Hello,

I am running Maker 2.10 on two versions (using two assembly programs) of a
fungal genome (~33Mbp). While one completes successfully, the other does
not. One of the scaffolds (out of 65) throws the following error.

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Calling translate without a seq argument!
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
STACK: Bio::Tools::CodonTable::translate
/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
STACK: PhatHit_utils::_adjust
/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
STACK: PhatHit_utils::adjust_start_stop
/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
STACK: maker::auto_annotator::load_transcript_struct
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
STACK: maker::auto_annotator::group_transcripts
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
STACK: maker::auto_annotator::annotate_genes
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
STACK: Process::MpiChunk::_go
/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
STACK: Process::MpiChunk::run
/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
STACK: Process::MpiTiers::run_all
/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
STACK: /opt/maker_2.10/bin/maker:276
-----------------------------------------------------------

FATAL ERROR
ERROR: Failed while clustering transcripts into genes for annotations!!

ERROR: Chunk failed at level 20
!!


Any help appreciated.

Thank you,

Sajeet




From carsonhh at gmail.com  Tue Jun 26 08:07:09 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 26 Jun 2012 10:07:09 -0400
Subject: [maker-devel] ERROR: Chunk failed at level 20
In-Reply-To: <000001cd5334$5c955df0$15c019d0$@com>
Message-ID: <CC0F3A2F.ED74%carsonhh@gmail.com>

Have you tried the most current version, 2.25?

Thanks,
Carson


On 12-06-25 8:41 PM, "Sajeet Haridas" <sajeet at gmail.com> wrote:

>Hello,
>
>I am running Maker 2.10 on two versions (using two assembly programs) of a
>fungal genome (~33Mbp). While one completes successfully, the other does
>not. One of the scaffolds (out of 65) throws the following error.
>
>------------- EXCEPTION: Bio::Root::Exception -------------
>MSG: Calling translate without a seq argument!
>STACK: Error::throw
>STACK: Bio::Root::Root::throw
>/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
>STACK: Bio::Tools::CodonTable::translate
>/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
>STACK: PhatHit_utils::_adjust
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
>STACK: PhatHit_utils::adjust_start_stop
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
>STACK: maker::auto_annotator::load_transcript_struct
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
>STACK: maker::auto_annotator::group_transcripts
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
>STACK: maker::auto_annotator::annotate_genes
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
>STACK: Process::MpiChunk::_go
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
>STACK: Process::MpiChunk::run
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
>STACK: Process::MpiTiers::run_all
>/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
>STACK: /opt/maker_2.10/bin/maker:276
>-----------------------------------------------------------
>
>FATAL ERROR
>ERROR: Failed while clustering transcripts into genes for annotations!!
>
>ERROR: Chunk failed at level 20
>!!
>
>
>Any help appreciated.
>
>Thank you,
>
>Sajeet
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From sajeet at gmail.com  Tue Jun 26 11:45:05 2012
From: sajeet at gmail.com (Sajeet Haridas)
Date: Tue, 26 Jun 2012 10:45:05 -0700
Subject: [maker-devel] ERROR: Chunk failed at level 20
In-Reply-To: <CC0F3A2F.ED74%carsonhh@gmail.com>
References: <000001cd5334$5c955df0$15c019d0$@com>
	<CC0F3A2F.ED74%carsonhh@gmail.com>
Message-ID: <000601cd53c3$6bed89f0$43c89dd0$@com>

Thank you.
It seems to work with 2.25.

Sajeet

-----Original Message-----
From: Carson Holt [mailto:carsonhh at gmail.com] 
Sent: June-26-12 7:07 AM
To: Sajeet Haridas; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] ERROR: Chunk failed at level 20

Have you tried the most current version, 2.25?

Thanks,
Carson


On 12-06-25 8:41 PM, "Sajeet Haridas" <sajeet at gmail.com> wrote:

>Hello,
>
>I am running Maker 2.10 on two versions (using two assembly programs) 
>of a fungal genome (~33Mbp). While one completes successfully, the 
>other does not. One of the scaffolds (out of 65) throws the following
error.
>
>------------- EXCEPTION: Bio::Root::Exception -------------
>MSG: Calling translate without a seq argument!
>STACK: Error::throw
>STACK: Bio::Root::Root::throw
>/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
>STACK: Bio::Tools::CodonTable::translate
>/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
>STACK: PhatHit_utils::_adjust
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
>STACK: PhatHit_utils::adjust_start_stop
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
>STACK: maker::auto_annotator::load_transcript_struct
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
>STACK: maker::auto_annotator::group_transcripts
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
>STACK: maker::auto_annotator::annotate_genes
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
>STACK: Process::MpiChunk::_go
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
>STACK: Process::MpiChunk::run
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
>STACK: Process::MpiTiers::run_all
>/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
>STACK: /opt/maker_2.10/bin/maker:276
>-----------------------------------------------------------
>
>FATAL ERROR
>ERROR: Failed while clustering transcripts into genes for annotations!!
>
>ERROR: Chunk failed at level 20
>!!
>
>
>Any help appreciated.
>
>Thank you,
>
>Sajeet
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org






From ranjani at uga.edu  Wed Jun 27 07:49:02 2012
From: ranjani at uga.edu (Sivaranjani Namasivayam)
Date: Wed, 27 Jun 2012 13:49:02 +0000
Subject: [maker-devel] Re-annotation
Message-ID: <A21F03FBB429334EB4D450CC75E8CBF3487DC468@CH1PRD0210MB384.namprd02.prod.outlook.com>

Hi,

I have a quick question about re-annotation. Under the re-annotation section, the provided maker's gff file from a previous run and set est_pass, altest_pass, protein_pass, rm_pass to 1.
I also provided some EST evidence (to the tag est) under the EST evidence section, but I don't see these ESTs being mapped to the genome (no blastn or est2genome) in the output gff files.
Is this expected?

Thanks,
Ranjani
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120627/f10008ce/attachment-0001.html>

From carsonhh at gmail.com  Wed Jun 27 09:43:14 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 27 Jun 2012 11:43:14 -0400
Subject: [maker-devel] Re-annotation
In-Reply-To: <A21F03FBB429334EB4D450CC75E8CBF3487DC468@CH1PRD0210MB384.namprd02.prod.outlook.com>
Message-ID: <CC10A193.EDB9%carsonhh@gmail.com>

If the new ESTs don't map within the threshold parameters set in the
maker_bopt.ctl file, then you would not expect new results.  Don't be
surprised if the new results are just hard to identify within the context of
the ESTs already being passed back through.  If you want to test the new
ESTs, then set est_pass to 0 during your next run and see if there are still
no ESTs.

Thanks,
Carson



From:  Sivaranjani Namasivayam <ranjani at uga.edu>
Date:  Wednesday, 27 June, 2012 9:49 AM
To:  "maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  [maker-devel] Re-annotation

Hi,

I have a quick question about re-annotation. Under the re-annotation
section, the provided maker's gff file from a previous run and set est_pass,
altest_pass, protein_pass, rm_pass to 1.
I also provided some EST evidence (to the tag est) under the EST evidence
section, but I don't see these ESTs being mapped to the genome (no blastn or
est2genome) in the output gff files.
Is this expected?

Thanks,
Ranjani
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120627/4afce4ea/attachment-0001.html>

From lei.liu.conze at slu.se  Wed Jun 27 08:26:35 2012
From: lei.liu.conze at slu.se (Lei Conze Liu)
Date: Wed, 27 Jun 2012 16:26:35 +0200
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
Message-ID: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>

Hi,

I just downloaded the recent version of maker-2.10.tgz but I can not
find the folder "bin" where contains the MAKER executables. Am I missing
something? It would be great if somebody can help me with that.

Greetings,

Lei

From carsonhh at gmail.com  Wed Jun 27 09:51:08 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 27 Jun 2012 11:51:08 -0400
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
Message-ID: <CC10A299.EDC3%carsonhh@gmail.com>

You need to go to the maker/src/ directory and run 'perl Build.PL'.  Then
run './Build install'.

Note that if you are by any chance are using the CPAN module 'local::lib'
on your system which redefines certain Perl installation parameters
affecting CPAN and Module::Build that those changes will cause MAKER (as
well as many other things in Perl) to install to a non-standard location
(in ~/perl5/bin usually) and if that is the case you should use maker
version 2.25 instead of 2.10 to get the install to complete correctly.

Thanks,
Carson





On 12-06-27 10:26 AM, "Lei Conze Liu" <lei.liu.conze at slu.se> wrote:

>Hi,
>
>I just downloaded the recent version of maker-2.10.tgz but I can not
>find the folder "bin" where contains the MAKER executables. Am I missing
>something? It would be great if somebody can help me with that.
>
>Greetings,
>
>Lei
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From lei.liu.conze at slu.se  Wed Jun 27 14:33:04 2012
From: lei.liu.conze at slu.se (Lei Conze Liu)
Date: Wed, 27 Jun 2012 22:33:04 +0200
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
References: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
Message-ID: <11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>

Dear all,

Thank you very much for the quick reply. I appreciate it very much.
I have indeed gone to the maker/src directory and have run 'perl Build.PL' and './Build install', but still misses the 'bin' folder.
As Carson have kindly pointed out that I might run into this kind of problem if I am using CPAN module 'local::lib' which I think I might be. So tomorrow I will try to install the 2.25 version and let you know how it goes.

Many thanks!

Greetings from Sweden

Lei


On 27 Jun 2012, at 16:26, Lei Conze Liu wrote:

Hi,

I just downloaded the recent version of maker-2.10.tgz but I can not
find the folder "bin" where contains the MAKER executables. Am I missing
something? It would be great if somebody can help me with that.

Greetings,

Lei
_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120627/44c08a8c/attachment-0001.html>

From cjfields at illinois.edu  Wed Jun 27 14:41:25 2012
From: cjfields at illinois.edu (Fields, Christopher J)
Date: Wed, 27 Jun 2012 20:41:25 +0000
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>
References: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
	<11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>
Message-ID: <CC9C6F22-A8A4-4AE3-83BE-E0B5D20AD736@illinois.edu>

I got v2.25 working with local::lib myself.  I plan on using that along with a loadable module (via http://modules.sourceforge.net/) to make launching maker as easy as possible (and also allow us to keep separate contained versions on the cluster w/o having to bend over backwards with env settings).

chris

On Jun 27, 2012, at 3:33 PM, Lei Conze Liu wrote:

> Dear all,
> 
> Thank you very much for the quick reply. I appreciate it very much. 
> I have indeed gone to the maker/src directory and have run 'perl Build.PL' and './Build install', but still misses the 'bin' folder.
> As Carson have kindly pointed out that I might run into this kind of problem if I am using CPAN module 'local::lib' which I think I might be. So tomorrow I will try to install the 2.25 version and let you know how it goes. 
> 
> Many thanks!
> 
> Greetings from Sweden
> 
> Lei
> 
> 
> On 27 Jun 2012, at 16:26, Lei Conze Liu wrote:
> 
>> Hi,
>> 
>> I just downloaded the recent version of maker-2.10.tgz but I can not
>> find the folder "bin" where contains the MAKER executables. Am I missing
>> something? It would be great if somebody can help me with that.
>> 
>> Greetings,
>> 
>> Lei
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
> 
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org




From markus.ankenbrand at stud-mail.uni-wuerzburg.de  Thu Jun 28 08:03:20 2012
From: markus.ankenbrand at stud-mail.uni-wuerzburg.de (Markus Ankenbrand)
Date: Thu, 28 Jun 2012 16:03:20 +0200
Subject: [maker-devel] maker-2.24 fails while preparing evidence clusters
Message-ID: <4FEC6428.3010108@stud-mail.uni-wuerzburg.de>

Hi all,

I'm using maker-2.24 to annotate contigs of a procaryotic organism. I'm
only using coding sequences of a reference species as "altest". Without
any obvious reason annotation fails for some contigs. It seems to have
nothing to do with the contig length. I also tried to run maker with
different reference ESTs and GeneMark. Depending on the setup different
contigs fail.

In case of failure, the log is:
...
cleaning clusters....
total clusters:3 now processing 0
   ...processing 0 of 3
   ...processing 1 of 3
total clusters:3 now processing 0
total clusters:3 now processing 0
   ...processing 0 of 2
Can't call method "start" on an undefined valueERROR: Failed while
preparing evidence clusters for annotations
ERROR: Chunk failed at level:0, tier_type:3
FAILED CONTIG:contig1

ERROR: Chunk failed at level:7, tier_type:0
FAILED CONTIG:contig1

--Next Contig--
...

If someone has any idea how to solve this problem, help would be very
much apriciated.

Greetings,
Markus



From fourie.joubert at up.ac.za  Thu Jun 28 09:11:31 2012
From: fourie.joubert at up.ac.za (Fourie Joubert)
Date: Thu, 28 Jun 2012 17:11:31 +0200
Subject: [maker-devel] Advice for optimizing augustus training on fungal
	genome?
Message-ID: <4FEC7423.3050001@up.ac.za>

Hi Everyone

Apologies if this is not the relevant list to mail to.

I am looking for advice in training augustus for a novel fungal genome.

I generated a gene set using CEGMA (below), and have subsequently been 
following the instructions at 
http://www.molecularevolution.org/molevolfiles/exercises/augustus/scipio.html 
and at 
http://www.molecularevolution.org/molevolfiles/exercises/augustus/training.html.

My training set is 339 genes and the test set is 100 genes.

My initial output is below.

It does not improve much with optimize_augustus.

When using the training paramters to predict genes in the genome, I seem 
to only find around 2,000 of the known ~16,000 genes. When I use the 
training data from a distantly related fungus (Neurospora), I get 
roughly the correct number of genes.

I am obviously doing something wrong here... (commands below).

I would really appreciate any advice on where to start looking for 
improvement.

Kindest regards!

Fourie





Augustus commands (Editedmyspecies_parameters.cfg  and setstopCodonExcludedFromCDS  to true.):

>  etraining --species=myspecies genes.gb.train

>  augustus --species=myspecies genes.gb.test | tee firsttest.out

>  grep -A 22 Evaluation firsttest.out

>  optimize_augustus.pl --species=myspecies genes.gb.train

>  etraining --species=myspecies genes.gb.train

>  augustus --species=myspecies genes.gb.test | tee secondtest.out

>  grep -A 22 Evaluation secondtest.out



CEGMA output:

#      Statistics of the completeness of the genome based on 248 CEGs      #

               #Prots  %Completeness  -  #Total  Average  %Ortho

   Complete      240       96.77      -   278     1.16     11.67

    Group 1       64       96.97      -    72     1.12      7.81
    Group 2       54       96.43      -    66     1.22     18.52
    Group 3       58       95.08      -    70     1.21     13.79
    Group 4       64       98.46      -    70     1.09      7.81

    Partial      245       98.79      -   290     1.18     13.88

    Group 1       65       98.48      -    73     1.12      7.69
    Group 2       56      100.00      -    70     1.25     21.43
    Group 3       59       96.72      -    75     1.27     18.64
    Group 4       65      100.00      -    72     1.11      9.23




Augustus output:

*******      Evaluation of gene prediction     *******

---------------------------------------------\

                  | sensitivity | specificity |

---------------------------------------------|

nucleotide level |       0.933 |       0.772 |

---------------------------------------------/

----------------------------------------------------------------------------------------------------------\

            |  #pred |  #anno |      |    FP = false pos. |    FN = false neg. |             |             |

            | total/ | total/ |   TP |--------------------|--------------------| sensitivity | specificity |

            | unique | unique |      | part | ovlp | wrng | part | ovlp | wrng |             |             |

----------------------------------------------------------------------------------------------------------|

            |        |        |      |                229 |                 85 |             |             |

exon level |    475 |    331 |  246 | ------------------ | ------------------ |       0.743 |       0.518 |

            |    475 |    331 |      |   59 |    9 |  161 |   56 |    2 |   27 |             |             |

----------------------------------------------------------------------------------------------------------/

----------------------------------------------------------------------------\

transcript | #pred | #anno |   TP |   FP |   FN | sensitivity | specificity |

----------------------------------------------------------------------------|

gene level |   158 |   100 |   45 |  113 |   55 |        0.45 |       0.285 |

----------------------------------------------------------------------------/




-- 
--------------
Prof Fourie Joubert
Bioinformatics and Computational Biology Unit
Department of Biochemistry
University of Pretoria
fourie.joubert at up.ac.za
http://www.bi.up.ac.za
Tel. +27-12-420-5825
Fax. +27-12-420-5800

-------------------------------------------------------------------------
This message and attachments are subject to a disclaimer. Please refer
to www.it.up.ac.za/documentation/governance/disclaimer/ for full details.




From yogeshp08 at gmail.com  Fri Jun  1 10:56:13 2012
From: yogeshp08 at gmail.com (Yogesh)
Date: Fri, 1 Jun 2012 11:56:13 -0500
Subject: [maker-devel] tblastn Cleanup?
In-Reply-To: <CBDBD0A5.C8CD%carsonhh@gmail.com>
References: <CBDBD0A5.C8CD%carsonhh@gmail.com>
Message-ID: <E782BA7523C145C994B5BE8509009476@gmail.com>

Hi Carson,

Thanks a lot. This is helpful.

Also I wanted to ask how can I follow this up with exonerate polishing. Is there a module in MAKER that can run this separately on my BLAST results?

-Yogesh


On Friday, May 18, 2012 at 9:22 AM, Carson Holt wrote:

> There are several things.  I set several filtering options directly on the BLAST command line.  These are things like maximum intron length, an e-value filter, and simple repeat filtering (called dust filter in NCBI blast and seg filter in WUBLAST).
> 
> I also run repeat masker over the genome first.  This allows simple and complex repeats to be removed before running BLAST (otherwise you get many false alignments).
> 
> Last I filter the results based on percent coverage of the hit to the original database sequence and percent identity.  I think you can set percent identity as a flag in BLAST, but the percent coverage filter is being calculated by MAKER, so to do this outside of MAKER would require that you write your own filtering script to compare the length of the alignment to the length of the sequence in the database.
> 
> I also have an HSP depth overlap filter.  This removes weird low complexity hits that escape repeatmasking.  They show up as multiple HSPs overlapping multiple times in the same region (usually very high numbers like 90 HSPs all 100 bp long in the same region).  I calculate the number of base pairs in the alignment on the hit then divide by the number of base pairs in the query alignment.  If it's greater than 3, I throw the hit out.
> 
> Thanks,
> Carson
> 
> 
> 
> From: Yogesh <yogeshp08 at gmail.com (mailto:yogeshp08 at gmail.com)>
> Date: Tuesday, 15 May, 2012 12:07 PM
> To: <maker-devel at yandell-lab.org (mailto:maker-devel at yandell-lab.org)>
> Subject: [maker-devel] tblastn Cleanup?
> 
> Hello,
> 
> I have a few tblastn alignments with a lot of low quality hits. I have to clean that up. Can you please suggest how Maker pipeline does it? Also can I run it directly on my data without having to go through the whole pipeline?
> 
> Thanks,
> 
> -Yogesh
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/71d95d76/attachment-0002.html>

From carsonhh at gmail.com  Fri Jun  1 11:01:50 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 13:01:50 -0400
Subject: [maker-devel] tblastn Cleanup?
In-Reply-To: <E782BA7523C145C994B5BE8509009476@gmail.com>
Message-ID: <CBEE6CF1.D401%carsonhh@gmail.com>

MAKER does this in the GI library file (function --> GI::polish_exonerate).
You might have to do some coding to modify it to work in your own scripts.
It has multiple dependencies on other MAKER library files including
exonerate::splice_info, Widget::exonerate::est2genome, and
Widget::exonerate::protein2genome.

Thanks,
Carson

From:  Yogesh <yogeshp08 at gmail.com>
Date:  Friday, 1 June, 2012 12:56 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] tblastn Cleanup?

 
Hi Carson,

Thanks a lot. This is helpful.

Also I wanted to ask how can I follow this up with exonerate polishing. Is
there a module in MAKER that can run this separately on my BLAST results?

-Yogesh

  

On Friday, May 18, 2012 at 9:22 AM, Carson Holt wrote:
> 
>  
> There are several things.  I set several filtering options directly on the
> BLAST command line.  These are things like maximum intron length, an e-value
> filter, and simple repeat filtering (called dust filter in NCBI blast and seg
> filter in WUBLAST).
> 
> I also run repeat masker over the genome first.  This allows simple and
> complex repeats to be removed before running BLAST (otherwise you get many
> false alignments).
> 
> Last I filter the results based on percent coverage of the hit to the original
> database sequence and percent identity.  I think you can set percent identity
> as a flag in BLAST, but the percent coverage filter is being calculated by
> MAKER, so to do this outside of MAKER would require that you write your own
> filtering script to compare the length of the alignment to the length of the
> sequence in the database.
> 
> I also have an HSP depth overlap filter.  This removes weird low complexity
> hits that escape repeatmasking.  They show up as multiple HSPs overlapping
> multiple times in the same region (usually very high numbers like 90 HSPs all
> 100 bp long in the same region).  I calculate the number of base pairs in the
> alignment on the hit then divide by the number of base pairs in the query
> alignment.  If it's greater than 3, I throw the hit out.
> 
> Thanks,
> Carson
> 
> 
> 
> From:  Yogesh <yogeshp08 at gmail.com>
> Date:  Tuesday, 15 May, 2012 12:07 PM
> To:  <maker-devel at yandell-lab.org>
> Subject:  [maker-devel] tblastn Cleanup?
> 
>  
> Hello,
> 
> I have a few tblastn alignments with a lot of low quality hits. I have to
> clean that up. Can you please suggest how Maker pipeline does it? Also can I
> run it directly on my data without having to go through the whole pipeline?
> 
> Thanks,
> 
> -Yogesh


-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/e145c056/attachment-0002.html>

From barry.moore at genetics.utah.edu  Fri Jun  1 12:22:56 2012
From: barry.moore at genetics.utah.edu (Barry Moore)
Date: Fri, 1 Jun 2012 12:22:56 -0600
Subject: [maker-devel] Can maker select a gene model based
	on	#algoritham predicted it
In-Reply-To: <CBEB8E25.D097%carsonhh@gmail.com>
References: <CBEB8E25.D097%carsonhh@gmail.com>
Message-ID: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543




-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/1a78f472/attachment-0002.html>

From carsonhh at gmail.com  Fri Jun  1 12:41:53 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 14:41:53 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>
Message-ID: <CBEE8148.D418%carsonhh@gmail.com>

While I could add an option to keep them if there are more than one, the
actual implementation is not as trivial as it seems.  On some organisms like
fungi and oomycetes, the predictions that don't overlap evidence tend to be
similar to each other across predictors, but on other eukaryotes with
difficult and complex intron/exon structure like lamprey or even planaria
about the only time two predictors will produce similar results coorelated
with when there is evidence supporting them, and all the unsupported regions
are messy with weird partial overlaps (sometimes even conflicting reading
frames).  I have a figure in the MAKER2 paper showing how poorly these
algorithms perform on such organisms and how additional evidence based
feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant
non-overlapping proteins recorded at the end of a MAKER run uses a complex
variant of the AED calculation across the alternate predictions to build a
consensus.  So in short it's not exactly as simple as just saying there are
two predictions at a given locus.  It would require some thought (as well as
good documentation), but it could probably be done.

--Carson

From:  Barry Moore <barry.moore at genetics.utah.edu>
Date:  Friday, 1 June, 2012 2:22 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

Carson,

How hard would it be to have maker take an option something like
'require_abinits=2' that would instruct maker to promote predictions that
overlap with (2, 3 or more) other predictions?  Seems like the maker might
have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.
I've got an offline copy of a newer tutorial wiki that is more up to date
than the GMOD version.  It's on a server right now that we've got locked
behind a firewall, but I'm hoping to move that to a public facing server in
the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/a3ab059e/attachment-0002.html>

From carsonhh at gmail.com  Fri Jun  1 12:52:46 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 14:52:46 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8543.D43A%carsonhh@gmail.com>
Message-ID: <CBEE8622.D43F%carsonhh@gmail.com>

One idea related to this.  I could have keep_preds be a floating point value
between 0 and 1.  This would then represent a threshold for an internal
MAKER value called the ab-initio AED (it already exists internally deep in
MAKER).  0 would turn keep_preds off (as it does now), 1 would keep
everything (as it does now), and values in between would allow the user to
dial in the degree of consensus among overlapping predictions when
considering them without evidence.  The ab-initio AED already works similar
to AED, with 0 being perfect concordance and 1 being complete discordance.

--Carson



From:  Carson Holt <carsonhh at gmail.com>
Date:  Friday, 1 June, 2012 2:41 PM
To:  Barry Moore <barry.moore at genetics.utah.edu>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

While I could add an option to keep them if there are more than one, the
actual implementation is not as trivial as it seems.  On some organisms like
fungi and oomycetes, the predictions that don't overlap evidence tend to be
similar to each other across predictors, but on other eukaryotes with
difficult and complex intron/exon structure like lamprey or even planaria
about the only time two predictors will produce similar results coorelated
with when there is evidence supporting them, and all the unsupported regions
are messy with weird partial overlaps (sometimes even conflicting reading
frames).  I have a figure in the MAKER2 paper showing how poorly these
algorithms perform on such organisms and how additional evidence based
feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant
non-overlapping proteins recorded at the end of a MAKER run uses a complex
variant of the AED calculation across the alternate predictions to build a
consensus.  So in short it's not exactly as simple as just saying there are
two predictions at a given locus.  It would require some thought (as well as
good documentation), but it could probably be done.

--Carson

From:  Barry Moore <barry.moore at genetics.utah.edu>
Date:  Friday, 1 June, 2012 2:22 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

Carson,

How hard would it be to have maker take an option something like
'require_abinits=2' that would instruct maker to promote predictions that
overlap with (2, 3 or more) other predictions?  Seems like the maker might
have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.
I've got an offline copy of a newer tutorial wiki that is more up to date
than the GMOD version.  It's on a server right now that we've got locked
behind a firewall, but I'm hoping to move that to a public facing server in
the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/11d85f8f/attachment-0002.html>

From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 13:06:30 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:06:30 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8148.D418%carsonhh@gmail.com>
References: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>,
	<CBEE8148.D418%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F903@mail02.sbri.org>

Hi Carson,
I agree with you mostly. Its better to have some form of evidence (blast, pfam etc) to call something as a coding gene. Genes that dont have evidence are hard to interpret anyway. But, in the organism we work on (Malaria and Leishmania parasites) we tend to see 100s of genus specific genes. Of course, as you would suspect, their biological/functional significance is not known. They remain as hypothetical proteins for years. But, the researchers still would like to lean towards slight over prediction over under prediction. 

Here is the approach i follow. I collect NON redundant set of proteins from all the related genus to supply as evidence in Maker. I run Augustus and Genemark inside Maker. Also supply gene models from another ab-initio gene prediction suite (automagi-our parasite specific). Automagi in-trun runs 3 algorithm and chooses a consensus gene model.  In short i run 5 gene predictors and chose anything that is predicted by 3. And predictions need NOT overlap to their entire length (this helps us to pull genes that are separated into two due to frame shifts). 

Yesterday, I wrote a small script, that takes all features predicted by MAKER compares them with 3 gffs (of Automagi=3, Augustus, Genemark). I keep_pred=1. It counts if a Maker chosen gene overlaps with prediction from at least 3 of 5 algorithms.

Hi Barry,
Thanks for letting me contribute to the wiki. Most of the edits i thought of is from discussing with Carson. I thought, doing so will save him bit more time from emailing in future. Its possible you got most of it already in latest wiki.  Something like, how to train Genemark. Its really hard to find it in their documentation. I learned it from one of Carson's earlier discussion.  My two cents.

Thanks,
Gowthaman

Carson: Thanks for the great tool. And thanks for every GREATER support. 

  
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 11:41 AM
To: Barry Moore
Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

While I could add an option to keep them if there are more than one, the actual implementation is not as trivial as it seems.  On some organisms like fungi and oomycetes, the predictions that don't overlap evidence tend to be similar to each other across predictors, but on other eukaryotes with difficult and complex intron/exon structure like lamprey or even planaria about the only time two predictors will produce similar results coorelated with when there is evidence supporting them, and all the unsupported regions are messy with weird partial overlaps (sometimes even conflicting reading frames).  I have a figure in the MAKER2 paper showing how poorly these algorithms perform on such organisms and how additional evidence based feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant non-overlapping proteins recorded at the end of a MAKER run uses a complex variant of the AED calculation across the alternate predictions to build a consensus.  So in short it's not exactly as simple as just saying there are two predictions at a given locus.  It would require some thought (as well as good documentation), but it could probably be done.

--Carson

From: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Date: Friday, 1 June, 2012 2:22 PM
To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

It's not an option in exactly the way you are specifying, but there is
something I usually do for annotation that works well.  I run interproscan
or rpsblast on the non_overlapping.proteins.fasta file and select just
those non-overlapping models that have a recognizable protein domain (just
searching the pfam doamin space is more than sufficient).  Then I provide
the selected results to model_gff, and provide the previous maker results
to the maker_gff option with (all reannotation pass options set to 1 and
all analysis options turned off).  This adds models with at least
recognizable domains (as even multiple gene predictors can overpredict in
a similar way).

Attached is a script to help select predictions and upgrade them to models
in GFF3 format.  If you have question let me know.

Thanks,
Carson



On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>> wrote:

Hi Carson,
Thanks for all the help during the long weekend, in spite of that long
drive. I am still trying to imagine that.

I now have maker to consider our own prediction via pred_gff, and use
augustus and gene mark (with our training model). And i was able to use
altest and protein evidences. Maker happily picks one gene model when
there is a overlap between three different predictions. But, when I look
at the gff, it seems like it picks a gene model only when there is an
est/protein evidence. It leaves out some genes even though, they are
predicted by all three algorithms. Of course, keep_pred=1 helps to keep
all the models. This kind of leads to over prediction.

But, I am looking for something in between. And would like to know if
that is possible?
1) Pick a gene model if it has an evidence from (est/prot etc...)
irrespective of how many algorithms predicted it
2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
if that is predicted by at least two algorithms.

Or even simpler:
I have ab-initio predictions from three algorithms, Can I output, those
genes that is supported by at least two of them. I care less about
exactness of gene boundaries.

Thanks,
Gowthaman

PS: With my recent attempts, i learned couple things about maker/other
associated tools that is not documented in gmod-maker wiki. Is it
possible/ok if I add contents to it. I am okay with running it by you
before making it public.

<gff3_preds2models>_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 13:07:18 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:07:18 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8622.D43F%carsonhh@gmail.com>
References: <CBEE8543.D43A%carsonhh@gmail.com>,
	<CBEE8622.D43F%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>

That sounds really good. 

Just wondering what would that float point mean? 

fraction of gene prediction algorithms predicted that region to contain a gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms predicted it?? 
Or 
it just indicates lever of concordance (in maker language) and user has to try different values before settling on one?

Thanks,
gowthaman
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 11:52 AM
To: Barry Moore
Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

One idea related to this.  I could have keep_preds be a floating point value between 0 and 1.  This would then represent a threshold for an internal MAKER value called the ab-initio AED (it already exists internally deep in MAKER).  0 would turn keep_preds off (as it does now), 1 would keep everything (as it does now), and values in between would allow the user to dial in the degree of consensus among overlapping predictions when considering them without evidence.  The ab-initio AED already works similar to AED, with 0 being perfect concordance and 1 being complete discordance.

--Carson



From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Date: Friday, 1 June, 2012 2:41 PM
To: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

While I could add an option to keep them if there are more than one, the actual implementation is not as trivial as it seems.  On some organisms like fungi and oomycetes, the predictions that don't overlap evidence tend to be similar to each other across predictors, but on other eukaryotes with difficult and complex intron/exon structure like lamprey or even planaria about the only time two predictors will produce similar results coorelated with when there is evidence supporting them, and all the unsupported regions are messy with weird partial overlaps (sometimes even conflicting reading frames).  I have a figure in the MAKER2 paper showing how poorly these algorithms perform on such organisms and how additional evidence based feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant non-overlapping proteins recorded at the end of a MAKER run uses a complex variant of the AED calculation across the alternate predictions to build a consensus.  So in short it's not exactly as simple as just saying there are two predictions at a given locus.  It would require some thought (as well as good documentation), but it could probably be done.

--Carson

From: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Date: Friday, 1 June, 2012 2:22 PM
To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

It's not an option in exactly the way you are specifying, but there is
something I usually do for annotation that works well.  I run interproscan
or rpsblast on the non_overlapping.proteins.fasta file and select just
those non-overlapping models that have a recognizable protein domain (just
searching the pfam doamin space is more than sufficient).  Then I provide
the selected results to model_gff, and provide the previous maker results
to the maker_gff option with (all reannotation pass options set to 1 and
all analysis options turned off).  This adds models with at least
recognizable domains (as even multiple gene predictors can overpredict in
a similar way).

Attached is a script to help select predictions and upgrade them to models
in GFF3 format.  If you have question let me know.

Thanks,
Carson



On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>> wrote:

Hi Carson,
Thanks for all the help during the long weekend, in spite of that long
drive. I am still trying to imagine that.

I now have maker to consider our own prediction via pred_gff, and use
augustus and gene mark (with our training model). And i was able to use
altest and protein evidences. Maker happily picks one gene model when
there is a overlap between three different predictions. But, when I look
at the gff, it seems like it picks a gene model only when there is an
est/protein evidence. It leaves out some genes even though, they are
predicted by all three algorithms. Of course, keep_pred=1 helps to keep
all the models. This kind of leads to over prediction.

But, I am looking for something in between. And would like to know if
that is possible?
1) Pick a gene model if it has an evidence from (est/prot etc...)
irrespective of how many algorithms predicted it
2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
if that is predicted by at least two algorithms.

Or even simpler:
I have ab-initio predictions from three algorithms, Can I output, those
genes that is supported by at least two of them. I care less about
exactness of gene boundaries.

Thanks,
Gowthaman

PS: With my recent attempts, i learned couple things about maker/other
associated tools that is not documented in gmod-maker wiki. Is it
possible/ok if I add contents to it. I am okay with running it by you
before making it public.

<gff3_preds2models>_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543







From carsonhh at gmail.com  Fri Jun  1 13:23:59 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 15:23:59 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>
Message-ID: <CBEE8C00.D465%carsonhh@gmail.com>

The metric AED is Annotation Edit Distance (original paper -->
http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
the sensitivity/specificity measure used to quantify the performance of
gene predictors and can be used to measure changes in gene models across
releases, and I further adapted use it for some slightly different purpose
than given in the original paper above.

This is copied from the MAKER2 paper -->
"Given a gene prediction i and a reference j, the base pair level
sensitivity can be calculated using the formula SN = |i?j|/|j|; where
|i?j| represents the number overlapping nucleotides between i and j, and
|j| represents the total number of nucleotides in the reference j.
Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
and accuracy is the average of the two.  Because we are not comparing to a
high quality reference (reference is arbitrary for AED), it is more
correct to refer to the average of sensitivity and specificity as the
congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
distance between i and j, then becomes D = 1-C, with a value of 0
indicating complete agreement of an annotation to the evidence, and values
at or near 1 indicating disagreement or no evidence support."



The ab-initio AED in comparison is the pairwise AED calculated between
each overlapping prediction and then averaged.  Each pair then have a
score representing it's average distance from the overlapping set of
predictions as a whole.  So a value of .1 would be 10% average
incongruency or 90% average congruency.

Thanks,
Carson



On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>That sounds really good.
>
>Just wondering what would that float point mean?
>
>fraction of gene prediction algorithms predicted that region to contain a
>gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>predicted it?? 
>Or 
>it just indicates lever of concordance (in maker language) and user has
>to try different values before settling on one?
>
>Thanks,
>gowthaman
>________________________________________
>From: Carson Holt [carsonhh at gmail.com]
>Sent: Friday, June 01, 2012 11:52 AM
>To: Barry Moore
>Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>One idea related to this.  I could have keep_preds be a floating point
>value between 0 and 1.  This would then represent a threshold for an
>internal MAKER value called the ab-initio AED (it already exists
>internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>1 would keep everything (as it does now), and values in between would
>allow the user to dial in the degree of consensus among overlapping
>predictions when considering them without evidence.  The ab-initio AED
>already works similar to AED, with 0 being perfect concordance and 1
>being complete discordance.
>
>--Carson
>
>
>
>From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Date: Friday, 1 June, 2012 2:41 PM
>To: Barry Moore 
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>, 
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>While I could add an option to keep them if there are more than one, the
>actual implementation is not as trivial as it seems.  On some organisms
>like fungi and oomycetes, the predictions that don't overlap evidence
>tend to be similar to each other across predictors, but on other
>eukaryotes with difficult and complex intron/exon structure like lamprey
>or even planaria about the only time two predictors will produce similar
>results coorelated with when there is evidence supporting them, and all
>the unsupported regions are messy with weird partial overlaps (sometimes
>even conflicting reading frames).  I have a figure in the MAKER2 paper
>showing how poorly these algorithms perform on such organisms and how
>additional evidence based feedback provided by MAKER produces
>dramatically improved results.
>
>The way I get around the issues when choosing the non-redundant
>non-overlapping proteins recorded at the end of a MAKER run uses a
>complex variant of the AED calculation across the alternate predictions
>to build a consensus.  So in short it's not exactly as simple as just
>saying there are two predictions at a given locus.  It would require some
>thought (as well as good documentation), but it could probably be done.
>
>--Carson
>
>From: Barry Moore 
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Date: Friday, 1 June, 2012 2:22 PM
>To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>, 
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>Carson,
>
>How hard would it be to have maker take an option something like
>'require_abinits=2' that would instruct maker to promote predictions that
>overlap with (2, 3 or more) other predictions?  Seems like the maker
>might have all that info in one place at some point already?
>
>Gowthaman, your contributions to the maker tutorial would be most
>welcome.  I've got an offline copy of a newer tutorial wiki that is more
>up to date than the GMOD version.  It's on a server right now that we've
>got locked behind a firewall, but I'm hoping to move that to a public
>facing server in the next week and I'd be happy to give you an account on
>the wiki.
>
>B
>
>On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>
>It's not an option in exactly the way you are specifying, but there is
>something I usually do for annotation that works well.  I run interproscan
>or rpsblast on the non_overlapping.proteins.fasta file and select just
>those non-overlapping models that have a recognizable protein domain (just
>searching the pfam doamin space is more than sufficient).  Then I provide
>the selected results to model_gff, and provide the previous maker results
>to the maker_gff option with (all reannotation pass options set to 1 and
>all analysis options turned off).  This adds models with at least
>recognizable domains (as even multiple gene predictors can overpredict in
>a similar way).
>
>Attached is a script to help select predictions and upgrade them to models
>in GFF3 format.  If you have question let me know.
>
>Thanks,
>Carson
>
>
>
>On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>> wrote:
>
>Hi Carson,
>Thanks for all the help during the long weekend, in spite of that long
>drive. I am still trying to imagine that.
>
>I now have maker to consider our own prediction via pred_gff, and use
>augustus and gene mark (with our training model). And i was able to use
>altest and protein evidences. Maker happily picks one gene model when
>there is a overlap between three different predictions. But, when I look
>at the gff, it seems like it picks a gene model only when there is an
>est/protein evidence. It leaves out some genes even though, they are
>predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>all the models. This kind of leads to over prediction.
>
>But, I am looking for something in between. And would like to know if
>that is possible?
>1) Pick a gene model if it has an evidence from (est/prot etc...)
>irrespective of how many algorithms predicted it
>2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>if that is predicted by at least two algorithms.
>
>Or even simpler:
>I have ab-initio predictions from three algorithms, Can I output, those
>genes that is supported by at least two of them. I care less about
>exactness of gene boundaries.
>
>Thanks,
>Gowthaman
>
>PS: With my recent attempts, i learned couple things about maker/other
>associated tools that is not documented in gmod-maker wiki. Is it
>possible/ok if I add contents to it. I am okay with running it by you
>before making it public.
>
><gff3_preds2models>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>Barry Moore
>Research Scientist
>Dept. of Human Genetics
>University of Utah
>Salt Lake City, UT 84112
>--------------------------------------------
>(801) 585-3543
>
>
>
>





From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 13:28:21 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:28:21 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8C00.D465%carsonhh@gmail.com>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>,
	<CBEE8C00.D465%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F906@mail02.sbri.org>

That sounds really neat. I will read those papers. Thanks for sharing.

Gowthaman
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 12:23 PM
To: Gowthaman Ramasamy; Barry Moore
Cc: maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

The metric AED is Annotation Edit Distance (original paper -->
http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
the sensitivity/specificity measure used to quantify the performance of
gene predictors and can be used to measure changes in gene models across
releases, and I further adapted use it for some slightly different purpose
than given in the original paper above.

This is copied from the MAKER2 paper -->
"Given a gene prediction i and a reference j, the base pair level
sensitivity can be calculated using the formula SN = |i?j|/|j|; where
|i?j| represents the number overlapping nucleotides between i and j, and
|j| represents the total number of nucleotides in the reference j.
Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
and accuracy is the average of the two.  Because we are not comparing to a
high quality reference (reference is arbitrary for AED), it is more
correct to refer to the average of sensitivity and specificity as the
congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
distance between i and j, then becomes D = 1-C, with a value of 0
indicating complete agreement of an annotation to the evidence, and values
at or near 1 indicating disagreement or no evidence support."



The ab-initio AED in comparison is the pairwise AED calculated between
each overlapping prediction and then averaged.  Each pair then have a
score representing it's average distance from the overlapping set of
predictions as a whole.  So a value of .1 would be 10% average
incongruency or 90% average congruency.

Thanks,
Carson



On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>That sounds really good.
>
>Just wondering what would that float point mean?
>
>fraction of gene prediction algorithms predicted that region to contain a
>gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>predicted it??
>Or
>it just indicates lever of concordance (in maker language) and user has
>to try different values before settling on one?
>
>Thanks,
>gowthaman
>________________________________________
>From: Carson Holt [carsonhh at gmail.com]
>Sent: Friday, June 01, 2012 11:52 AM
>To: Barry Moore
>Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>One idea related to this.  I could have keep_preds be a floating point
>value between 0 and 1.  This would then represent a threshold for an
>internal MAKER value called the ab-initio AED (it already exists
>internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>1 would keep everything (as it does now), and values in between would
>allow the user to dial in the degree of consensus among overlapping
>predictions when considering them without evidence.  The ab-initio AED
>already works similar to AED, with 0 being perfect concordance and 1
>being complete discordance.
>
>--Carson
>
>
>
>From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Date: Friday, 1 June, 2012 2:41 PM
>To: Barry Moore
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>,
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>While I could add an option to keep them if there are more than one, the
>actual implementation is not as trivial as it seems.  On some organisms
>like fungi and oomycetes, the predictions that don't overlap evidence
>tend to be similar to each other across predictors, but on other
>eukaryotes with difficult and complex intron/exon structure like lamprey
>or even planaria about the only time two predictors will produce similar
>results coorelated with when there is evidence supporting them, and all
>the unsupported regions are messy with weird partial overlaps (sometimes
>even conflicting reading frames).  I have a figure in the MAKER2 paper
>showing how poorly these algorithms perform on such organisms and how
>additional evidence based feedback provided by MAKER produces
>dramatically improved results.
>
>The way I get around the issues when choosing the non-redundant
>non-overlapping proteins recorded at the end of a MAKER run uses a
>complex variant of the AED calculation across the alternate predictions
>to build a consensus.  So in short it's not exactly as simple as just
>saying there are two predictions at a given locus.  It would require some
>thought (as well as good documentation), but it could probably be done.
>
>--Carson
>
>From: Barry Moore
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Date: Friday, 1 June, 2012 2:22 PM
>To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>,
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>Carson,
>
>How hard would it be to have maker take an option something like
>'require_abinits=2' that would instruct maker to promote predictions that
>overlap with (2, 3 or more) other predictions?  Seems like the maker
>might have all that info in one place at some point already?
>
>Gowthaman, your contributions to the maker tutorial would be most
>welcome.  I've got an offline copy of a newer tutorial wiki that is more
>up to date than the GMOD version.  It's on a server right now that we've
>got locked behind a firewall, but I'm hoping to move that to a public
>facing server in the next week and I'd be happy to give you an account on
>the wiki.
>
>B
>
>On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>
>It's not an option in exactly the way you are specifying, but there is
>something I usually do for annotation that works well.  I run interproscan
>or rpsblast on the non_overlapping.proteins.fasta file and select just
>those non-overlapping models that have a recognizable protein domain (just
>searching the pfam doamin space is more than sufficient).  Then I provide
>the selected results to model_gff, and provide the previous maker results
>to the maker_gff option with (all reannotation pass options set to 1 and
>all analysis options turned off).  This adds models with at least
>recognizable domains (as even multiple gene predictors can overpredict in
>a similar way).
>
>Attached is a script to help select predictions and upgrade them to models
>in GFF3 format.  If you have question let me know.
>
>Thanks,
>Carson
>
>
>
>On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>> wrote:
>
>Hi Carson,
>Thanks for all the help during the long weekend, in spite of that long
>drive. I am still trying to imagine that.
>
>I now have maker to consider our own prediction via pred_gff, and use
>augustus and gene mark (with our training model). And i was able to use
>altest and protein evidences. Maker happily picks one gene model when
>there is a overlap between three different predictions. But, when I look
>at the gff, it seems like it picks a gene model only when there is an
>est/protein evidence. It leaves out some genes even though, they are
>predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>all the models. This kind of leads to over prediction.
>
>But, I am looking for something in between. And would like to know if
>that is possible?
>1) Pick a gene model if it has an evidence from (est/prot etc...)
>irrespective of how many algorithms predicted it
>2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>if that is predicted by at least two algorithms.
>
>Or even simpler:
>I have ab-initio predictions from three algorithms, Can I output, those
>genes that is supported by at least two of them. I care less about
>exactness of gene boundaries.
>
>Thanks,
>Gowthaman
>
>PS: With my recent attempts, i learned couple things about maker/other
>associated tools that is not documented in gmod-maker wiki. Is it
>possible/ok if I add contents to it. I am okay with running it by you
>before making it public.
>
><gff3_preds2models>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>Barry Moore
>Research Scientist
>Dept. of Human Genetics
>University of Utah
>Salt Lake City, UT 84112
>--------------------------------------------
>(801) 585-3543
>
>
>
>





From barry.moore at genetics.utah.edu  Fri Jun  1 14:39:25 2012
From: barry.moore at genetics.utah.edu (Barry Moore)
Date: Fri, 1 Jun 2012 14:39:25 -0600
Subject: [maker-devel] Can maker select a gene model based on
	#algoritham predicted it
In-Reply-To: <CBEE8C00.D465%carsonhh@gmail.com>
References: <CBEE8C00.D465%carsonhh@gmail.com>
Message-ID: <B876750E-47CD-4DEC-81F1-5E5EC5F6B754@genetics.utah.edu>

I like this a lot Carson - for two reasons:  First, it sounds like it's fairly easy to implement with that data and code that already exists within MAKER! And second it sounds like the right way to be doing this - the more the abintis agree the more likely to they are to be correct.

B

On Jun 1, 2012, at 1:23 PM, Carson Holt wrote:

> The metric AED is Annotation Edit Distance (original paper -->
> http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
> the sensitivity/specificity measure used to quantify the performance of
> gene predictors and can be used to measure changes in gene models across
> releases, and I further adapted use it for some slightly different purpose
> than given in the original paper above.
> 
> This is copied from the MAKER2 paper -->
> "Given a gene prediction i and a reference j, the base pair level
> sensitivity can be calculated using the formula SN = |i?j|/|j|; where
> |i?j| represents the number overlapping nucleotides between i and j, and
> |j| represents the total number of nucleotides in the reference j.
> Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
> and accuracy is the average of the two.  Because we are not comparing to a
> high quality reference (reference is arbitrary for AED), it is more
> correct to refer to the average of sensitivity and specificity as the
> congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
> distance between i and j, then becomes D = 1-C, with a value of 0
> indicating complete agreement of an annotation to the evidence, and values
> at or near 1 indicating disagreement or no evidence support."
> 
> 
> 
> The ab-initio AED in comparison is the pairwise AED calculated between
> each overlapping prediction and then averaged.  Each pair then have a
> score representing it's average distance from the overlapping set of
> predictions as a whole.  So a value of .1 would be 10% average
> incongruency or 90% average congruency.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> That sounds really good.
>> 
>> Just wondering what would that float point mean?
>> 
>> fraction of gene prediction algorithms predicted that region to contain a
>> gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>> predicted it?? 
>> Or 
>> it just indicates lever of concordance (in maker language) and user has
>> to try different values before settling on one?
>> 
>> Thanks,
>> gowthaman
>> ________________________________________
>> From: Carson Holt [carsonhh at gmail.com]
>> Sent: Friday, June 01, 2012 11:52 AM
>> To: Barry Moore
>> Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> One idea related to this.  I could have keep_preds be a floating point
>> value between 0 and 1.  This would then represent a threshold for an
>> internal MAKER value called the ab-initio AED (it already exists
>> internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>> 1 would keep everything (as it does now), and values in between would
>> allow the user to dial in the degree of consensus among overlapping
>> predictions when considering them without evidence.  The ab-initio AED
>> already works similar to AED, with 0 being perfect concordance and 1
>> being complete discordance.
>> 
>> --Carson
>> 
>> 
>> 
>> From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>> Date: Friday, 1 June, 2012 2:41 PM
>> To: Barry Moore 
>> <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>> Cc: Gowthaman Ramasamy
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>>, 
>> "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
>> <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> While I could add an option to keep them if there are more than one, the
>> actual implementation is not as trivial as it seems.  On some organisms
>> like fungi and oomycetes, the predictions that don't overlap evidence
>> tend to be similar to each other across predictors, but on other
>> eukaryotes with difficult and complex intron/exon structure like lamprey
>> or even planaria about the only time two predictors will produce similar
>> results coorelated with when there is evidence supporting them, and all
>> the unsupported regions are messy with weird partial overlaps (sometimes
>> even conflicting reading frames).  I have a figure in the MAKER2 paper
>> showing how poorly these algorithms perform on such organisms and how
>> additional evidence based feedback provided by MAKER produces
>> dramatically improved results.
>> 
>> The way I get around the issues when choosing the non-redundant
>> non-overlapping proteins recorded at the end of a MAKER run uses a
>> complex variant of the AED calculation across the alternate predictions
>> to build a consensus.  So in short it's not exactly as simple as just
>> saying there are two predictions at a given locus.  It would require some
>> thought (as well as good documentation), but it could probably be done.
>> 
>> --Carson
>> 
>> From: Barry Moore 
>> <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>> Date: Friday, 1 June, 2012 2:22 PM
>> To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>> Cc: Gowthaman Ramasamy
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>>, 
>> "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
>> <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> Carson,
>> 
>> How hard would it be to have maker take an option something like
>> 'require_abinits=2' that would instruct maker to promote predictions that
>> overlap with (2, 3 or more) other predictions?  Seems like the maker
>> might have all that info in one place at some point already?
>> 
>> Gowthaman, your contributions to the maker tutorial would be most
>> welcome.  I've got an offline copy of a newer tutorial wiki that is more
>> up to date than the GMOD version.  It's on a server right now that we've
>> got locked behind a firewall, but I'm hoping to move that to a public
>> facing server in the next week and I'd be happy to give you an account on
>> the wiki.
>> 
>> B
>> 
>> On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>> 
>> It's not an option in exactly the way you are specifying, but there is
>> something I usually do for annotation that works well.  I run interproscan
>> or rpsblast on the non_overlapping.proteins.fasta file and select just
>> those non-overlapping models that have a recognizable protein domain (just
>> searching the pfam doamin space is more than sufficient).  Then I provide
>> the selected results to model_gff, and provide the previous maker results
>> to the maker_gff option with (all reannotation pass options set to 1 and
>> all analysis options turned off).  This adds models with at least
>> recognizable domains (as even multiple gene predictors can overpredict in
>> a similar way).
>> 
>> Attached is a script to help select predictions and upgrade them to models
>> in GFF3 format.  If you have question let me know.
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>> wrote:
>> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
>> 
>> <gff3_preds2models>_______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> Barry Moore
>> Research Scientist
>> Dept. of Human Genetics
>> University of Utah
>> Salt Lake City, UT 84112
>> --------------------------------------------
>> (801) 585-3543
>> 
>> 
>> 
>> 
> 
> 

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543




-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/c444140d/attachment-0002.html>

From weckalba at asu.edu  Mon Jun  4 11:41:14 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Mon, 4 Jun 2012 10:41:14 -0700
Subject: [maker-devel] question regarding alternate splicing annotation
Message-ID: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>

Hi Maker developers,

I am trying to expand on some current annotations that are already quite
good, but only predict protein coding sequence and one isoform per gene, to
add UTRs and alternative splice forms from cufflinks data.  To do this I
put the current annotations in both the model_gff and pred_gff field, plus
the cufflinks gff3 for the ests (as I noticed was suggested in a previous
email).  I've left everything else as default, except changing
alt_splice=1. I am watching the progress of the *.gff.ann files, but I'm
not noticing alternate splicing being added, while UTRs are being picked up
(exons being added, etc.).  This is a vertebrate genome, so run times are
fairly long and I just wanted to double check if I wasn't missing
something.  Will maker go back through a second step to annotate
alternative splicing?  Or should I be trying something a little different.

Thanks,

Walter
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120604/80ac7225/attachment-0002.html>

From carsonhh at gmail.com  Mon Jun  4 12:02:19 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Mon, 04 Jun 2012 14:02:19 -0400
Subject: [maker-devel] question regarding alternate splicing annotation
In-Reply-To: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>
Message-ID: <CBF26EB9.D534%carsonhh@gmail.com>

Using GFF3 pass-through options alone won't allow for the alternate splice
prediction to work.  You have to also allow gene predictors like SNAP and
Augustus to run.  MAKER uses mutually exclusive EST data to produce separate
hint files in some cases that can produce alternate splice forms from the ab
initio predictors.  The EST evidence must be very long in general or they
will not produce alternate forms.  These alternate splice model can then
compete against your existing gene models based on scoring statistics MAKER
produces and potentially replace them.  This may not be what you want
though.  The alternate splice prediction works better De Novo than for
re-annotation.

The alternate splicing option still needs more work, but I would appreciate
any feedback.

Thanks,
Carson




From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Monday, 4 June, 2012 1:41 PM
To:  <maker-devel at yandell-lab.org>
Subject:  [maker-devel] question regarding alternate splicing annotation

Hi Maker developers,

I am trying to expand on some current annotations that are already quite
good, but only predict protein coding sequence and one isoform per gene, to
add UTRs and alternative splice forms from cufflinks data.  To do this I put
the current annotations in both the model_gff andusing the gff_field, plus
the cufflinks gff3 for the ests (as I noticed was suggested in a previous
email).  I've left everything else as default, except changing alt_splice=1.
I am watching the progress of the *.gff.ann files, but I'm not noticing
alternate splicing being added, while UTRs are being picked up (exons being
added, etc.).  This is a vertebrate genome, so run times are fairly long and
I just wanted to double check if I wasn't missing something.  Will maker go
back through a second step to annotate alternative splicing?  Or should I be
trying something a little different.

Thanks,

Walter
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120604/01844803/attachment-0002.html>

From weckalba at asu.edu  Mon Jun  4 12:23:18 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Mon, 4 Jun 2012 11:23:18 -0700
Subject: [maker-devel] question regarding alternate splicing annotation
In-Reply-To: <CBF26EB9.D534%carsonhh@gmail.com>
References: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>
	<CBF26EB9.D534%carsonhh@gmail.com>
Message-ID: <CANRPJSfXK1Py7297bTg3_nQXuUkce4c0WueSM_iYA0MLvXP_OQ@mail.gmail.com>

Hi Carson,

Thanks for the quick reply.  I have already trained SNAP and Augustus based
on the de novo assembly from the same RNA-seq data used to generate the
cufflinks annotations.  Those SNAP and Augustus predictions were part of my
initial annotation, along with the de novo assembled transcripts, previous
reference annotations, and related species protein alignments.  I had
broken this up because of run time issues, and thought it might speed
things along.  I will switch gears to add in the SNAP and Augustus ab
initio predictions.

As you might infer, I have a great deal of formats this transcript data
could come in (ie outputs from cufflinks for each sample, cuffmerge,
tophat, trinity, or raw).  Do you have any suggestions for what might be a
good balance between speed and completeness?  I also can not for life of me
get Maker install on our cluster, but I do have Augustus and SNAP installed
there.  I have a massive amount of RNA-seq data I'm trying to incorporate,
so I'm confident plenty of alternative splicing could be found, but I'm
hitting time issues due to the scale (ie four day wall limit on the cluster
and only having an 8-core in house).

I've tried other programs to do this, but obviously cufflinks gives you way
too much, and I'm finding EVM, while fast, is too happy to shorten gene
models based on partial transcript evidence, which requires way more manual
correction than we are capable of doing.

I'll start with just letting Maker run SNAP and Augustus, and let you know
how it goes.

Walter


On 4 June 2012 11:02, Carson Holt <carsonhh at gmail.com> wrote:

> Using GFF3 pass-through options alone won't allow for the alternate splice
> prediction to work.  You have to also allow gene predictors like SNAP and
> Augustus to run.  MAKER uses mutually exclusive EST data to produce
> separate hint files in some cases that can produce alternate splice forms
> from the ab initio predictors.  The EST evidence must be very long in
> general or they will not produce alternate forms.  These alternate splice
> model can then compete against your existing gene models based on scoring
> statistics MAKER produces and potentially replace them.  This may not be
> what you want though.  The alternate splice prediction works better De Novo
> than for re-annotation.
>
> The alternate splicing option still needs more work, but I would
> appreciate any feedback.
>
> Thanks,
> Carson
>
>
>
>
> From: Walter Eckalbar <weckalba at asu.edu>
> Date: Monday, 4 June, 2012 1:41 PM
> To: <maker-devel at yandell-lab.org>
> Subject: [maker-devel] question regarding alternate splicing annotation
>
> Hi Maker developers,
>
> I am trying to expand on some current annotations that are already quite
> good, but only predict protein coding sequence and one isoform per gene, to
> add UTRs and alternative splice forms from cufflinks data.  To do this I
> put the current annotations in both the model_gff andusing the gff_field,
> plus the cufflinks gff3 for the ests (as I noticed was suggested in a
> previous email).  I've left everything else as default, except changing
> alt_splice=1. I am watching the progress of the *.gff.ann files, but I'm
> not noticing alternate splicing being added, while UTRs are being picked up
> (exons being added, etc.).  This is a vertebrate genome, so run times are
> fairly long and I just wanted to double check if I wasn't missing
> something.  Will maker go back through a second step to annotate
> alternative splicing?  Or should I be trying something a little different.
>
> Thanks,
>
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120604/7e44220c/attachment-0002.html>

From jrliberto at yahoo.com  Wed Jun  6 12:22:46 2012
From: jrliberto at yahoo.com (Jennifer Liberto)
Date: Wed, 6 Jun 2012 11:22:46 -0700 (PDT)
Subject: [maker-devel] MAKER output concerns
Message-ID: <1339006966.41760.YahooMailNeo@web110112.mail.gq1.yahoo.com>

To whom this may concern,
?
I am brand new to MAKER and I am concerned about the output
files that I am receiving.? My
partner and I were able to run the dpp test with no errors, all the files and
directories were accounted for.? However, when we tried to run it on our own small dataset of 5 genes,
and a surfperch genome, we were missing 2 files in the output of every contig:
?
Snig2_XXXXXXX.maker.proteins.fasta
Snig2_XXXXXXX.maker.transcripts.fasta
?
When I look at the run log for each of the contigs, I see that
blastx, blastn, tblastx, augustus, snap, and repeatrunner were called but not
exonerate; I have attached a sample run log with this post. Also, our gff files
contain only short 52 bp repeat sequences (I have attached one of these here as
well in a .txt format) and looks nothing like the gff file we received in out
dpp test.? If you could give any
pointers or hints as to why we are not receiving the two files, why exonerate
is not being called, and why our gff files contain only uniformly small repeat
sequences, the help would be greatly appreciated.? 
?
Thank you for your time,
Jennifer Liberto
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/3394c6ed/attachment-0002.html>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: run.log
Type: application/octet-stream
Size: 5078 bytes
Desc: not available
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/3394c6ed/attachment-0002.obj>
-------------- next part --------------
##gff-version 3
Snig2_1983881	.	contig	1	52	.	.	.	ID=Snig2_1983881;Name=Snig2_1983881;
Snig2_1983881	repeatmasker	match	8	52	405	+	.	ID=Snig2_1983881:hit:14530;Name=species:%28CA%29n%20genus:Simple_repeat;Target=species:%28CA%29n%20genus:Simple_repeat 1 45 +;
Snig2_1983881	repeatmasker	match_part	8	52	405	+	.	ID=Snig2_1983881:hsp:14530;Parent=Snig2_1983881:hit:14530;Name=species:%2528CA%2529n%2520genus:Simple_repeat;Target=species:%2528CA%2529n%2520genus:Simple_repeat 1 45 +;
Snig2_1983881	repeatmasker	match	8	52	405	+	.	ID=Snig2_1983881:hit:14531;Name=species:%28CA%29n%20genus:Simple_repeat;Target=species:%28CA%29n%20genus:Simple_repeat 1 45 +;
Snig2_1983881	repeatmasker	match_part	8	52	405	+	.	ID=Snig2_1983881:hsp:14531;Parent=Snig2_1983881:hit:14531;Name=species:%2528CA%2529n%2520genus:Simple_repeat;Target=species:%2528CA%2529n%2520genus:Simple_repeat 1 45 +;
##FASTA
>Snig2_1983881
TTGGCGCCACACACACACACACACACACACACACACACACACACACACACAC

From carsonhh at gmail.com  Wed Jun  6 12:39:42 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 06 Jun 2012 14:39:42 -0400
Subject: [maker-devel] MAKER output concerns
In-Reply-To: <1339006966.41760.YahooMailNeo@web110112.mail.gq1.yahoo.com>
Message-ID: <CBF51A5C.D620%carsonhh@gmail.com>

Hi Jennifer,

The contig you ran with was only 52 bp in length and contained only
repetitive sequence.  Exonerate only runs if there are BLAST results that
need polishing, which there weren't.
The Snig2_XXXXXXX.maker.proteins.fasta and
Snig2_XXXXXXX.maker.transcripts.fasta were not produced because there were
no proteins or transcripts to report.

In general running on sequence shorter than 10,000 bp isn't useful.  This is
because programs like SNAP and Augustus need sequence flanking the actual
gene to make their calls, and with intron/exon structure you are unlikely to
fully capture a gene (end to end) at random in under 10kb for many
eukaryotic organisms.

If you are trying to use raw reads, you will need to assemble them first
before running MAKER.  Let us know specifically what you are trying to do,
and we can give you pointers on how to proceed.

Thanks,
Carson



From:  Jennifer Liberto <jrliberto at yahoo.com>
Reply-To:  Jennifer Liberto <jrliberto at yahoo.com>
Date:  Wednesday, 6 June, 2012 2:22 PM
To:  "maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  [maker-devel] MAKER output concerns

To whom this may concern,
 
I am brand new to MAKER and I am concerned about the output files that I am
receiving.  My partner and I were able to run the dpp test with no errors,
all the files and directories were accounted for. However, when we tried to
run it on our own small dataset of 5 genes, and a surfperch genome, we were
missing 2 files in the output of every contig:
 
Snig2_XXXXXXX.maker.proteins.fasta
Snig2_XXXXXXX.maker.transcripts.fasta
 
When I look at the run log for each of the contigs, I see that blastx,
blastn, tblastx, augustus, snap, and repeatrunner were called but not
exonerate; I have attached a sample run log with this post. Also, our gff
files contain only short 52 bp repeat sequences (I have attached one of
these here as well in a .txt format) and looks nothing like the gff file we
received in out dpp test.  If you could give any pointers or hints as to why
we are not receiving the two files, why exonerate is not being called, and
why our gff files contain only uniformly small repeat sequences, the help
would be greatly appreciated.
 
Thank you for your time,
Jennifer Liberto
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/237aa6e6/attachment-0002.html>

From gowthaman.ramasamy at seattlebiomed.org  Thu Jun  7 07:36:38 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Thu, 7 Jun 2012 06:36:38 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <CBF61973.D683%carson.holt@oicr.on.ca>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>,
	<CBF61973.D683%carson.holt@oicr.on.ca>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F928@mail02.sbri.org>

Thats a very nice catch. I will adjust parent to Parent and try. 

Its nice idea to run maker first with prok. mode. I will keep that in mind.

Thanks,
Gowtham

_____________________________
From: Carson Holt [Carson.Holt at oicr.on.ca]
Sent: Thursday, June 07, 2012 6:28 AM
To: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: GFF3 file format not accepted by pred_gff options

You have parent= instead of Parent=.  In GFF3, attribute tags are case
sensitive.  Those starting with uppercase letters represent reserved
words, and all others represent ad hoc tags.
The modencode validator would not check parent= for validity because it
sees it as an ad hoc tag (thus not producing an error).

Try changing parent= to some invalid value and compare with what you get
when Parent= is set to an invalid value in the modencode validator, and
you will see what I mean.


The fixed version is attached.


Also the genemark_gtf2gff script was made for converting the GeneMark-ES
output, so I'm not surprised it didn't work on the prokaryote version, but
you should
be fine just by fixing the parent= tag on the conversion you made.  You
could also have run MAKER once in prokaryote mode with the prokaryotic
parameter file to get it to produce a GFF3 for you.

Thanks,
Carson




On 12-06-06 9:53 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Carson,
>As I wrote to you earlier, I was able to successfully create a gff3 file
>from our predictor to be used in pred_gff option. But, now, I am trying
>to add another abinitio prediction (GeneMark-prokaryotic).  For some
>weird reasons,  I would like to run GeneMark-prokaryote and
>Augustus-eukaryotes. So, i am not able to run both inside maker.
>
>But, that gff3 was not used by pred_gff. I tried to make it as similar to
>the working gffs as possible. Still in vein. Would you mind having look
>at the attached gff file. I even run it by gff validator at
>modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All
>passed.
>
>In the maker produced gff i just see one pair of match-matchpart that
>corresponds to entire supercontig from GeneMark. Not corresponding to
>genes.
>
>I really appreciate your time and help.
>
>Gowthaman




From gowthaman.ramasamy at seattlebiomed.org  Wed Jun  6 19:53:20 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Wed, 6 Jun 2012 18:53:20 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>

Hi Carson,
As I wrote to you earlier, I was able to successfully create a gff3 file from our predictor to be used in pred_gff option. But, now, I am trying to add another abinitio prediction (GeneMark-prokaryotic).  For some weird reasons,  I would like to run GeneMark-prokaryote and Augustus-eukaryotes. So, i am not able to run both inside maker.

But, that gff3 was not used by pred_gff. I tried to make it as similar to the working gffs as possible. Still in vein. Would you mind having look at the attached gff file. I even run it by gff validator at modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All passed.

In the maker produced gff i just see one pair of match-matchpart that corresponds to entire supercontig from GeneMark. Not corresponding to genes.

I really appreciate your time and help. 

Gowthaman

-------------- next part --------------
A non-text attachment was scrubbed...
Name: Contig23.GMprok.gff
Type: application/octet-stream
Size: 291755 bytes
Desc: Contig23.GMprok.gff
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/2c5bf543/attachment-0002.obj>

From gowthaman.ramasamy at seattlebiomed.org  Wed Jun  6 19:59:33 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Wed, 6 Jun 2012 18:59:33 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F927@mail02.sbri.org>

Carson,
I also tried to use maker's genemart_gtf2gff script to create valid gff3 file. I seem to have problems with it too.
Here is what I see...

-bash-3.2$ ~/software/maker/bin/genemark_gtf2gff3 CrfA_v13.3.5_supercontigs.gff2
ERROR: Cannot understand format
expecting -> gene_id "xxxx"; transcript_id "xxxx";

Attached is first 10000 lines of the GTF output from genemark.

Any help/pointers will be really appreciated.

Thanks again,
Gowthaman
________________________________________
From: Gowthaman Ramasamy
Sent: Wednesday, June 06, 2012 6:53 PM
To: Carson Holt; maker-devel at yandell-lab.org
Subject: GFF3 file format not accepted by pred_gff options

Hi Carson,
As I wrote to you earlier, I was able to successfully create a gff3 file from our predictor to be used in pred_gff option. But, now, I am trying to add another abinitio prediction (GeneMark-prokaryotic).  For some weird reasons,  I would like to run GeneMark-prokaryote and Augustus-eukaryotes. So, i am not able to run both inside maker.

But, that gff3 was not used by pred_gff. I tried to make it as similar to the working gffs as possible. Still in vein. Would you mind having look at the attached gff file. I even run it by gff validator at modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All passed.

In the maker produced gff i just see one pair of match-matchpart that corresponds to entire supercontig from GeneMark. Not corresponding to genes.

I really appreciate your time and help.

Gowthaman
-------------- next part --------------
A non-text attachment was scrubbed...
Name: tiny_genemark-prok.gtf.bz2
Type: application/x-bzip2
Size: 209923 bytes
Desc: tiny_genemark-prok.gtf.bz2
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/ace7deee/attachment.bz2>

From Carson.Holt at oicr.on.ca  Thu Jun  7 07:28:06 2012
From: Carson.Holt at oicr.on.ca (Carson Holt)
Date: Thu, 7 Jun 2012 13:28:06 +0000
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
Message-ID: <CBF61973.D683%carson.holt@oicr.on.ca>

You have parent= instead of Parent=.  In GFF3, attribute tags are case
sensitive.  Those starting with uppercase letters represent reserved
words, and all others represent ad hoc tags.
The modencode validator would not check parent= for validity because it
sees it as an ad hoc tag (thus not producing an error).

Try changing parent= to some invalid value and compare with what you get
when Parent= is set to an invalid value in the modencode validator, and
you will see what I mean.


The fixed version is attached.


Also the genemark_gtf2gff script was made for converting the GeneMark-ES
output, so I'm not surprised it didn't work on the prokaryote version, but
you should 
be fine just by fixing the parent= tag on the conversion you made.  You
could also have run MAKER once in prokaryote mode with the prokaryotic
parameter file to get it to produce a GFF3 for you.

Thanks,
Carson




On 12-06-06 9:53 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Carson,
>As I wrote to you earlier, I was able to successfully create a gff3 file
>from our predictor to be used in pred_gff option. But, now, I am trying
>to add another abinitio prediction (GeneMark-prokaryotic).  For some
>weird reasons,  I would like to run GeneMark-prokaryote and
>Augustus-eukaryotes. So, i am not able to run both inside maker.
>
>But, that gff3 was not used by pred_gff. I tried to make it as similar to
>the working gffs as possible. Still in vein. Would you mind having look
>at the attached gff file. I even run it by gff validator at
>modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All
>passed.
>
>In the maker produced gff i just see one pair of match-matchpart that
>corresponds to entire supercontig from GeneMark. Not corresponding to
>genes.
>
>I really appreciate your time and help.
>
>Gowthaman

-------------- next part --------------
A non-text attachment was scrubbed...
Name: Contig23.GMprok.gff
Type: application/octet-stream
Size: 291755 bytes
Desc: Contig23.GMprok.gff
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120607/685ec79a/attachment-0002.obj>

From weckalba at asu.edu  Thu Jun  7 14:40:20 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Thu, 7 Jun 2012 13:40:20 -0700
Subject: [maker-devel] cluster error running maker
Message-ID: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>

Hi everyone,

I have been retrying installing maker on our university cluster, everything
seems to install correctly, but when I run maker I find the following error
message:

Ran into unknown state (hex char: 29) at
/home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
A data structure will be created for you at:
/scratch/weckalba/Maker/genome.maker.output/genome_datastore

To access files for individual sequences use the datastore index:
/scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log

DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.


Seems to have something to do with permissions and DBD::SQLite.  I
installed DBD::SQLite on my own home directories and routed the perl path
to it (and other CPAN installs in the same directories).

I was wondering if anyone ever encountered this before and knew a work
around.  The admins for our cluster are unfortunately very slow to respond.

Thanks

Walter
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120607/b3459baf/attachment-0002.html>

From carsonhh at gmail.com  Fri Jun  8 06:45:42 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 08 Jun 2012 08:45:42 -0400
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>
Message-ID: <CBF76A49.D740%carsonhh@gmail.com>

Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to Volker
Brendel at Iowa State for this one.

> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
> 646785-and-handle-Hex29.patch
> 
> This adds to previously posted 646785 patch.  At least on some systems,
> commands can contain "(" and ")".  See comments in the code.
> 

Download Proc-ProcessTable-0.45 to reinstall before applying the patch.


I'll also send you a link in a separate e-mail to download a maker 2.26 test
version where I've replaced Proc::ProcessTable with a different module
because of the failure on some systems.

Thanks,
Carson




From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Thursday, 7 June, 2012 4:40 PM
To:  <maker-devel at yandell-lab.org>
Subject:  [maker-devel] cluster error running maker

Hi everyone,

I have been retrying installing maker on our university cluster, everything
seems to install correctly, but when I run maker I find the following error
message:

Ran into unknown state (hex char: 29) at
/home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
A data structure will be created for you at:
/scratch/weckalba/Maker/genome.maker.output/genome_datastore

To access files for individual sequences use the datastore index:
/scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.lo
g

DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.


Seems to have something to do with permissions and DBD::SQLite.  I installed
DBD::SQLite on my own home directories and routed the perl path to it (and
other CPAN installs in the same directories).

I was wondering if anyone ever encountered this before and knew a work
around.  The admins for our cluster are unfortunately very slow to respond.

Thanks

Walter
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/87256d43/attachment-0002.html>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: 646785-and-handle-Hex29.patch
Type: application/octet-stream
Size: 4619 bytes
Desc: not available
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/87256d43/attachment-0002.obj>

From weckalba at asu.edu  Fri Jun  8 10:15:38 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Fri, 8 Jun 2012 09:15:38 -0700
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CBF76A49.D740%carsonhh@gmail.com>
References: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>
	<CBF76A49.D740%carsonhh@gmail.com>
Message-ID: <CANRPJScgVoFkm2-fO5Y7MUyFngSgMjN71fPJL3tfr5k-dPDDYA@mail.gmail.com>

Hi Carson,

I will try this as well to get my 2.25 version of maker running.

I have hit another error on my local machine.  This only seems to come up
with scaffolds > 5Mbp.  And am hitting this same error with version 2.10
and 2.25.

  [0] = Make
  [1] = 0
  [2] = additional
  [3] = prediction
  [4] = runs.
dead in Widget::augustus::parse_gene unknown feature type:additional
ERROR: Failed while preparing ab-inits
ERROR: Chunk failed at level:4, tier_type:0
FAILED CONTIG:GL343198.1

Do you have a suggestion for this one?

Thanks for all your help,

Walter


On 8 June 2012 05:45, Carson Holt <carsonhh at gmail.com> wrote:

> Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to
> Volker Brendel at Iowa State for this one.
>
> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
> 646785-and-handle-Hex29.patch
>
> This adds to previously posted 646785 patch.  At least on some
> systems, commands can contain "(" and ")".  See comments in the code.
>
>
> Download Proc-ProcessTable-0.45 to reinstall before applying the patch.
>
>
> I'll also send you a link in a separate e-mail to download a maker 2.26
> test version where I've replaced Proc::ProcessTable with a different module
> because of the failure on some systems.
>
> Thanks,
> Carson
>
>
>
>
> From: Walter Eckalbar <weckalba at asu.edu>
> Date: Thursday, 7 June, 2012 4:40 PM
> To: <maker-devel at yandell-lab.org>
> Subject: [maker-devel] cluster error running maker
>
> Hi everyone,
>
> I have been retrying installing maker on our university cluster,
> everything seems to install correctly, but when I run maker I find the
> following error message:
>
> Ran into unknown state (hex char: 29) at
> /home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
> A data structure will be created for you at:
> /scratch/weckalba/Maker/genome.maker.output/genome_datastore
>
> To access files for individual sequences use the datastore index:
>
> /scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log
>
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
> DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.
>
>
> Seems to have something to do with permissions and DBD::SQLite.  I
> installed DBD::SQLite on my own home directories and routed the perl path
> to it (and other CPAN installs in the same directories).
>
> I was wondering if anyone ever encountered this before and knew a work
> around.  The admins for our cluster are unfortunately very slow to respond.
>
> Thanks
>
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/f5a6a74f/attachment-0002.html>

From carsonhh at gmail.com  Fri Jun  8 10:28:36 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 08 Jun 2012 12:28:36 -0400
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CANRPJScgVoFkm2-fO5Y7MUyFngSgMjN71fPJL3tfr5k-dPDDYA@mail.gmail.com>
Message-ID: <CBF79DE3.D7AE%carsonhh@gmail.com>

That is one I haven't seen before (including on large multi-megabase contigs
).

Right before the error, it will say the location of the file that is being
read.  It will terminate in  ".augustus".  Could you send that file to me?
Augustus seems to be producing something weird in it's output.

Thanks,
Carson



From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Friday, 8 June, 2012 12:15 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] cluster error running maker

Hi Carson,

I will try this as well to get my 2.25 version of maker running.

I have hit another error on my local machine.  This only seems to come up
with scaffolds > 5Mbp.  And am hitting this same error with version 2.10 and
2.25.

  [0] = Make
  [1] = 0
  [2] = additional
  [3] = prediction
  [4] = runs.
dead in Widget::augustus::parse_gene unknown feature type:additional
ERROR: Failed while preparing ab-inits
ERROR: Chunk failed at level:4, tier_type:0
FAILED CONTIG:GL343198.1

Do you have a suggestion for this one?

Thanks for all your help,

Walter


On 8 June 2012 05:45, Carson Holt <carsonhh at gmail.com> wrote:
> Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to Volker
> Brendel at Iowa State for this one.
> 
>> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
>> 646785-and-handle-Hex29.patch
>> 
>> This adds to previously posted 646785 patch.  At least on some systems,
>> commands can contain "(" and ")".  See comments in the code.
>> 
> 
> Download Proc-ProcessTable-0.45 to reinstall before applying the patch.
> 
> 
> I'll also send you a link in a separate e-mail to download a maker 2.26 test
> version where I've replaced Proc::ProcessTable with a different module because
> of the failure on some systems.
> 
> Thanks,
> Carson
> 
> 
> 
> 
> From:  Walter Eckalbar <weckalba at asu.edu>
> Date:  Thursday, 7 June, 2012 4:40 PM
> To:  <maker-devel at yandell-lab.org>
> Subject:  [maker-devel] cluster error running maker
> 
> Hi everyone,
> 
> I have been retrying installing maker on our university cluster, everything
> seems to install correctly, but when I run maker I find the following error
> message:
> 
> Ran into unknown state (hex char: 29) at
> /home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
> A data structure will be created for you at:
> /scratch/weckalba/Maker/genome.maker.output/genome_datastore
> 
> To access files for individual sequences use the datastore index:
> /scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log
> 
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
> DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.
> 
> 
> Seems to have something to do with permissions and DBD::SQLite.  I installed
> DBD::SQLite on my own home directories and routed the perl path to it (and
> other CPAN installs in the same directories).
> 
> I was wondering if anyone ever encountered this before and knew a work around.
> The admins for our cluster are unfortunately very slow to respond.
> 
> Thanks
> 
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.comhttp://box290.bluehost.com/mailman/listinfo/mak
> er-devel_yandell-lab.org



-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/8b777a77/attachment-0002.html>

From daniel.standage at gmail.com  Thu Jun 14 12:26:18 2012
From: daniel.standage at gmail.com (Daniel Standage)
Date: Thu, 14 Jun 2012 13:26:18 -0500
Subject: [maker-devel] Quick question about re-annotation
Message-ID: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>

Greetings!

I have a quick question about re-annotation with Maker. I have successfully
completed a Maker run, but now I would like to re-run Maker with some
additional EST evidence (from a related organism, aligned and in GFF3
format). I simply added the file to the *altest_gff* configuration setting
and re-ran Maker. However, from  the log messages it looked like Maker was
starting from scratch rather than using what had already been completed in
the initial run. Luckily, I had made a backup of the complete Maker data
structure, so I killed the job, deleted the data structure, and restored
from the backup.

Before I try to run this again, do I need to change any other configuration
settings to do this re-annotation? The stanza under *Re-annotation Using
MAKER Derived GFF3* looks relevant, but it is not clear to me which
settings need to be set.

Thanks!

--
Daniel S. Standage
Ph.D. Candidate
Bioinformatics and Computational Biology Program
Department of Genetics, Development, and Cell Biology
Iowa State University
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120614/13e8189c/attachment-0002.html>

From gowthaman.ramasamy at seattlebiomed.org  Thu Jun 14 12:48:01 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Thu, 14 Jun 2012 11:48:01 -0700
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
References: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>

Of course, Carson knows the best answer.

But, I think, you need to grab the GFFs from your previous maker run, and pass it as model_gff= option. That way, gene models in GFFs are used as a starting point and now will check for evidences from your alt_est dataset....

-Gowthaman
________________________________________
From: maker-devel-bounces at yandell-lab.org [maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage [daniel.standage at gmail.com]
Sent: Thursday, June 14, 2012 11:26 AM
To: Maker Mailing List
Subject: [maker-devel] Quick question about re-annotation

Greetings!

I have a quick question about re-annotation with Maker. I have successfully completed a Maker run, but now I would like to re-run Maker with some additional EST evidence (from a related organism, aligned and in GFF3 format). I simply added the file to the altest_gff configuration setting and re-ran Maker. However, from  the log messages it looked like Maker was starting from scratch rather than using what had already been completed in the initial run. Luckily, I had made a backup of the complete Maker data structure, so I killed the job, deleted the data structure, and restored from the backup.

Before I try to run this again, do I need to change any other configuration settings to do this re-annotation? The stanza under Re-annotation Using MAKER Derived GFF3 looks relevant, but it is not clear to me which settings need to be set.

Thanks!

--
Daniel S. Standage
Ph.D. Candidate
Bioinformatics and Computational Biology Program
Department of Genetics, Development, and Cell Biology
Iowa State University




From jason.stajich at gmail.com  Sun Jun 17 01:30:20 2012
From: jason.stajich at gmail.com (Jason Stajich)
Date: Sun, 17 Jun 2012 08:30:20 +0100
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>
References: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
	<89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>
Message-ID: <CALf8Lpwq4kQu2-VrviAKK9R7EG2vRG3ATQo8g_LjM=stO1tLpA@mail.gmail.com>

Well remember that ESTs are used as extra helper information to the ab
initio gene predictors so it will want to run all those predictions again
and re-call the gene structures from the combined output with this extra
info added in. So you will need to decide how you want these to be
incorporated and if you are willing to wait for the analysis to complete
again with this info. The pass through of the previous run will allow you
to keep the names from that previous run if they are important to you.

Jason Stajich


On Thu, Jun 14, 2012 at 7:48 PM, Gowthaman Ramasamy <
gowthaman.ramasamy at seattlebiomed.org> wrote:

> Of course, Carson knows the best answer.
>
> But, I think, you need to grab the GFFs from your previous maker run, and
> pass it as model_gff= option. That way, gene models in GFFs are used as a
> starting point and now will check for evidences from your alt_est
> dataset....
>
> -Gowthaman
> ________________________________________
> From: maker-devel-bounces at yandell-lab.org [
> maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage [
> daniel.standage at gmail.com]
> Sent: Thursday, June 14, 2012 11:26 AM
> To: Maker Mailing List
> Subject: [maker-devel] Quick question about re-annotation
>
> Greetings!
>
> I have a quick question about re-annotation with Maker. I have
> successfully completed a Maker run, but now I would like to re-run Maker
> with some additional EST evidence (from a related organism, aligned and in
> GFF3 format). I simply added the file to the altest_gff configuration
> setting and re-ran Maker. However, from  the log messages it looked like
> Maker was starting from scratch rather than using what had already been
> completed in the initial run. Luckily, I had made a backup of the complete
> Maker data structure, so I killed the job, deleted the data structure, and
> restored from the backup.
>
> Before I try to run this again, do I need to change any other
> configuration settings to do this re-annotation? The stanza under
> Re-annotation Using MAKER Derived GFF3 looks relevant, but it is not clear
> to me which settings need to be set.
>
> Thanks!
>
> --
> Daniel S. Standage
> Ph.D. Candidate
> Bioinformatics and Computational Biology Program
> Department of Genetics, Development, and Cell Biology
> Iowa State University
>
>
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120617/522b4820/attachment-0002.html>

From alvinchen2002 at gmail.com  Fri Jun 15 13:41:52 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Fri, 15 Jun 2012 15:41:52 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
Message-ID: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>

Hi, 

	This is my first time to use maker. I have installed everything that required by maker, and use the data in "data" folder to test this program. But I got a "Segmentation fault" message after "Maker is now finished!!!". And I can't find gff file anywhere. Does anyone have a clue of this?

Thanks, 
Alvin

Here is the output of the program:

[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
WARNING: blast_type is set to 'wublast' but executables cannot be located
The blast_type 'ncbi' will be used instead.

A data structure will be created for you at:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore

To access files for individual sequences use the datastore index:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_datastore_index.log




--Next Contig--

#---------------------------------------------------------------------
Now starting the contig!!
SeqID: contig-dpp-500-500
Length: 32156
#---------------------------------------------------------------------


running  repeat masker.
#--------- command -------------#
Widget::RepeatMasker:
/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.all.rb -species all -dir /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
#-------------------------------#
processing output: 
cycle 1 
cycle 2 
cycle 3 
cycle 4 
cycle 5 
cycle 6 
cycle 7 
cycle 8 
cycle 9 
cycle 10 
Generating output... 
masking
done
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.repeatrunner
#-------------------------------#
deleted:0 hits
 in cluster:shadow cluster...
    i_size:5 j_size:3
 sorting hits in shadow cluster...
... finished.
 i_size:5   current i:0
 i_size:5   current i:1
 i_size:5   current i:2
 i_size:5   current i:3
 i_size:5   current i:4
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastn:
/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
#-------------------------------#
deleted:-1 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
#-------------------------------#
deleted:0 hits
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.dpp-mRNA-5.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.dpp-mRNA-4.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.dpp-mRNA-3.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.dpp-mRNA-2.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.dpp-mRNA-1.est_exonerate
#-------------------------------#
cleaning blastn...
cleaning tblastx...
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-5.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-4.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-3.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-2.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-1.p_exonerate
#-------------------------------#
cleaning blastx...
Preparing evidence for hint based annotation
 in cluster:shadow cluster...
    i_size:15 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:15   current i:0
 i_size:15   current i:1
 i_size:15   current i:2
 i_size:15   current i:3
 i_size:15   current i:4
 i_size:15   current i:5
 i_size:15   current i:6
 i_size:15   current i:7
 i_size:15   current i:8
 i_size:15   current i:9
 i_size:15   current i:10
 i_size:15   current i:11
 i_size:15   current i:12
 i_size:15   current i:13
 i_size:15   current i:14
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
 ...processing 0 of 5
 ...processing 1 of 5
 ...processing 2 of 5
 ...processing 3 of 5
Making transcripts
Processing transcripts into genes
 in cluster:shadow cluster...
    i_size:3 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:3   current i:0
 i_size:3   current i:1
 i_size:3   current i:2
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
now careful_clustering....
getting Pairs
doing single linkage clustering
 ...processing 0 of 3
 ...processing 1 of 3
Calculating annotation quality statistics
Choosing best annotations


Maker is now finished!!!

Segmentation fault






From gowthaman.ramasamy at seattlebiomed.org  Mon Jun 18 12:16:00 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Mon, 18 Jun 2012 11:16:00 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>
References: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C9EAEDA1E@mail02.sbri.org>

Hi Alvin,
I am a relatively new user too. I too get "seg fault" even though, maker did finish making the gff file successfully.

GFFs are actually buried deep down. One possibility is that you were looking only in parent folders.
If you have not done already,  you might want to check for gffs at: /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/*/*/*. ie, three levels down your data store.

what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?

Gowthaman
________________________________________
From: maker-devel-bounces at yandell-lab.org [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen [alvinchen2002 at gmail.com]
Sent: Friday, June 15, 2012 12:41 PM
To: maker-devel at yandell-lab.org
Subject: [maker-devel] maker 2.10 Segmentation fault

Hi,

        This is my first time to use maker. I have installed everything that required by maker, and use the data in "data" folder to test this program. But I got a "Segmentation fault" message after "Maker is now finished!!!". And I can't find gff file anywhere. Does anyone have a clue of this?

Thanks,
Alvin

Here is the output of the program:

[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
WARNING: blast_type is set to 'wublast' but executables cannot be located
The blast_type 'ncbi' will be used instead.

A data structure will be created for you at:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore

To access files for individual sequences use the datastore index:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_datastore_index.log




--Next Contig--

#---------------------------------------------------------------------
Now starting the contig!!
SeqID: contig-dpp-500-500
Length: 32156
#---------------------------------------------------------------------


running  repeat masker.
#--------- command -------------#
Widget::RepeatMasker:
/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.all.rb -species all -dir /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
#-------------------------------#
processing output:
cycle 1
cycle 2
cycle 3
cycle 4
cycle 5
cycle 6
cycle 7
cycle 8
cycle 9
cycle 10
Generating output...
masking
done
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.repeatrunner
#-------------------------------#
deleted:0 hits
 in cluster:shadow cluster...
    i_size:5 j_size:3
 sorting hits in shadow cluster...
... finished.
 i_size:5   current i:0
 i_size:5   current i:1
 i_size:5   current i:2
 i_size:5   current i:3
 i_size:5   current i:4
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastn:
/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
#-------------------------------#
deleted:-1 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
#-------------------------------#
deleted:0 hits
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.dpp-mRNA-5.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.dpp-mRNA-4.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.dpp-mRNA-3.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.dpp-mRNA-2.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.dpp-mRNA-1.est_exonerate
#-------------------------------#
cleaning blastn...
cleaning tblastx...
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-5.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-4.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-3.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-2.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-1.p_exonerate
#-------------------------------#
cleaning blastx...
Preparing evidence for hint based annotation
 in cluster:shadow cluster...
    i_size:15 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:15   current i:0
 i_size:15   current i:1
 i_size:15   current i:2
 i_size:15   current i:3
 i_size:15   current i:4
 i_size:15   current i:5
 i_size:15   current i:6
 i_size:15   current i:7
 i_size:15   current i:8
 i_size:15   current i:9
 i_size:15   current i:10
 i_size:15   current i:11
 i_size:15   current i:12
 i_size:15   current i:13
 i_size:15   current i:14
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
 ...processing 0 of 5
 ...processing 1 of 5
 ...processing 2 of 5
 ...processing 3 of 5
Making transcripts
Processing transcripts into genes
 in cluster:shadow cluster...
    i_size:3 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:3   current i:0
 i_size:3   current i:1
 i_size:3   current i:2
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
now careful_clustering....
getting Pairs
doing single linkage clustering
 ...processing 0 of 3
 ...processing 1 of 3
Calculating annotation quality statistics
Choosing best annotations


Maker is now finished!!!

Segmentation fault




_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org



From carsonhh at gmail.com  Tue Jun 19 09:30:28 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 08:30:28 -0700
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <CALf8Lpwq4kQu2-VrviAKK9R7EG2vRG3ATQo8g_LjM=stO1tLpA@mail.gmail.com>
Message-ID: <CC05E879.EA7E%carsonhh@gmail.com>

Yes the advice given so far is correct.  You can pass back through old
evidence using the maker_gff option and setting est_pass, protein_pass, etc.
to 1.  Set the pred_pass=0 so as to ignore old predictions.  Let MAKER
generate those again to reflect the additional evidence (added to the
alt_est= option).  If you have model_pass=1 and map_forward=1 set then if
any model changes, you can at least maintain the name.

Thanks,
Carson


From:  Jason Stajich <jason.stajich at gmail.com>
Date:  Sunday, 17 June, 2012 12:30 AM
To:  Daniel Standage <daniel.standage at gmail.com>
Cc:  Maker Mailing List <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Quick question about re-annotation

Well remember that ESTs are used as extra helper information to the ab
initio gene predictors so it will want to run all those predictions again
and re-call the gene structures from the combined output with this extra
info added in. So you will need to decide how you want these to be
incorporated and if you are willing to wait for the analysis to complete
again with this info. The pass through of the previous run will allow you to
keep the names from that previous run if they are important to you.

Jason Stajich


On Thu, Jun 14, 2012 at 7:48 PM, Gowthaman Ramasamy
<gowthaman.ramasamy at seattlebiomed.org> wrote:
> Of course, Carson knows the best answer.
> 
> But, I think, you need to grab the GFFs from your previous maker run, and pass
> it as model_gff= option. That way, gene models in GFFs are used as a starting
> point and now will check for evidences from your alt_est dataset....
> 
> -Gowthaman
> ________________________________________
> From: maker-devel-bounces at yandell-lab.org
> [maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage
> [daniel.standage at gmail.com]
> Sent: Thursday, June 14, 2012 11:26 AM
> To: Maker Mailing List
> Subject: [maker-devel] Quick question about re-annotation
> 
> Greetings!
> 
> I have a quick question about re-annotation with Maker. I have successfully
> completed a Maker run, but now I would like to re-run Maker with some
> additional EST evidence (from a related organism, aligned and in GFF3 format).
> I simply added the file to the altest_gff configuration setting and re-ran
> Maker. However, from  the log messages it looked like Maker was starting from
> scratch rather than using what had already been completed in the initial run.
> Luckily, I had made a backup of the complete Maker data structure, so I killed
> the job, deleted the data structure, and restored from the backup.
> 
> Before I try to run this again, do I need to change any other configuration
> settings to do this re-annotation? The stanza under Re-annotation Using MAKER
> Derived GFF3 looks relevant, but it is not clear to me which settings need to
> be set.
> 
> Thanks!
> 
> --
> Daniel S. Standage
> Ph.D. Candidate
> Bioinformatics and Computational Biology Program
> Department of Genetics, Development, and Cell Biology
> Iowa State University
> 
> 
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120619/039e29b4/attachment-0002.html>

From carsonhh at gmail.com  Tue Jun 19 09:39:55 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 08:39:55 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C9EAEDA1E@mail02.sbri.org>
Message-ID: <CC05E9A6.EA88%carsonhh@gmail.com>

The "Maker is now finished" message occurs before the Segmentation fault
so it is finished.  The Segmentation fault is probably an issue with your
system reaping the perl threads on completion.  You can try reinstalling
the forks and forks::shared from CPAN.  Also make sure you are using the
2.25 version and no 2.10.  But your job is finished anyways, so it's
really not affecting the output.  MAKER puts the results for each contig
in a separate folder because some downstream programs like Apollo can only
handle one contig at a time.  Use the
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file to see where each contigs output is stored.


If you want a merged output file for everything, use the merge_gff script
in maker and give it the
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file and it will assemble a merged output file for you.
 There are two type of output GFF3 which gives detailed annotation
information and fasta which just produces sequence for each transcript.
Use fasta_merge to get a merged fasta file for all contigs (giving it the
same 
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file).  The fiel you are interested will be the
maker.pteins.fasta and maker.transcripts.fasta file.

More information on MAKER's output here -->
http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output

Thanks,
Carson


On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Alvin,
>I am a relatively new user too. I too get "seg fault" even though, maker
>did finish making the gff file successfully.
>
>GFFs are actually buried deep down. One possibility is that you were
>looking only in parent folders.
>If you have not done already,  you might want to check for gffs at:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/*/*/*. ie, three levels down your data store.
>
>what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?
>
>Gowthaman
>________________________________________
>From: maker-devel-bounces at yandell-lab.org
>[maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>[alvinchen2002 at gmail.com]
>Sent: Friday, June 15, 2012 12:41 PM
>To: maker-devel at yandell-lab.org
>Subject: [maker-devel] maker 2.10 Segmentation fault
>
>Hi,
>
>        This is my first time to use maker. I have installed everything
>that required by maker, and use the data in "data" folder to test this
>program. But I got a "Segmentation fault" message after "Maker is now
>finished!!!". And I can't find gff file anywhere. Does anyone have a clue
>of this?
>
>Thanks,
>Alvin
>
>Here is the output of the program:
>
>[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
>WARNING: blast_type is set to 'wublast' but executables cannot be located
>The blast_type 'ncbi' will be used instead.
>
>A data structure will be created for you at:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re
>
>To access files for individual sequences use the datastore index:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_
>datastore_index.log
>
>
>
>
>--Next Contig--
>
>#---------------------------------------------------------------------
>Now starting the contig!!
>SeqID: contig-dpp-500-500
>Length: 32156
>#---------------------------------------------------------------------
>
>
>running  repeat masker.
>#--------- command -------------#
>Widget::RepeatMasker:
>/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.all.rb -species all -dir
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>#-------------------------------#
>processing output:
>cycle 1
>cycle 2
>cycle 3
>cycle 4
>cycle 5
>cycle 6
>cycle 7
>cycle 8
>cycle 9
>cycle 10
>Generating output...
>masking
>done
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
> in cluster:shadow cluster...
>    i_size:5 j_size:3
> sorting hits in shadow cluster...
>... finished.
> i_size:5   current i:0
> i_size:5   current i:1
> i_size:5   current i:2
> i_size:5   current i:3
> i_size:5   current i:4
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastn:
>/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>-i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>-o 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>#-------------------------------#
>deleted:-1 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
>#-------------------------------#
>deleted:0 hits
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26586-31847.dpp-mRNA-5.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.23089-31847.dpp-mRNA-4.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.22854-31847.dpp-mRNA-3.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.20908-31847.dpp-mRNA-2.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26901-31847.dpp-mRNA-1.est_exonerate
>#-------------------------------#
>cleaning blastn...
>cleaning tblastx...
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-5.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-4.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-3.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-2.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-1.p_exonerate
>#-------------------------------#
>cleaning blastx...
>Preparing evidence for hint based annotation
> in cluster:shadow cluster...
>    i_size:15 j_size:1
> sorting hits in shadow cluster...
>... finished.
> i_size:15   current i:0
> i_size:15   current i:1
> i_size:15   current i:2
> i_size:15   current i:3
> i_size:15   current i:4
> i_size:15   current i:5
> i_size:15   current i:6
> i_size:15   current i:7
> i_size:15   current i:8
> i_size:15   current i:9
> i_size:15   current i:10
> i_size:15   current i:11
> i_size:15   current i:12
> i_size:15   current i:13
> i_size:15   current i:14
> in cluster:shadow cluster...
>    i_size:0 j_size:0
> sorting hits in shadow cluster...
>... finished.
> ...processing 0 of 5
> ...processing 1 of 5
> ...processing 2 of 5
> ...processing 3 of 5
>Making transcripts
>Processing transcripts into genes
> in cluster:shadow cluster...
>    i_size:3 j_size:1
> sorting hits in shadow cluster...
>... finished.
> i_size:3   current i:0
> i_size:3   current i:1
> i_size:3   current i:2
> in cluster:shadow cluster...
>    i_size:0 j_size:0
> sorting hits in shadow cluster...
>... finished.
>now careful_clustering....
>getting Pairs
>doing single linkage clustering
> ...processing 0 of 3
> ...processing 1 of 3
>Calculating annotation quality statistics
>Choosing best annotations
>
>
>Maker is now finished!!!
>
>Segmentation fault
>
>
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From alvinchen2002 at gmail.com  Tue Jun 19 21:57:33 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Tue, 19 Jun 2012 23:57:33 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC05E9A6.EA88%carsonhh@gmail.com>
References: <CC05E9A6.EA88%carsonhh@gmail.com>
Message-ID: <3C1B46A3-09B2-4BFC-9CDE-BBCFF2B74073@gmail.com>

Hey Carson and Gowthaman, 

	Thanks for your replies! You are right, Carson, the problem caused by "Proc::Signal::reap_children_by_name(9, 'maintain.pl');". dpp_contig_master_datastore_index.log shows that the job has finished. I have installed the newest version of forks and forks::shared. but the version is 0.34 not 2.25, is that correct? The bad news is that the program still crashed at last, but it won't hurt.  I have tried the dpp and hsap data in data folder, and I have got 6 genes for hsap and 3 genes for dpp, is this number correct? I just want make sure everything works fine and I will begin to use it with my data. Thanks!

Best,
Alvin


On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:

> The "Maker is now finished" message occurs before the Segmentation fault
> so it is finished.  The Segmentation fault is probably an issue with your
> system reaping the perl threads on completion.  You can try reinstalling
> the forks and forks::shared from CPAN.  Also make sure you are using the
> 2.25 version and no 2.10.  But your job is finished anyways, so it's
> really not affecting the output.  MAKER puts the results for each contig
> in a separate folder because some downstream programs like Apollo can only
> handle one contig at a time.  Use the
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file to see where each contigs output is stored.
> 
> 
> If you want a merged output file for everything, use the merge_gff script
> in maker and give it the
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file and it will assemble a merged output file for you.
> There are two type of output GFF3 which gives detailed annotation
> information and fasta which just produces sequence for each transcript.
> Use fasta_merge to get a merged fasta file for all contigs (giving it the
> same 
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file).  The fiel you are interested will be the
> maker.pteins.fasta and maker.transcripts.fasta file.
> 
> More information on MAKER's output here -->
> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
> 
> Thanks,
> Carson
> 
> 
> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Alvin,
>> I am a relatively new user too. I too get "seg fault" even though, maker
>> did finish making the gff file successfully.
>> 
>> GFFs are actually buried deep down. One possibility is that you were
>> looking only in parent folders.
>> If you have not done already,  you might want to check for gffs at:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/*/*/*. ie, three levels down your data store.
>> 
>> what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?
>> 
>> Gowthaman
>> ________________________________________
>> From: maker-devel-bounces at yandell-lab.org
>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>> [alvinchen2002 at gmail.com]
>> Sent: Friday, June 15, 2012 12:41 PM
>> To: maker-devel at yandell-lab.org
>> Subject: [maker-devel] maker 2.10 Segmentation fault
>> 
>> Hi,
>> 
>>       This is my first time to use maker. I have installed everything
>> that required by maker, and use the data in "data" folder to test this
>> program. But I got a "Segmentation fault" message after "Maker is now
>> finished!!!". And I can't find gff file anywhere. Does anyone have a clue
>> of this?
>> 
>> Thanks,
>> Alvin
>> 
>> Here is the output of the program:
>> 
>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
>> WARNING: blast_type is set to 'wublast' but executables cannot be located
>> The blast_type 'ncbi' will be used instead.
>> 
>> A data structure will be created for you at:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re
>> 
>> To access files for individual sequences use the datastore index:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_
>> datastore_index.log
>> 
>> 
>> 
>> 
>> --Next Contig--
>> 
>> #---------------------------------------------------------------------
>> Now starting the contig!!
>> SeqID: contig-dpp-500-500
>> Length: 32156
>> #---------------------------------------------------------------------
>> 
>> 
>> running  repeat masker.
>> #--------- command -------------#
>> Widget::RepeatMasker:
>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.all.rb -species all -dir
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>> #-------------------------------#
>> processing output:
>> cycle 1
>> cycle 2
>> cycle 3
>> cycle 4
>> cycle 5
>> cycle 6
>> cycle 7
>> cycle 8
>> cycle 9
>> cycle 10
>> Generating output...
>> masking
>> done
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> in cluster:shadow cluster...
>>   i_size:5 j_size:3
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:5   current i:0
>> i_size:5   current i:1
>> i_size:5   current i:2
>> i_size:5   current i:3
>> i_size:5   current i:4
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastn:
>> /usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>> -o 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>> #-------------------------------#
>> deleted:-1 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
>> #-------------------------------#
>> deleted:0 hits
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26586-31847.dpp-mRNA-5.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .23089-31847.dpp-mRNA-4.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .22854-31847.dpp-mRNA-3.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .20908-31847.dpp-mRNA-2.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26901-31847.dpp-mRNA-1.est_exonerate
>> #-------------------------------#
>> cleaning blastn...
>> cleaning tblastx...
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-5.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-4.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-3.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-2.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-1.p_exonerate
>> #-------------------------------#
>> cleaning blastx...
>> Preparing evidence for hint based annotation
>> in cluster:shadow cluster...
>>   i_size:15 j_size:1
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:15   current i:0
>> i_size:15   current i:1
>> i_size:15   current i:2
>> i_size:15   current i:3
>> i_size:15   current i:4
>> i_size:15   current i:5
>> i_size:15   current i:6
>> i_size:15   current i:7
>> i_size:15   current i:8
>> i_size:15   current i:9
>> i_size:15   current i:10
>> i_size:15   current i:11
>> i_size:15   current i:12
>> i_size:15   current i:13
>> i_size:15   current i:14
>> in cluster:shadow cluster...
>>   i_size:0 j_size:0
>> sorting hits in shadow cluster...
>> ... finished.
>> ...processing 0 of 5
>> ...processing 1 of 5
>> ...processing 2 of 5
>> ...processing 3 of 5
>> Making transcripts
>> Processing transcripts into genes
>> in cluster:shadow cluster...
>>   i_size:3 j_size:1
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:3   current i:0
>> i_size:3   current i:1
>> i_size:3   current i:2
>> in cluster:shadow cluster...
>>   i_size:0 j_size:0
>> sorting hits in shadow cluster...
>> ... finished.
>> now careful_clustering....
>> getting Pairs
>> doing single linkage clustering
>> ...processing 0 of 3
>> ...processing 1 of 3
>> Calculating annotation quality statistics
>> Choosing best annotations
>> 
>> 
>> Maker is now finished!!!
>> 
>> Segmentation fault
>> 
>> 
>> 
>> 
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
> 
> 




From carsonhh at gmail.com  Tue Jun 19 23:03:14 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:03:14 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <3C1B46A3-09B2-4BFC-9CDE-BBCFF2B74073@gmail.com>
Message-ID: <CC06A670.EACE%carsonhh@gmail.com>

Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
version 2.25 (type maker -v to see the version you are using).  The
reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
process fails to respond to signals upstream in the code.  The 2.25
version of MAKER does some extra things that should even further avoid the
need for the call compared to MAKER 2.10.

Thanks,
Carson






On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey Carson and Gowthaman,
>
>	Thanks for your replies! You are right, Carson, the problem caused by
>"Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>dpp_contig_master_datastore_index.log shows that the job has finished. I
>have installed the newest version of forks and forks::shared. but the
>version is 0.34 not 2.25, is that correct? The bad news is that the
>program still crashed at last, but it won't hurt.  I have tried the dpp
>and hsap data in data folder, and I have got 6 genes for hsap and 3 genes
>for dpp, is this number correct? I just want make sure everything works
>fine and I will begin to use it with my data. Thanks!
>
>Best,
>Alvin
>
>
>On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>
>> The "Maker is now finished" message occurs before the Segmentation fault
>> so it is finished.  The Segmentation fault is probably an issue with
>>your
>> system reaping the perl threads on completion.  You can try reinstalling
>> the forks and forks::shared from CPAN.  Also make sure you are using the
>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>> really not affecting the output.  MAKER puts the results for each contig
>> in a separate folder because some downstream programs like Apollo can
>>only
>> handle one contig at a time.  Use the
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file to see where each contigs output is stored.
>> 
>> 
>> If you want a merged output file for everything, use the merge_gff
>>script
>> in maker and give it the
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file and it will assemble a merged output file for
>>you.
>> There are two type of output GFF3 which gives detailed annotation
>> information and fasta which just produces sequence for each transcript.
>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>the
>> same 
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file).  The fiel you are interested will be the
>> maker.pteins.fasta and maker.transcripts.fasta file.
>> 
>> More information on MAKER's output here -->
>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>> 
>> Thanks,
>> Carson
>> 
>> 
>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>> 
>>> Hi Alvin,
>>> I am a relatively new user too. I too get "seg fault" even though,
>>>maker
>>> did finish making the gff file successfully.
>>> 
>>> GFFs are actually buried deep down. One possibility is that you were
>>> looking only in parent folders.
>>> If you have not done already,  you might want to check for gffs at:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/*/*/*. ie, three levels down your data store.
>>> 
>>> what does "dpp_contig_master_datastore_index.log" says?
>>>Failed/Finsihed ?
>>> 
>>> Gowthaman
>>> ________________________________________
>>> From: maker-devel-bounces at yandell-lab.org
>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>> [alvinchen2002 at gmail.com]
>>> Sent: Friday, June 15, 2012 12:41 PM
>>> To: maker-devel at yandell-lab.org
>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>> 
>>> Hi,
>>> 
>>>       This is my first time to use maker. I have installed everything
>>> that required by maker, and use the data in "data" folder to test this
>>> program. But I got a "Segmentation fault" message after "Maker is now
>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>clue
>>> of this?
>>> 
>>> Thanks,
>>> Alvin
>>> 
>>> Here is the output of the program:
>>> 
>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>maker_exe.ctl
>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>located
>>> The blast_type 'ncbi' will be used instead.
>>> 
>>> A data structure will be created for you at:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re
>>> 
>>> To access files for individual sequences use the datastore index:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_maste
>>>r_
>>> datastore_index.log
>>> 
>>> 
>>> 
>>> 
>>> --Next Contig--
>>> 
>>> #---------------------------------------------------------------------
>>> Now starting the contig!!
>>> SeqID: contig-dpp-500-500
>>> Length: 32156
>>> #---------------------------------------------------------------------
>>> 
>>> 
>>> running  repeat masker.
>>> #--------- command -------------#
>>> Widget::RepeatMasker:
>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .0.all.rb -species all -dir
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>> #-------------------------------#
>>> processing output:
>>> cycle 1
>>> cycle 2
>>> cycle 3
>>> cycle 4
>>> cycle 5
>>> cycle 6
>>> cycle 7
>>> cycle 8
>>> cycle 9
>>> cycle 10
>>> Generating output...
>>> masking
>>> done
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>0.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>1.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>2.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>3.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>4.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>5.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>6.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>7.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>8.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>9.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> in cluster:shadow cluster...
>>>   i_size:5 j_size:3
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:5   current i:0
>>> i_size:5   current i:1
>>> i_size:5   current i:2
>>> i_size:5   current i:3
>>> i_size:5   current i:4
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastn:
>>> /usr/bin/blastall -p blastn -d
>>>/tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>>> -o 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>> #-------------------------------#
>>> deleted:-1 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blast
>>>x
>>> #-------------------------------#
>>> deleted:0 hits
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>> #-------------------------------#
>>> cleaning blastn...
>>> cleaning tblastx...
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-5.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-4.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-3.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-2.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-1.p_exonerate
>>> #-------------------------------#
>>> cleaning blastx...
>>> Preparing evidence for hint based annotation
>>> in cluster:shadow cluster...
>>>   i_size:15 j_size:1
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:15   current i:0
>>> i_size:15   current i:1
>>> i_size:15   current i:2
>>> i_size:15   current i:3
>>> i_size:15   current i:4
>>> i_size:15   current i:5
>>> i_size:15   current i:6
>>> i_size:15   current i:7
>>> i_size:15   current i:8
>>> i_size:15   current i:9
>>> i_size:15   current i:10
>>> i_size:15   current i:11
>>> i_size:15   current i:12
>>> i_size:15   current i:13
>>> i_size:15   current i:14
>>> in cluster:shadow cluster...
>>>   i_size:0 j_size:0
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> ...processing 0 of 5
>>> ...processing 1 of 5
>>> ...processing 2 of 5
>>> ...processing 3 of 5
>>> Making transcripts
>>> Processing transcripts into genes
>>> in cluster:shadow cluster...
>>>   i_size:3 j_size:1
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:3   current i:0
>>> i_size:3   current i:1
>>> i_size:3   current i:2
>>> in cluster:shadow cluster...
>>>   i_size:0 j_size:0
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> now careful_clustering....
>>> getting Pairs
>>> doing single linkage clustering
>>> ...processing 0 of 3
>>> ...processing 1 of 3
>>> Calculating annotation quality statistics
>>> Choosing best annotations
>>> 
>>> 
>>> Maker is now finished!!!
>>> 
>>> Segmentation fault
>>> 
>>> 
>>> 
>>> 
>>> _______________________________________________
>>> maker-devel mailing list
>>> maker-devel at box290.bluehost.com
>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>> 
>>> _______________________________________________
>>> maker-devel mailing list
>>> maker-devel at box290.bluehost.com
>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> 
>





From alvinchen2002 at gmail.com  Tue Jun 19 23:15:24 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Wed, 20 Jun 2012 01:15:24 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC06A670.EACE%carsonhh@gmail.com>
References: <CC06A670.EACE%carsonhh@gmail.com>
Message-ID: <ACAA26CD-8208-4027-9831-2139093467A2@gmail.com>

Hey  Carson,

	I am still using 2.10, because 2.25 get crashed at the beginning. I think it may be caused by these codes:

Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up maintainers
Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up maintainers"

You have added them at the top of the scripts in the new version. 

Alvin

On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:

> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
> version 2.25 (type maker -v to see the version you are using).  The
> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
> process fails to respond to signals upstream in the code.  The 2.25
> version of MAKER does some extra things that should even further avoid the
> need for the call compared to MAKER 2.10.
> 
> Thanks,
> Carson
> 
> 
> 
> 
> 
> 
> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
> 
>> Hey Carson and Gowthaman,
>> 
>> 	Thanks for your replies! You are right, Carson, the problem caused by
>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>> dpp_contig_master_datastore_index.log shows that the job has finished. I
>> have installed the newest version of forks and forks::shared. but the
>> version is 0.34 not 2.25, is that correct? The bad news is that the
>> program still crashed at last, but it won't hurt.  I have tried the dpp
>> and hsap data in data folder, and I have got 6 genes for hsap and 3 genes
>> for dpp, is this number correct? I just want make sure everything works
>> fine and I will begin to use it with my data. Thanks!
>> 
>> Best,
>> Alvin
>> 
>> 
>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>> 
>>> The "Maker is now finished" message occurs before the Segmentation fault
>>> so it is finished.  The Segmentation fault is probably an issue with
>>> your
>>> system reaping the perl threads on completion.  You can try reinstalling
>>> the forks and forks::shared from CPAN.  Also make sure you are using the
>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>> really not affecting the output.  MAKER puts the results for each contig
>>> in a separate folder because some downstream programs like Apollo can
>>> only
>>> handle one contig at a time.  Use the
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file to see where each contigs output is stored.
>>> 
>>> 
>>> If you want a merged output file for everything, use the merge_gff
>>> script
>>> in maker and give it the
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file and it will assemble a merged output file for
>>> you.
>>> There are two type of output GFF3 which gives detailed annotation
>>> information and fasta which just produces sequence for each transcript.
>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>> the
>>> same 
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file).  The fiel you are interested will be the
>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>> 
>>> More information on MAKER's output here -->
>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>> 
>>> Thanks,
>>> Carson
>>> 
>>> 
>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>> 
>>>> Hi Alvin,
>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>> maker
>>>> did finish making the gff file successfully.
>>>> 
>>>> GFFs are actually buried deep down. One possibility is that you were
>>>> looking only in parent folders.
>>>> If you have not done already,  you might want to check for gffs at:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/*/*/*. ie, three levels down your data store.
>>>> 
>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>> Failed/Finsihed ?
>>>> 
>>>> Gowthaman
>>>> ________________________________________
>>>> From: maker-devel-bounces at yandell-lab.org
>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>> [alvinchen2002 at gmail.com]
>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>> To: maker-devel at yandell-lab.org
>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>> 
>>>> Hi,
>>>> 
>>>>      This is my first time to use maker. I have installed everything
>>>> that required by maker, and use the data in "data" folder to test this
>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>> clue
>>>> of this?
>>>> 
>>>> Thanks,
>>>> Alvin
>>>> 
>>>> Here is the output of the program:
>>>> 
>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>> maker_exe.ctl
>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>> located
>>>> The blast_type 'ncbi' will be used instead.
>>>> 
>>>> A data structure will be created for you at:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re
>>>> 
>>>> To access files for individual sequences use the datastore index:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_maste
>>>> r_
>>>> datastore_index.log
>>>> 
>>>> 
>>>> 
>>>> 
>>>> --Next Contig--
>>>> 
>>>> #---------------------------------------------------------------------
>>>> Now starting the contig!!
>>>> SeqID: contig-dpp-500-500
>>>> Length: 32156
>>>> #---------------------------------------------------------------------
>>>> 
>>>> 
>>>> running  repeat masker.
>>>> #--------- command -------------#
>>>> Widget::RepeatMasker:
>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .0.all.rb -species all -dir
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>> #-------------------------------#
>>>> processing output:
>>>> cycle 1
>>>> cycle 2
>>>> cycle 3
>>>> cycle 4
>>>> cycle 5
>>>> cycle 6
>>>> cycle 7
>>>> cycle 8
>>>> cycle 9
>>>> cycle 10
>>>> Generating output...
>>>> masking
>>>> done
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 0.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 1.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 2.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 3.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 4.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 5.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 6.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 7.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 8.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 9.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> in cluster:shadow cluster...
>>>>  i_size:5 j_size:3
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:5   current i:0
>>>> i_size:5   current i:1
>>>> i_size:5   current i:2
>>>> i_size:5   current i:3
>>>> i_size:5   current i:4
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastn:
>>>> /usr/bin/blastall -p blastn -d
>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>>>> -o 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>> #-------------------------------#
>>>> deleted:-1 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blast
>>>> x
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>> #-------------------------------#
>>>> cleaning blastn...
>>>> cleaning tblastx...
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>> #-------------------------------#
>>>> cleaning blastx...
>>>> Preparing evidence for hint based annotation
>>>> in cluster:shadow cluster...
>>>>  i_size:15 j_size:1
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:15   current i:0
>>>> i_size:15   current i:1
>>>> i_size:15   current i:2
>>>> i_size:15   current i:3
>>>> i_size:15   current i:4
>>>> i_size:15   current i:5
>>>> i_size:15   current i:6
>>>> i_size:15   current i:7
>>>> i_size:15   current i:8
>>>> i_size:15   current i:9
>>>> i_size:15   current i:10
>>>> i_size:15   current i:11
>>>> i_size:15   current i:12
>>>> i_size:15   current i:13
>>>> i_size:15   current i:14
>>>> in cluster:shadow cluster...
>>>>  i_size:0 j_size:0
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> ...processing 0 of 5
>>>> ...processing 1 of 5
>>>> ...processing 2 of 5
>>>> ...processing 3 of 5
>>>> Making transcripts
>>>> Processing transcripts into genes
>>>> in cluster:shadow cluster...
>>>>  i_size:3 j_size:1
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:3   current i:0
>>>> i_size:3   current i:1
>>>> i_size:3   current i:2
>>>> in cluster:shadow cluster...
>>>>  i_size:0 j_size:0
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> now careful_clustering....
>>>> getting Pairs
>>>> doing single linkage clustering
>>>> ...processing 0 of 3
>>>> ...processing 1 of 3
>>>> Calculating annotation quality statistics
>>>> Choosing best annotations
>>>> 
>>>> 
>>>> Maker is now finished!!!
>>>> 
>>>> Segmentation fault
>>>> 
>>>> 
>>>> 
>>>> 
>>>> _______________________________________________
>>>> maker-devel mailing list
>>>> maker-devel at box290.bluehost.com
>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>>> 
>>>> _______________________________________________
>>>> maker-devel mailing list
>>>> maker-devel at box290.bluehost.com
>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>> 
>>> 
>> 
> 
> 




From carsonhh at gmail.com  Tue Jun 19 23:21:22 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:21:22 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <ACAA26CD-8208-4027-9831-2139093467A2@gmail.com>
Message-ID: <CC06AB2D.EAE2%carsonhh@gmail.com>

Those are wrapped in an END block so they only run when perl exits (I.e.
post completion or failure).  If 2.25 is failing it would likely be for
another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
-debug).  Does it produce any output before failure?

Thanks,
Carson





On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey  Carson,
>
>	I am still using 2.10, because 2.25 get crashed at the beginning. I
>think it may be caused by these codes:
>
>Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>maintainers
>Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>maintainers"
>
>You have added them at the top of the scripts in the new version.
>
>Alvin
>
>On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>
>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
>> version 2.25 (type maker -v to see the version you are using).  The
>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>> process fails to respond to signals upstream in the code.  The 2.25
>> version of MAKER does some extra things that should even further avoid
>>the
>> need for the call compared to MAKER 2.10.
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> 
>> 
>> 
>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>> 
>>> Hey Carson and Gowthaman,
>>> 
>>> 	Thanks for your replies! You are right, Carson, the problem caused by
>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>> dpp_contig_master_datastore_index.log shows that the job has finished.
>>>I
>>> have installed the newest version of forks and forks::shared. but the
>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>> program still crashed at last, but it won't hurt.  I have tried the dpp
>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>genes
>>> for dpp, is this number correct? I just want make sure everything works
>>> fine and I will begin to use it with my data. Thanks!
>>> 
>>> Best,
>>> Alvin
>>> 
>>> 
>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>> 
>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>fault
>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>> your
>>>> system reaping the perl threads on completion.  You can try
>>>>reinstalling
>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>the
>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>> really not affecting the output.  MAKER puts the results for each
>>>>contig
>>>> in a separate folder because some downstream programs like Apollo can
>>>> only
>>>> handle one contig at a time.  Use the
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file to see where each contigs output is stored.
>>>> 
>>>> 
>>>> If you want a merged output file for everything, use the merge_gff
>>>> script
>>>> in maker and give it the
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file and it will assemble a merged output file for
>>>> you.
>>>> There are two type of output GFF3 which gives detailed annotation
>>>> information and fasta which just produces sequence for each
>>>>transcript.
>>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>>> the
>>>> same 
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file).  The fiel you are interested will be the
>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>> 
>>>> More information on MAKER's output here -->
>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>> 
>>>> Thanks,
>>>> Carson
>>>> 
>>>> 
>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>> 
>>>>> Hi Alvin,
>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>> maker
>>>>> did finish making the gff file successfully.
>>>>> 
>>>>> GFFs are actually buried deep down. One possibility is that you were
>>>>> looking only in parent folders.
>>>>> If you have not done already,  you might want to check for gffs at:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re/*/*/*. ie, three levels down your data store.
>>>>> 
>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>> Failed/Finsihed ?
>>>>> 
>>>>> Gowthaman
>>>>> ________________________________________
>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>> [alvinchen2002 at gmail.com]
>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>> To: maker-devel at yandell-lab.org
>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>> 
>>>>> Hi,
>>>>> 
>>>>>      This is my first time to use maker. I have installed everything
>>>>> that required by maker, and use the data in "data" folder to test
>>>>>this
>>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>>> clue
>>>>> of this?
>>>>> 
>>>>> Thanks,
>>>>> Alvin
>>>>> 
>>>>> Here is the output of the program:
>>>>> 
>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>> maker_exe.ctl
>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>> located
>>>>> The blast_type 'ncbi' will be used instead.
>>>>> 
>>>>> A data structure will be created for you at:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re
>>>>> 
>>>>> To access files for individual sequences use the datastore index:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mas
>>>>>te
>>>>> r_
>>>>> datastore_index.log
>>>>> 
>>>>> 
>>>>> 
>>>>> 
>>>>> --Next Contig--
>>>>> 
>>>>> 
>>>>>#---------------------------------------------------------------------
>>>>> Now starting the contig!!
>>>>> SeqID: contig-dpp-500-500
>>>>> Length: 32156
>>>>> 
>>>>>#---------------------------------------------------------------------
>>>>> 
>>>>> 
>>>>> running  repeat masker.
>>>>> #--------- command -------------#
>>>>> Widget::RepeatMasker:
>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .0.all.rb -species all -dir
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>> #-------------------------------#
>>>>> processing output:
>>>>> cycle 1
>>>>> cycle 2
>>>>> cycle 3
>>>>> cycle 4
>>>>> cycle 5
>>>>> cycle 6
>>>>> cycle 7
>>>>> cycle 8
>>>>> cycle 9
>>>>> cycle 10
>>>>> Generating output...
>>>>> masking
>>>>> done
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 0.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 1.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 2.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 3.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 4.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 5.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 6.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 7.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 8.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 9.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> in cluster:shadow cluster...
>>>>>  i_size:5 j_size:3
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:5   current i:0
>>>>> i_size:5   current i:1
>>>>> i_size:5   current i:2
>>>>> i_size:5   current i:3
>>>>> i_size:5   current i:4
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastn:
>>>>> /usr/bin/blastall -p blastn -d
>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>-e
>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>-I T
>>>>> -o 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>> #-------------------------------#
>>>>> deleted:-1 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>>/tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.bla
>>>>>st
>>>>> x
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>> #-------------------------------#
>>>>> cleaning blastn...
>>>>> cleaning tblastx...
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>> #-------------------------------#
>>>>> cleaning blastx...
>>>>> Preparing evidence for hint based annotation
>>>>> in cluster:shadow cluster...
>>>>>  i_size:15 j_size:1
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:15   current i:0
>>>>> i_size:15   current i:1
>>>>> i_size:15   current i:2
>>>>> i_size:15   current i:3
>>>>> i_size:15   current i:4
>>>>> i_size:15   current i:5
>>>>> i_size:15   current i:6
>>>>> i_size:15   current i:7
>>>>> i_size:15   current i:8
>>>>> i_size:15   current i:9
>>>>> i_size:15   current i:10
>>>>> i_size:15   current i:11
>>>>> i_size:15   current i:12
>>>>> i_size:15   current i:13
>>>>> i_size:15   current i:14
>>>>> in cluster:shadow cluster...
>>>>>  i_size:0 j_size:0
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> ...processing 0 of 5
>>>>> ...processing 1 of 5
>>>>> ...processing 2 of 5
>>>>> ...processing 3 of 5
>>>>> Making transcripts
>>>>> Processing transcripts into genes
>>>>> in cluster:shadow cluster...
>>>>>  i_size:3 j_size:1
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:3   current i:0
>>>>> i_size:3   current i:1
>>>>> i_size:3   current i:2
>>>>> in cluster:shadow cluster...
>>>>>  i_size:0 j_size:0
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> now careful_clustering....
>>>>> getting Pairs
>>>>> doing single linkage clustering
>>>>> ...processing 0 of 3
>>>>> ...processing 1 of 3
>>>>> Calculating annotation quality statistics
>>>>> Choosing best annotations
>>>>> 
>>>>> 
>>>>> Maker is now finished!!!
>>>>> 
>>>>> Segmentation fault
>>>>> 
>>>>> 
>>>>> 
>>>>> 
>>>>> _______________________________________________
>>>>> maker-devel mailing list
>>>>> maker-devel at box290.bluehost.com
>>>>> 
>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>g
>>>>> 
>>>>> _______________________________________________
>>>>> maker-devel mailing list
>>>>> maker-devel at box290.bluehost.com
>>>>> 
>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>g
>>>> 
>>>> 
>>> 
>> 
>> 
>





From alvinchen2002 at gmail.com  Tue Jun 19 23:48:10 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Wed, 20 Jun 2012 01:48:10 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC06AB2D.EAE2%carsonhh@gmail.com>
References: <CC06AB2D.EAE2%carsonhh@gmail.com>
Message-ID: <6C911ABF-19AF-4EBB-A990-1ECE85ADD7E3@gmail.com>

Hey Carson, 

	It seems like there is a bug in Proc-ProcessTable 0.45.  I solved the problem by downgraded Proc-ProcessTable from 0.45 to 0.44. I can run 2.25 without any problems now. 

Cheers,
Alvin

On Jun 20, 2012, at 1:21 AM, Carson Holt wrote:

> Those are wrapped in an END block so they only run when perl exits (I.e.
> post completion or failure).  If 2.25 is failing it would likely be for
> another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
> -debug).  Does it produce any output before failure?
> 
> Thanks,
> Carson
> 
> 
> 
> 
> 
> On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
> 
>> Hey  Carson,
>> 
>> 	I am still using 2.10, because 2.25 get crashed at the beginning. I
>> think it may be caused by these codes:
>> 
>> Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>> maintainers
>> Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>> maintainers"
>> 
>> You have added them at the top of the scripts in the new version.
>> 
>> Alvin
>> 
>> On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>> 
>>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
>>> version 2.25 (type maker -v to see the version you are using).  The
>>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>>> process fails to respond to signals upstream in the code.  The 2.25
>>> version of MAKER does some extra things that should even further avoid
>>> the
>>> need for the call compared to MAKER 2.10.
>>> 
>>> Thanks,
>>> Carson
>>> 
>>> 
>>> 
>>> 
>>> 
>>> 
>>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>>> 
>>>> Hey Carson and Gowthaman,
>>>> 
>>>> 	Thanks for your replies! You are right, Carson, the problem caused by
>>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>>> dpp_contig_master_datastore_index.log shows that the job has finished.
>>>> I
>>>> have installed the newest version of forks and forks::shared. but the
>>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>>> program still crashed at last, but it won't hurt.  I have tried the dpp
>>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>> genes
>>>> for dpp, is this number correct? I just want make sure everything works
>>>> fine and I will begin to use it with my data. Thanks!
>>>> 
>>>> Best,
>>>> Alvin
>>>> 
>>>> 
>>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>>> 
>>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>> fault
>>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>>> your
>>>>> system reaping the perl threads on completion.  You can try
>>>>> reinstalling
>>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>> the
>>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>>> really not affecting the output.  MAKER puts the results for each
>>>>> contig
>>>>> in a separate folder because some downstream programs like Apollo can
>>>>> only
>>>>> handle one contig at a time.  Use the
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file to see where each contigs output is stored.
>>>>> 
>>>>> 
>>>>> If you want a merged output file for everything, use the merge_gff
>>>>> script
>>>>> in maker and give it the
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file and it will assemble a merged output file for
>>>>> you.
>>>>> There are two type of output GFF3 which gives detailed annotation
>>>>> information and fasta which just produces sequence for each
>>>>> transcript.
>>>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>>>> the
>>>>> same 
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file).  The fiel you are interested will be the
>>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>>> 
>>>>> More information on MAKER's output here -->
>>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>>> 
>>>>> Thanks,
>>>>> Carson
>>>>> 
>>>>> 
>>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>>> 
>>>>>> Hi Alvin,
>>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>>> maker
>>>>>> did finish making the gff file successfully.
>>>>>> 
>>>>>> GFFs are actually buried deep down. One possibility is that you were
>>>>>> looking only in parent folders.
>>>>>> If you have not done already,  you might want to check for gffs at:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re/*/*/*. ie, three levels down your data store.
>>>>>> 
>>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>>> Failed/Finsihed ?
>>>>>> 
>>>>>> Gowthaman
>>>>>> ________________________________________
>>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>>> [alvinchen2002 at gmail.com]
>>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>>> To: maker-devel at yandell-lab.org
>>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>>> 
>>>>>> Hi,
>>>>>> 
>>>>>>     This is my first time to use maker. I have installed everything
>>>>>> that required by maker, and use the data in "data" folder to test
>>>>>> this
>>>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>>>> clue
>>>>>> of this?
>>>>>> 
>>>>>> Thanks,
>>>>>> Alvin
>>>>>> 
>>>>>> Here is the output of the program:
>>>>>> 
>>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>>> maker_exe.ctl
>>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>>> located
>>>>>> The blast_type 'ncbi' will be used instead.
>>>>>> 
>>>>>> A data structure will be created for you at:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re
>>>>>> 
>>>>>> To access files for individual sequences use the datastore index:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mas
>>>>>> te
>>>>>> r_
>>>>>> datastore_index.log
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> --Next Contig--
>>>>>> 
>>>>>> 
>>>>>> #---------------------------------------------------------------------
>>>>>> Now starting the contig!!
>>>>>> SeqID: contig-dpp-500-500
>>>>>> Length: 32156
>>>>>> 
>>>>>> #---------------------------------------------------------------------
>>>>>> 
>>>>>> 
>>>>>> running  repeat masker.
>>>>>> #--------- command -------------#
>>>>>> Widget::RepeatMasker:
>>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .0.all.rb -species all -dir
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>>> #-------------------------------#
>>>>>> processing output:
>>>>>> cycle 1
>>>>>> cycle 2
>>>>>> cycle 3
>>>>>> cycle 4
>>>>>> cycle 5
>>>>>> cycle 6
>>>>>> cycle 7
>>>>>> cycle 8
>>>>>> cycle 9
>>>>>> cycle 10
>>>>>> Generating output...
>>>>>> masking
>>>>>> done
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 0.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 1.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 2.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 3.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 4.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 5.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 6.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 7.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 8.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 9.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:5 j_size:3
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:5   current i:0
>>>>>> i_size:5   current i:1
>>>>>> i_size:5   current i:2
>>>>>> i_size:5   current i:3
>>>>>> i_size:5   current i:4
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastn:
>>>>>> /usr/bin/blastall -p blastn -d
>>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>> -e
>>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>> -I T
>>>>>> -o 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>>> #-------------------------------#
>>>>>> deleted:-1 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.bla
>>>>>> st
>>>>>> x
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>>> #-------------------------------#
>>>>>> cleaning blastn...
>>>>>> cleaning tblastx...
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>>> #-------------------------------#
>>>>>> cleaning blastx...
>>>>>> Preparing evidence for hint based annotation
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:15 j_size:1
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:15   current i:0
>>>>>> i_size:15   current i:1
>>>>>> i_size:15   current i:2
>>>>>> i_size:15   current i:3
>>>>>> i_size:15   current i:4
>>>>>> i_size:15   current i:5
>>>>>> i_size:15   current i:6
>>>>>> i_size:15   current i:7
>>>>>> i_size:15   current i:8
>>>>>> i_size:15   current i:9
>>>>>> i_size:15   current i:10
>>>>>> i_size:15   current i:11
>>>>>> i_size:15   current i:12
>>>>>> i_size:15   current i:13
>>>>>> i_size:15   current i:14
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:0 j_size:0
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> ...processing 0 of 5
>>>>>> ...processing 1 of 5
>>>>>> ...processing 2 of 5
>>>>>> ...processing 3 of 5
>>>>>> Making transcripts
>>>>>> Processing transcripts into genes
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:3 j_size:1
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:3   current i:0
>>>>>> i_size:3   current i:1
>>>>>> i_size:3   current i:2
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:0 j_size:0
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> now careful_clustering....
>>>>>> getting Pairs
>>>>>> doing single linkage clustering
>>>>>> ...processing 0 of 3
>>>>>> ...processing 1 of 3
>>>>>> Calculating annotation quality statistics
>>>>>> Choosing best annotations
>>>>>> 
>>>>>> 
>>>>>> Maker is now finished!!!
>>>>>> 
>>>>>> Segmentation fault
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> _______________________________________________
>>>>>> maker-devel mailing list
>>>>>> maker-devel at box290.bluehost.com
>>>>>> 
>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>> g
>>>>>> 
>>>>>> _______________________________________________
>>>>>> maker-devel mailing list
>>>>>> maker-devel at box290.bluehost.com
>>>>>> 
>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>> g
>>>>> 
>>>>> 
>>>> 
>>> 
>>> 
>> 
> 
> 




From carsonhh at gmail.com  Tue Jun 19 23:50:03 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:50:03 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <6C911ABF-19AF-4EBB-A990-1ECE85ADD7E3@gmail.com>
Message-ID: <CC06B280.EAF2%carsonhh@gmail.com>

Perfect.  And good to know.

Thanks,
Carson


On 12-06-19 10:48 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey Carson, 
>
>	It seems like there is a bug in Proc-ProcessTable 0.45.  I solved the
>problem by downgraded Proc-ProcessTable from 0.45 to 0.44. I can run 2.25
>without any problems now.
>
>Cheers,
>Alvin
>
>On Jun 20, 2012, at 1:21 AM, Carson Holt wrote:
>
>> Those are wrapped in an END block so they only run when perl exits (I.e.
>> post completion or failure).  If 2.25 is failing it would likely be for
>> another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
>> -debug).  Does it produce any output before failure?
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> 
>> 
>> On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>> 
>>> Hey  Carson,
>>> 
>>> 	I am still using 2.10, because 2.25 get crashed at the beginning. I
>>> think it may be caused by these codes:
>>> 
>>> Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>>> maintainers
>>> Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>>> maintainers"
>>> 
>>> You have added them at the top of the scripts in the new version.
>>> 
>>> Alvin
>>> 
>>> On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>>> 
>>>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant
>>>>MAKER
>>>> version 2.25 (type maker -v to see the version you are using).  The
>>>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>>>> process fails to respond to signals upstream in the code.  The 2.25
>>>> version of MAKER does some extra things that should even further avoid
>>>> the
>>>> need for the call compared to MAKER 2.10.
>>>> 
>>>> Thanks,
>>>> Carson
>>>> 
>>>> 
>>>> 
>>>> 
>>>> 
>>>> 
>>>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>>>> 
>>>>> Hey Carson and Gowthaman,
>>>>> 
>>>>> 	Thanks for your replies! You are right, Carson, the problem caused
>>>>>by
>>>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>>>> dpp_contig_master_datastore_index.log shows that the job has
>>>>>finished.
>>>>> I
>>>>> have installed the newest version of forks and forks::shared. but the
>>>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>>>> program still crashed at last, but it won't hurt.  I have tried the
>>>>>dpp
>>>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>>> genes
>>>>> for dpp, is this number correct? I just want make sure everything
>>>>>works
>>>>> fine and I will begin to use it with my data. Thanks!
>>>>> 
>>>>> Best,
>>>>> Alvin
>>>>> 
>>>>> 
>>>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>>>> 
>>>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>>> fault
>>>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>>>> your
>>>>>> system reaping the perl threads on completion.  You can try
>>>>>> reinstalling
>>>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>>> the
>>>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>>>> really not affecting the output.  MAKER puts the results for each
>>>>>> contig
>>>>>> in a separate folder because some downstream programs like Apollo
>>>>>>can
>>>>>> only
>>>>>> handle one contig at a time.  Use the
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file to see where each contigs output is stored.
>>>>>> 
>>>>>> 
>>>>>> If you want a merged output file for everything, use the merge_gff
>>>>>> script
>>>>>> in maker and give it the
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file and it will assemble a merged output file
>>>>>>for
>>>>>> you.
>>>>>> There are two type of output GFF3 which gives detailed annotation
>>>>>> information and fasta which just produces sequence for each
>>>>>> transcript.
>>>>>> Use fasta_merge to get a merged fasta file for all contigs (giving
>>>>>>it
>>>>>> the
>>>>>> same 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file).  The fiel you are interested will be the
>>>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>>>> 
>>>>>> More information on MAKER's output here -->
>>>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>>>> 
>>>>>> Thanks,
>>>>>> Carson
>>>>>> 
>>>>>> 
>>>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>>>> 
>>>>>>> Hi Alvin,
>>>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>>>> maker
>>>>>>> did finish making the gff file successfully.
>>>>>>> 
>>>>>>> GFFs are actually buried deep down. One possibility is that you
>>>>>>>were
>>>>>>> looking only in parent folders.
>>>>>>> If you have not done already,  you might want to check for gffs at:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re/*/*/*. ie, three levels down your data store.
>>>>>>> 
>>>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>>>> Failed/Finsihed ?
>>>>>>> 
>>>>>>> Gowthaman
>>>>>>> ________________________________________
>>>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>>>> [alvinchen2002 at gmail.com]
>>>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>>>> To: maker-devel at yandell-lab.org
>>>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>>>> 
>>>>>>> Hi,
>>>>>>> 
>>>>>>>     This is my first time to use maker. I have installed everything
>>>>>>> that required by maker, and use the data in "data" folder to test
>>>>>>> this
>>>>>>> program. But I got a "Segmentation fault" message after "Maker is
>>>>>>>now
>>>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have
>>>>>>>a
>>>>>>> clue
>>>>>>> of this?
>>>>>>> 
>>>>>>> Thanks,
>>>>>>> Alvin
>>>>>>> 
>>>>>>> Here is the output of the program:
>>>>>>> 
>>>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>>>> maker_exe.ctl
>>>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>>>> located
>>>>>>> The blast_type 'ncbi' will be used instead.
>>>>>>> 
>>>>>>> A data structure will be created for you at:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re
>>>>>>> 
>>>>>>> To access files for individual sequences use the datastore index:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_m
>>>>>>>as
>>>>>>> te
>>>>>>> r_
>>>>>>> datastore_index.log
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> --Next Contig--
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>#-------------------------------------------------------------------
>>>>>>>--
>>>>>>> Now starting the contig!!
>>>>>>> SeqID: contig-dpp-500-500
>>>>>>> Length: 32156
>>>>>>> 
>>>>>>> 
>>>>>>>#-------------------------------------------------------------------
>>>>>>>--
>>>>>>> 
>>>>>>> 
>>>>>>> running  repeat masker.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::RepeatMasker:
>>>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .0.all.rb -species all -dir
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>>>> #-------------------------------#
>>>>>>> processing output:
>>>>>>> cycle 1
>>>>>>> cycle 2
>>>>>>> cycle 3
>>>>>>> cycle 4
>>>>>>> cycle 5
>>>>>>> cycle 6
>>>>>>> cycle 7
>>>>>>> cycle 8
>>>>>>> cycle 9
>>>>>>> cycle 10
>>>>>>> Generating output...
>>>>>>> masking
>>>>>>> done
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 0.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 1.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 2.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 3.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 4.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 5.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 6.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 7.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 8.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 9.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:5 j_size:3
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:5   current i:0
>>>>>>> i_size:5   current i:1
>>>>>>> i_size:5   current i:2
>>>>>>> i_size:5   current i:3
>>>>>>> i_size:5   current i:4
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastn:
>>>>>>> /usr/bin/blastall -p blastn -d
>>>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>>> -e
>>>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>>> -I T
>>>>>>> -o 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>>>> #-------------------------------#
>>>>>>> deleted:-1 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.b
>>>>>>>la
>>>>>>> st
>>>>>>> x
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> cleaning blastn...
>>>>>>> cleaning tblastx...
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> cleaning blastx...
>>>>>>> Preparing evidence for hint based annotation
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:15 j_size:1
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:15   current i:0
>>>>>>> i_size:15   current i:1
>>>>>>> i_size:15   current i:2
>>>>>>> i_size:15   current i:3
>>>>>>> i_size:15   current i:4
>>>>>>> i_size:15   current i:5
>>>>>>> i_size:15   current i:6
>>>>>>> i_size:15   current i:7
>>>>>>> i_size:15   current i:8
>>>>>>> i_size:15   current i:9
>>>>>>> i_size:15   current i:10
>>>>>>> i_size:15   current i:11
>>>>>>> i_size:15   current i:12
>>>>>>> i_size:15   current i:13
>>>>>>> i_size:15   current i:14
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:0 j_size:0
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> ...processing 0 of 5
>>>>>>> ...processing 1 of 5
>>>>>>> ...processing 2 of 5
>>>>>>> ...processing 3 of 5
>>>>>>> Making transcripts
>>>>>>> Processing transcripts into genes
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:3 j_size:1
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:3   current i:0
>>>>>>> i_size:3   current i:1
>>>>>>> i_size:3   current i:2
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:0 j_size:0
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> now careful_clustering....
>>>>>>> getting Pairs
>>>>>>> doing single linkage clustering
>>>>>>> ...processing 0 of 3
>>>>>>> ...processing 1 of 3
>>>>>>> Calculating annotation quality statistics
>>>>>>> Choosing best annotations
>>>>>>> 
>>>>>>> 
>>>>>>> Maker is now finished!!!
>>>>>>> 
>>>>>>> Segmentation fault
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> _______________________________________________
>>>>>>> maker-devel mailing list
>>>>>>> maker-devel at box290.bluehost.com
>>>>>>> 
>>>>>>> 
>>>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.
>>>>>>>or
>>>>>>> g
>>>>>>> 
>>>>>>> _______________________________________________
>>>>>>> maker-devel mailing list
>>>>>>> maker-devel at box290.bluehost.com
>>>>>>> 
>>>>>>> 
>>>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.
>>>>>>>or
>>>>>>> g
>>>>>> 
>>>>>> 
>>>>> 
>>>> 
>>>> 
>>> 
>> 
>> 
>





From scott at scottcain.net  Fri Jun 22 08:55:56 2012
From: scott at scottcain.net (Scott Cain)
Date: Fri, 22 Jun 2012 10:55:56 -0400
Subject: [maker-devel] Applications open for GMOD Summer School 2012
Message-ID: <CA+JTaoz5z=hMqqpvRogmuTHdOrGBnqNHy510dxH0y68v0u1HNA@mail.gmail.com>

Applications are now being accepted for the 2012 GMOD Summer School
course, a five-day hands-on school aimed at teaching new GMOD
administrators how to install, configure and integrate popular GMOD
Components. The course will be held August 25-29 at the US National
Evolutionary Synthesis Center (NESCent) in Durham, North Carolina.

 https://docs.google.com/a/scottcain.net/spreadsheet/embeddedform?formkey=dG5hNGFiQ3UwYTV2LUZxZW04Qm1yZXc6MQ

These components will be covered at the school:

   Apollo or WebApollo - genome annotation editor
   Chado - biological database schema
   Galaxy - workflow system
   GBrowse - genome viewer
   GBrowse_syn - synteny viewer
   GFF3 - genome annotation file format and tools
   InterMine - biological data mining system
   JBrowse - next generation genome browser
   MAKER - genome annotation pipeline
   Tripal - web front end to Chado databases


The deadline for applying is the end of July 9, 2012. Admission is
competitive and is based on the strength of the application,
especially the statement of interest. The 2011 school had over 70
applicants for the 25 slots. Any application received after deadline
will be automatically placed on the waiting list.

The course requires some knowledge of Linux as a prerequisite. The
registration fee will be $300 (only $60 per day). There will be a
limited number of scholarships available.

Thanks,

Scott Cain

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
Ontario Institute for Cancer Research



From sajeet at gmail.com  Mon Jun 25 18:41:01 2012
From: sajeet at gmail.com (Sajeet Haridas)
Date: Mon, 25 Jun 2012 17:41:01 -0700
Subject: [maker-devel] ERROR: Chunk failed at level 20
Message-ID: <000001cd5334$5c955df0$15c019d0$@com>

Hello,

I am running Maker 2.10 on two versions (using two assembly programs) of a
fungal genome (~33Mbp). While one completes successfully, the other does
not. One of the scaffolds (out of 65) throws the following error.

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Calling translate without a seq argument!
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
STACK: Bio::Tools::CodonTable::translate
/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
STACK: PhatHit_utils::_adjust
/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
STACK: PhatHit_utils::adjust_start_stop
/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
STACK: maker::auto_annotator::load_transcript_struct
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
STACK: maker::auto_annotator::group_transcripts
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
STACK: maker::auto_annotator::annotate_genes
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
STACK: Process::MpiChunk::_go
/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
STACK: Process::MpiChunk::run
/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
STACK: Process::MpiTiers::run_all
/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
STACK: /opt/maker_2.10/bin/maker:276
-----------------------------------------------------------

FATAL ERROR
ERROR: Failed while clustering transcripts into genes for annotations!!

ERROR: Chunk failed at level 20
!!


Any help appreciated.

Thank you,

Sajeet




From carsonhh at gmail.com  Tue Jun 26 08:07:09 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 26 Jun 2012 10:07:09 -0400
Subject: [maker-devel] ERROR: Chunk failed at level 20
In-Reply-To: <000001cd5334$5c955df0$15c019d0$@com>
Message-ID: <CC0F3A2F.ED74%carsonhh@gmail.com>

Have you tried the most current version, 2.25?

Thanks,
Carson


On 12-06-25 8:41 PM, "Sajeet Haridas" <sajeet at gmail.com> wrote:

>Hello,
>
>I am running Maker 2.10 on two versions (using two assembly programs) of a
>fungal genome (~33Mbp). While one completes successfully, the other does
>not. One of the scaffolds (out of 65) throws the following error.
>
>------------- EXCEPTION: Bio::Root::Exception -------------
>MSG: Calling translate without a seq argument!
>STACK: Error::throw
>STACK: Bio::Root::Root::throw
>/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
>STACK: Bio::Tools::CodonTable::translate
>/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
>STACK: PhatHit_utils::_adjust
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
>STACK: PhatHit_utils::adjust_start_stop
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
>STACK: maker::auto_annotator::load_transcript_struct
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
>STACK: maker::auto_annotator::group_transcripts
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
>STACK: maker::auto_annotator::annotate_genes
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
>STACK: Process::MpiChunk::_go
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
>STACK: Process::MpiChunk::run
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
>STACK: Process::MpiTiers::run_all
>/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
>STACK: /opt/maker_2.10/bin/maker:276
>-----------------------------------------------------------
>
>FATAL ERROR
>ERROR: Failed while clustering transcripts into genes for annotations!!
>
>ERROR: Chunk failed at level 20
>!!
>
>
>Any help appreciated.
>
>Thank you,
>
>Sajeet
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From sajeet at gmail.com  Tue Jun 26 11:45:05 2012
From: sajeet at gmail.com (Sajeet Haridas)
Date: Tue, 26 Jun 2012 10:45:05 -0700
Subject: [maker-devel] ERROR: Chunk failed at level 20
In-Reply-To: <CC0F3A2F.ED74%carsonhh@gmail.com>
References: <000001cd5334$5c955df0$15c019d0$@com>
	<CC0F3A2F.ED74%carsonhh@gmail.com>
Message-ID: <000601cd53c3$6bed89f0$43c89dd0$@com>

Thank you.
It seems to work with 2.25.

Sajeet

-----Original Message-----
From: Carson Holt [mailto:carsonhh at gmail.com] 
Sent: June-26-12 7:07 AM
To: Sajeet Haridas; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] ERROR: Chunk failed at level 20

Have you tried the most current version, 2.25?

Thanks,
Carson


On 12-06-25 8:41 PM, "Sajeet Haridas" <sajeet at gmail.com> wrote:

>Hello,
>
>I am running Maker 2.10 on two versions (using two assembly programs) 
>of a fungal genome (~33Mbp). While one completes successfully, the 
>other does not. One of the scaffolds (out of 65) throws the following
error.
>
>------------- EXCEPTION: Bio::Root::Exception -------------
>MSG: Calling translate without a seq argument!
>STACK: Error::throw
>STACK: Bio::Root::Root::throw
>/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
>STACK: Bio::Tools::CodonTable::translate
>/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
>STACK: PhatHit_utils::_adjust
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
>STACK: PhatHit_utils::adjust_start_stop
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
>STACK: maker::auto_annotator::load_transcript_struct
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
>STACK: maker::auto_annotator::group_transcripts
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
>STACK: maker::auto_annotator::annotate_genes
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
>STACK: Process::MpiChunk::_go
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
>STACK: Process::MpiChunk::run
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
>STACK: Process::MpiTiers::run_all
>/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
>STACK: /opt/maker_2.10/bin/maker:276
>-----------------------------------------------------------
>
>FATAL ERROR
>ERROR: Failed while clustering transcripts into genes for annotations!!
>
>ERROR: Chunk failed at level 20
>!!
>
>
>Any help appreciated.
>
>Thank you,
>
>Sajeet
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org






From ranjani at uga.edu  Wed Jun 27 07:49:02 2012
From: ranjani at uga.edu (Sivaranjani Namasivayam)
Date: Wed, 27 Jun 2012 13:49:02 +0000
Subject: [maker-devel] Re-annotation
Message-ID: <A21F03FBB429334EB4D450CC75E8CBF3487DC468@CH1PRD0210MB384.namprd02.prod.outlook.com>

Hi,

I have a quick question about re-annotation. Under the re-annotation section, the provided maker's gff file from a previous run and set est_pass, altest_pass, protein_pass, rm_pass to 1.
I also provided some EST evidence (to the tag est) under the EST evidence section, but I don't see these ESTs being mapped to the genome (no blastn or est2genome) in the output gff files.
Is this expected?

Thanks,
Ranjani
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120627/f10008ce/attachment-0002.html>

From carsonhh at gmail.com  Wed Jun 27 09:43:14 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 27 Jun 2012 11:43:14 -0400
Subject: [maker-devel] Re-annotation
In-Reply-To: <A21F03FBB429334EB4D450CC75E8CBF3487DC468@CH1PRD0210MB384.namprd02.prod.outlook.com>
Message-ID: <CC10A193.EDB9%carsonhh@gmail.com>

If the new ESTs don't map within the threshold parameters set in the
maker_bopt.ctl file, then you would not expect new results.  Don't be
surprised if the new results are just hard to identify within the context of
the ESTs already being passed back through.  If you want to test the new
ESTs, then set est_pass to 0 during your next run and see if there are still
no ESTs.

Thanks,
Carson



From:  Sivaranjani Namasivayam <ranjani at uga.edu>
Date:  Wednesday, 27 June, 2012 9:49 AM
To:  "maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  [maker-devel] Re-annotation

Hi,

I have a quick question about re-annotation. Under the re-annotation
section, the provided maker's gff file from a previous run and set est_pass,
altest_pass, protein_pass, rm_pass to 1.
I also provided some EST evidence (to the tag est) under the EST evidence
section, but I don't see these ESTs being mapped to the genome (no blastn or
est2genome) in the output gff files.
Is this expected?

Thanks,
Ranjani
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120627/4afce4ea/attachment-0002.html>

From lei.liu.conze at slu.se  Wed Jun 27 08:26:35 2012
From: lei.liu.conze at slu.se (Lei Conze Liu)
Date: Wed, 27 Jun 2012 16:26:35 +0200
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
Message-ID: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>

Hi,

I just downloaded the recent version of maker-2.10.tgz but I can not
find the folder "bin" where contains the MAKER executables. Am I missing
something? It would be great if somebody can help me with that.

Greetings,

Lei

From carsonhh at gmail.com  Wed Jun 27 09:51:08 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 27 Jun 2012 11:51:08 -0400
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
Message-ID: <CC10A299.EDC3%carsonhh@gmail.com>

You need to go to the maker/src/ directory and run 'perl Build.PL'.  Then
run './Build install'.

Note that if you are by any chance are using the CPAN module 'local::lib'
on your system which redefines certain Perl installation parameters
affecting CPAN and Module::Build that those changes will cause MAKER (as
well as many other things in Perl) to install to a non-standard location
(in ~/perl5/bin usually) and if that is the case you should use maker
version 2.25 instead of 2.10 to get the install to complete correctly.

Thanks,
Carson





On 12-06-27 10:26 AM, "Lei Conze Liu" <lei.liu.conze at slu.se> wrote:

>Hi,
>
>I just downloaded the recent version of maker-2.10.tgz but I can not
>find the folder "bin" where contains the MAKER executables. Am I missing
>something? It would be great if somebody can help me with that.
>
>Greetings,
>
>Lei
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From lei.liu.conze at slu.se  Wed Jun 27 14:33:04 2012
From: lei.liu.conze at slu.se (Lei Conze Liu)
Date: Wed, 27 Jun 2012 22:33:04 +0200
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
References: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
Message-ID: <11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>

Dear all,

Thank you very much for the quick reply. I appreciate it very much.
I have indeed gone to the maker/src directory and have run 'perl Build.PL' and './Build install', but still misses the 'bin' folder.
As Carson have kindly pointed out that I might run into this kind of problem if I am using CPAN module 'local::lib' which I think I might be. So tomorrow I will try to install the 2.25 version and let you know how it goes.

Many thanks!

Greetings from Sweden

Lei


On 27 Jun 2012, at 16:26, Lei Conze Liu wrote:

Hi,

I just downloaded the recent version of maker-2.10.tgz but I can not
find the folder "bin" where contains the MAKER executables. Am I missing
something? It would be great if somebody can help me with that.

Greetings,

Lei
_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120627/44c08a8c/attachment-0002.html>

From cjfields at illinois.edu  Wed Jun 27 14:41:25 2012
From: cjfields at illinois.edu (Fields, Christopher J)
Date: Wed, 27 Jun 2012 20:41:25 +0000
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>
References: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
	<11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>
Message-ID: <CC9C6F22-A8A4-4AE3-83BE-E0B5D20AD736@illinois.edu>

I got v2.25 working with local::lib myself.  I plan on using that along with a loadable module (via http://modules.sourceforge.net/) to make launching maker as easy as possible (and also allow us to keep separate contained versions on the cluster w/o having to bend over backwards with env settings).

chris

On Jun 27, 2012, at 3:33 PM, Lei Conze Liu wrote:

> Dear all,
> 
> Thank you very much for the quick reply. I appreciate it very much. 
> I have indeed gone to the maker/src directory and have run 'perl Build.PL' and './Build install', but still misses the 'bin' folder.
> As Carson have kindly pointed out that I might run into this kind of problem if I am using CPAN module 'local::lib' which I think I might be. So tomorrow I will try to install the 2.25 version and let you know how it goes. 
> 
> Many thanks!
> 
> Greetings from Sweden
> 
> Lei
> 
> 
> On 27 Jun 2012, at 16:26, Lei Conze Liu wrote:
> 
>> Hi,
>> 
>> I just downloaded the recent version of maker-2.10.tgz but I can not
>> find the folder "bin" where contains the MAKER executables. Am I missing
>> something? It would be great if somebody can help me with that.
>> 
>> Greetings,
>> 
>> Lei
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
> 
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org




From markus.ankenbrand at stud-mail.uni-wuerzburg.de  Thu Jun 28 08:03:20 2012
From: markus.ankenbrand at stud-mail.uni-wuerzburg.de (Markus Ankenbrand)
Date: Thu, 28 Jun 2012 16:03:20 +0200
Subject: [maker-devel] maker-2.24 fails while preparing evidence clusters
Message-ID: <4FEC6428.3010108@stud-mail.uni-wuerzburg.de>

Hi all,

I'm using maker-2.24 to annotate contigs of a procaryotic organism. I'm
only using coding sequences of a reference species as "altest". Without
any obvious reason annotation fails for some contigs. It seems to have
nothing to do with the contig length. I also tried to run maker with
different reference ESTs and GeneMark. Depending on the setup different
contigs fail.

In case of failure, the log is:
...
cleaning clusters....
total clusters:3 now processing 0
   ...processing 0 of 3
   ...processing 1 of 3
total clusters:3 now processing 0
total clusters:3 now processing 0
   ...processing 0 of 2
Can't call method "start" on an undefined valueERROR: Failed while
preparing evidence clusters for annotations
ERROR: Chunk failed at level:0, tier_type:3
FAILED CONTIG:contig1

ERROR: Chunk failed at level:7, tier_type:0
FAILED CONTIG:contig1

--Next Contig--
...

If someone has any idea how to solve this problem, help would be very
much apriciated.

Greetings,
Markus



From fourie.joubert at up.ac.za  Thu Jun 28 09:11:31 2012
From: fourie.joubert at up.ac.za (Fourie Joubert)
Date: Thu, 28 Jun 2012 17:11:31 +0200
Subject: [maker-devel] Advice for optimizing augustus training on fungal
	genome?
Message-ID: <4FEC7423.3050001@up.ac.za>

Hi Everyone

Apologies if this is not the relevant list to mail to.

I am looking for advice in training augustus for a novel fungal genome.

I generated a gene set using CEGMA (below), and have subsequently been 
following the instructions at 
http://www.molecularevolution.org/molevolfiles/exercises/augustus/scipio.html 
and at 
http://www.molecularevolution.org/molevolfiles/exercises/augustus/training.html.

My training set is 339 genes and the test set is 100 genes.

My initial output is below.

It does not improve much with optimize_augustus.

When using the training paramters to predict genes in the genome, I seem 
to only find around 2,000 of the known ~16,000 genes. When I use the 
training data from a distantly related fungus (Neurospora), I get 
roughly the correct number of genes.

I am obviously doing something wrong here... (commands below).

I would really appreciate any advice on where to start looking for 
improvement.

Kindest regards!

Fourie





Augustus commands (Editedmyspecies_parameters.cfg  and setstopCodonExcludedFromCDS  to true.):

>  etraining --species=myspecies genes.gb.train

>  augustus --species=myspecies genes.gb.test | tee firsttest.out

>  grep -A 22 Evaluation firsttest.out

>  optimize_augustus.pl --species=myspecies genes.gb.train

>  etraining --species=myspecies genes.gb.train

>  augustus --species=myspecies genes.gb.test | tee secondtest.out

>  grep -A 22 Evaluation secondtest.out



CEGMA output:

#      Statistics of the completeness of the genome based on 248 CEGs      #

               #Prots  %Completeness  -  #Total  Average  %Ortho

   Complete      240       96.77      -   278     1.16     11.67

    Group 1       64       96.97      -    72     1.12      7.81
    Group 2       54       96.43      -    66     1.22     18.52
    Group 3       58       95.08      -    70     1.21     13.79
    Group 4       64       98.46      -    70     1.09      7.81

    Partial      245       98.79      -   290     1.18     13.88

    Group 1       65       98.48      -    73     1.12      7.69
    Group 2       56      100.00      -    70     1.25     21.43
    Group 3       59       96.72      -    75     1.27     18.64
    Group 4       65      100.00      -    72     1.11      9.23




Augustus output:

*******      Evaluation of gene prediction     *******

---------------------------------------------\

                  | sensitivity | specificity |

---------------------------------------------|

nucleotide level |       0.933 |       0.772 |

---------------------------------------------/

----------------------------------------------------------------------------------------------------------\

            |  #pred |  #anno |      |    FP = false pos. |    FN = false neg. |             |             |

            | total/ | total/ |   TP |--------------------|--------------------| sensitivity | specificity |

            | unique | unique |      | part | ovlp | wrng | part | ovlp | wrng |             |             |

----------------------------------------------------------------------------------------------------------|

            |        |        |      |                229 |                 85 |             |             |

exon level |    475 |    331 |  246 | ------------------ | ------------------ |       0.743 |       0.518 |

            |    475 |    331 |      |   59 |    9 |  161 |   56 |    2 |   27 |             |             |

----------------------------------------------------------------------------------------------------------/

----------------------------------------------------------------------------\

transcript | #pred | #anno |   TP |   FP |   FN | sensitivity | specificity |

----------------------------------------------------------------------------|

gene level |   158 |   100 |   45 |  113 |   55 |        0.45 |       0.285 |

----------------------------------------------------------------------------/




-- 
--------------
Prof Fourie Joubert
Bioinformatics and Computational Biology Unit
Department of Biochemistry
University of Pretoria
fourie.joubert at up.ac.za
http://www.bi.up.ac.za
Tel. +27-12-420-5825
Fax. +27-12-420-5800

-------------------------------------------------------------------------
This message and attachments are subject to a disclaimer. Please refer
to www.it.up.ac.za/documentation/governance/disclaimer/ for full details.




From yogeshp08 at gmail.com  Fri Jun  1 10:56:13 2012
From: yogeshp08 at gmail.com (Yogesh)
Date: Fri, 1 Jun 2012 11:56:13 -0500
Subject: [maker-devel] tblastn Cleanup?
In-Reply-To: <CBDBD0A5.C8CD%carsonhh@gmail.com>
References: <CBDBD0A5.C8CD%carsonhh@gmail.com>
Message-ID: <E782BA7523C145C994B5BE8509009476@gmail.com>

Hi Carson,

Thanks a lot. This is helpful.

Also I wanted to ask how can I follow this up with exonerate polishing. Is there a module in MAKER that can run this separately on my BLAST results?

-Yogesh


On Friday, May 18, 2012 at 9:22 AM, Carson Holt wrote:

> There are several things.  I set several filtering options directly on the BLAST command line.  These are things like maximum intron length, an e-value filter, and simple repeat filtering (called dust filter in NCBI blast and seg filter in WUBLAST).
> 
> I also run repeat masker over the genome first.  This allows simple and complex repeats to be removed before running BLAST (otherwise you get many false alignments).
> 
> Last I filter the results based on percent coverage of the hit to the original database sequence and percent identity.  I think you can set percent identity as a flag in BLAST, but the percent coverage filter is being calculated by MAKER, so to do this outside of MAKER would require that you write your own filtering script to compare the length of the alignment to the length of the sequence in the database.
> 
> I also have an HSP depth overlap filter.  This removes weird low complexity hits that escape repeatmasking.  They show up as multiple HSPs overlapping multiple times in the same region (usually very high numbers like 90 HSPs all 100 bp long in the same region).  I calculate the number of base pairs in the alignment on the hit then divide by the number of base pairs in the query alignment.  If it's greater than 3, I throw the hit out.
> 
> Thanks,
> Carson
> 
> 
> 
> From: Yogesh <yogeshp08 at gmail.com (mailto:yogeshp08 at gmail.com)>
> Date: Tuesday, 15 May, 2012 12:07 PM
> To: <maker-devel at yandell-lab.org (mailto:maker-devel at yandell-lab.org)>
> Subject: [maker-devel] tblastn Cleanup?
> 
> Hello,
> 
> I have a few tblastn alignments with a lot of low quality hits. I have to clean that up. Can you please suggest how Maker pipeline does it? Also can I run it directly on my data without having to go through the whole pipeline?
> 
> Thanks,
> 
> -Yogesh
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/71d95d76/attachment-0003.html>

From carsonhh at gmail.com  Fri Jun  1 11:01:50 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 13:01:50 -0400
Subject: [maker-devel] tblastn Cleanup?
In-Reply-To: <E782BA7523C145C994B5BE8509009476@gmail.com>
Message-ID: <CBEE6CF1.D401%carsonhh@gmail.com>

MAKER does this in the GI library file (function --> GI::polish_exonerate).
You might have to do some coding to modify it to work in your own scripts.
It has multiple dependencies on other MAKER library files including
exonerate::splice_info, Widget::exonerate::est2genome, and
Widget::exonerate::protein2genome.

Thanks,
Carson

From:  Yogesh <yogeshp08 at gmail.com>
Date:  Friday, 1 June, 2012 12:56 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] tblastn Cleanup?

 
Hi Carson,

Thanks a lot. This is helpful.

Also I wanted to ask how can I follow this up with exonerate polishing. Is
there a module in MAKER that can run this separately on my BLAST results?

-Yogesh

  

On Friday, May 18, 2012 at 9:22 AM, Carson Holt wrote:
> 
>  
> There are several things.  I set several filtering options directly on the
> BLAST command line.  These are things like maximum intron length, an e-value
> filter, and simple repeat filtering (called dust filter in NCBI blast and seg
> filter in WUBLAST).
> 
> I also run repeat masker over the genome first.  This allows simple and
> complex repeats to be removed before running BLAST (otherwise you get many
> false alignments).
> 
> Last I filter the results based on percent coverage of the hit to the original
> database sequence and percent identity.  I think you can set percent identity
> as a flag in BLAST, but the percent coverage filter is being calculated by
> MAKER, so to do this outside of MAKER would require that you write your own
> filtering script to compare the length of the alignment to the length of the
> sequence in the database.
> 
> I also have an HSP depth overlap filter.  This removes weird low complexity
> hits that escape repeatmasking.  They show up as multiple HSPs overlapping
> multiple times in the same region (usually very high numbers like 90 HSPs all
> 100 bp long in the same region).  I calculate the number of base pairs in the
> alignment on the hit then divide by the number of base pairs in the query
> alignment.  If it's greater than 3, I throw the hit out.
> 
> Thanks,
> Carson
> 
> 
> 
> From:  Yogesh <yogeshp08 at gmail.com>
> Date:  Tuesday, 15 May, 2012 12:07 PM
> To:  <maker-devel at yandell-lab.org>
> Subject:  [maker-devel] tblastn Cleanup?
> 
>  
> Hello,
> 
> I have a few tblastn alignments with a lot of low quality hits. I have to
> clean that up. Can you please suggest how Maker pipeline does it? Also can I
> run it directly on my data without having to go through the whole pipeline?
> 
> Thanks,
> 
> -Yogesh


-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/e145c056/attachment-0003.html>

From barry.moore at genetics.utah.edu  Fri Jun  1 12:22:56 2012
From: barry.moore at genetics.utah.edu (Barry Moore)
Date: Fri, 1 Jun 2012 12:22:56 -0600
Subject: [maker-devel] Can maker select a gene model based
	on	#algoritham predicted it
In-Reply-To: <CBEB8E25.D097%carsonhh@gmail.com>
References: <CBEB8E25.D097%carsonhh@gmail.com>
Message-ID: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543




-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/1a78f472/attachment-0003.html>

From carsonhh at gmail.com  Fri Jun  1 12:41:53 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 14:41:53 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>
Message-ID: <CBEE8148.D418%carsonhh@gmail.com>

While I could add an option to keep them if there are more than one, the
actual implementation is not as trivial as it seems.  On some organisms like
fungi and oomycetes, the predictions that don't overlap evidence tend to be
similar to each other across predictors, but on other eukaryotes with
difficult and complex intron/exon structure like lamprey or even planaria
about the only time two predictors will produce similar results coorelated
with when there is evidence supporting them, and all the unsupported regions
are messy with weird partial overlaps (sometimes even conflicting reading
frames).  I have a figure in the MAKER2 paper showing how poorly these
algorithms perform on such organisms and how additional evidence based
feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant
non-overlapping proteins recorded at the end of a MAKER run uses a complex
variant of the AED calculation across the alternate predictions to build a
consensus.  So in short it's not exactly as simple as just saying there are
two predictions at a given locus.  It would require some thought (as well as
good documentation), but it could probably be done.

--Carson

From:  Barry Moore <barry.moore at genetics.utah.edu>
Date:  Friday, 1 June, 2012 2:22 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

Carson,

How hard would it be to have maker take an option something like
'require_abinits=2' that would instruct maker to promote predictions that
overlap with (2, 3 or more) other predictions?  Seems like the maker might
have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.
I've got an offline copy of a newer tutorial wiki that is more up to date
than the GMOD version.  It's on a server right now that we've got locked
behind a firewall, but I'm hoping to move that to a public facing server in
the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/a3ab059e/attachment-0003.html>

From carsonhh at gmail.com  Fri Jun  1 12:52:46 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 14:52:46 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8543.D43A%carsonhh@gmail.com>
Message-ID: <CBEE8622.D43F%carsonhh@gmail.com>

One idea related to this.  I could have keep_preds be a floating point value
between 0 and 1.  This would then represent a threshold for an internal
MAKER value called the ab-initio AED (it already exists internally deep in
MAKER).  0 would turn keep_preds off (as it does now), 1 would keep
everything (as it does now), and values in between would allow the user to
dial in the degree of consensus among overlapping predictions when
considering them without evidence.  The ab-initio AED already works similar
to AED, with 0 being perfect concordance and 1 being complete discordance.

--Carson



From:  Carson Holt <carsonhh at gmail.com>
Date:  Friday, 1 June, 2012 2:41 PM
To:  Barry Moore <barry.moore at genetics.utah.edu>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

While I could add an option to keep them if there are more than one, the
actual implementation is not as trivial as it seems.  On some organisms like
fungi and oomycetes, the predictions that don't overlap evidence tend to be
similar to each other across predictors, but on other eukaryotes with
difficult and complex intron/exon structure like lamprey or even planaria
about the only time two predictors will produce similar results coorelated
with when there is evidence supporting them, and all the unsupported regions
are messy with weird partial overlaps (sometimes even conflicting reading
frames).  I have a figure in the MAKER2 paper showing how poorly these
algorithms perform on such organisms and how additional evidence based
feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant
non-overlapping proteins recorded at the end of a MAKER run uses a complex
variant of the AED calculation across the alternate predictions to build a
consensus.  So in short it's not exactly as simple as just saying there are
two predictions at a given locus.  It would require some thought (as well as
good documentation), but it could probably be done.

--Carson

From:  Barry Moore <barry.moore at genetics.utah.edu>
Date:  Friday, 1 June, 2012 2:22 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org>,
"maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Can maker select a gene model based on
#algoritham predicted it

Carson,

How hard would it be to have maker take an option something like
'require_abinits=2' that would instruct maker to promote predictions that
overlap with (2, 3 or more) other predictions?  Seems like the maker might
have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.
I've got an offline copy of a newer tutorial wiki that is more up to date
than the GMOD version.  It's on a server right now that we've got locked
behind a firewall, but I'm hoping to move that to a public facing server in
the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

> It's not an option in exactly the way you are specifying, but there is
> something I usually do for annotation that works well.  I run interproscan
> or rpsblast on the non_overlapping.proteins.fasta file and select just
> those non-overlapping models that have a recognizable protein domain (just
> searching the pfam doamin space is more than sufficient).  Then I provide
> the selected results to model_gff, and provide the previous maker results
> to the maker_gff option with (all reannotation pass options set to 1 and
> all analysis options turned off).  This adds models with at least
> recognizable domains (as even multiple gene predictors can overpredict in
> a similar way).
> 
> Attached is a script to help select predictions and upgrade them to models
> in GFF3 format.  If you have question let me know.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
> 
> <gff3_preds2models>_______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/11d85f8f/attachment-0003.html>

From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 13:06:30 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:06:30 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8148.D418%carsonhh@gmail.com>
References: <83C45468-752F-443D-BAA2-F44CACCB2C53@genetics.utah.edu>,
	<CBEE8148.D418%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F903@mail02.sbri.org>

Hi Carson,
I agree with you mostly. Its better to have some form of evidence (blast, pfam etc) to call something as a coding gene. Genes that dont have evidence are hard to interpret anyway. But, in the organism we work on (Malaria and Leishmania parasites) we tend to see 100s of genus specific genes. Of course, as you would suspect, their biological/functional significance is not known. They remain as hypothetical proteins for years. But, the researchers still would like to lean towards slight over prediction over under prediction. 

Here is the approach i follow. I collect NON redundant set of proteins from all the related genus to supply as evidence in Maker. I run Augustus and Genemark inside Maker. Also supply gene models from another ab-initio gene prediction suite (automagi-our parasite specific). Automagi in-trun runs 3 algorithm and chooses a consensus gene model.  In short i run 5 gene predictors and chose anything that is predicted by 3. And predictions need NOT overlap to their entire length (this helps us to pull genes that are separated into two due to frame shifts). 

Yesterday, I wrote a small script, that takes all features predicted by MAKER compares them with 3 gffs (of Automagi=3, Augustus, Genemark). I keep_pred=1. It counts if a Maker chosen gene overlaps with prediction from at least 3 of 5 algorithms.

Hi Barry,
Thanks for letting me contribute to the wiki. Most of the edits i thought of is from discussing with Carson. I thought, doing so will save him bit more time from emailing in future. Its possible you got most of it already in latest wiki.  Something like, how to train Genemark. Its really hard to find it in their documentation. I learned it from one of Carson's earlier discussion.  My two cents.

Thanks,
Gowthaman

Carson: Thanks for the great tool. And thanks for every GREATER support. 

  
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 11:41 AM
To: Barry Moore
Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

While I could add an option to keep them if there are more than one, the actual implementation is not as trivial as it seems.  On some organisms like fungi and oomycetes, the predictions that don't overlap evidence tend to be similar to each other across predictors, but on other eukaryotes with difficult and complex intron/exon structure like lamprey or even planaria about the only time two predictors will produce similar results coorelated with when there is evidence supporting them, and all the unsupported regions are messy with weird partial overlaps (sometimes even conflicting reading frames).  I have a figure in the MAKER2 paper showing how poorly these algorithms perform on such organisms and how additional evidence based feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant non-overlapping proteins recorded at the end of a MAKER run uses a complex variant of the AED calculation across the alternate predictions to build a consensus.  So in short it's not exactly as simple as just saying there are two predictions at a given locus.  It would require some thought (as well as good documentation), but it could probably be done.

--Carson

From: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Date: Friday, 1 June, 2012 2:22 PM
To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

It's not an option in exactly the way you are specifying, but there is
something I usually do for annotation that works well.  I run interproscan
or rpsblast on the non_overlapping.proteins.fasta file and select just
those non-overlapping models that have a recognizable protein domain (just
searching the pfam doamin space is more than sufficient).  Then I provide
the selected results to model_gff, and provide the previous maker results
to the maker_gff option with (all reannotation pass options set to 1 and
all analysis options turned off).  This adds models with at least
recognizable domains (as even multiple gene predictors can overpredict in
a similar way).

Attached is a script to help select predictions and upgrade them to models
in GFF3 format.  If you have question let me know.

Thanks,
Carson



On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>> wrote:

Hi Carson,
Thanks for all the help during the long weekend, in spite of that long
drive. I am still trying to imagine that.

I now have maker to consider our own prediction via pred_gff, and use
augustus and gene mark (with our training model). And i was able to use
altest and protein evidences. Maker happily picks one gene model when
there is a overlap between three different predictions. But, when I look
at the gff, it seems like it picks a gene model only when there is an
est/protein evidence. It leaves out some genes even though, they are
predicted by all three algorithms. Of course, keep_pred=1 helps to keep
all the models. This kind of leads to over prediction.

But, I am looking for something in between. And would like to know if
that is possible?
1) Pick a gene model if it has an evidence from (est/prot etc...)
irrespective of how many algorithms predicted it
2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
if that is predicted by at least two algorithms.

Or even simpler:
I have ab-initio predictions from three algorithms, Can I output, those
genes that is supported by at least two of them. I care less about
exactness of gene boundaries.

Thanks,
Gowthaman

PS: With my recent attempts, i learned couple things about maker/other
associated tools that is not documented in gmod-maker wiki. Is it
possible/ok if I add contents to it. I am okay with running it by you
before making it public.

<gff3_preds2models>_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543






From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 13:07:18 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:07:18 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8622.D43F%carsonhh@gmail.com>
References: <CBEE8543.D43A%carsonhh@gmail.com>,
	<CBEE8622.D43F%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>

That sounds really good. 

Just wondering what would that float point mean? 

fraction of gene prediction algorithms predicted that region to contain a gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms predicted it?? 
Or 
it just indicates lever of concordance (in maker language) and user has to try different values before settling on one?

Thanks,
gowthaman
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 11:52 AM
To: Barry Moore
Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

One idea related to this.  I could have keep_preds be a floating point value between 0 and 1.  This would then represent a threshold for an internal MAKER value called the ab-initio AED (it already exists internally deep in MAKER).  0 would turn keep_preds off (as it does now), 1 would keep everything (as it does now), and values in between would allow the user to dial in the degree of consensus among overlapping predictions when considering them without evidence.  The ab-initio AED already works similar to AED, with 0 being perfect concordance and 1 being complete discordance.

--Carson



From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Date: Friday, 1 June, 2012 2:41 PM
To: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

While I could add an option to keep them if there are more than one, the actual implementation is not as trivial as it seems.  On some organisms like fungi and oomycetes, the predictions that don't overlap evidence tend to be similar to each other across predictors, but on other eukaryotes with difficult and complex intron/exon structure like lamprey or even planaria about the only time two predictors will produce similar results coorelated with when there is evidence supporting them, and all the unsupported regions are messy with weird partial overlaps (sometimes even conflicting reading frames).  I have a figure in the MAKER2 paper showing how poorly these algorithms perform on such organisms and how additional evidence based feedback provided by MAKER produces dramatically improved results.

The way I get around the issues when choosing the non-redundant non-overlapping proteins recorded at the end of a MAKER run uses a complex variant of the AED calculation across the alternate predictions to build a consensus.  So in short it's not exactly as simple as just saying there are two predictions at a given locus.  It would require some thought (as well as good documentation), but it could probably be done.

--Carson

From: Barry Moore <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
Date: Friday, 1 June, 2012 2:22 PM
To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
Cc: Gowthaman Ramasamy <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>>, "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>" <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

Carson,

How hard would it be to have maker take an option something like 'require_abinits=2' that would instruct maker to promote predictions that overlap with (2, 3 or more) other predictions?  Seems like the maker might have all that info in one place at some point already?

Gowthaman, your contributions to the maker tutorial would be most welcome.  I've got an offline copy of a newer tutorial wiki that is more up to date than the GMOD version.  It's on a server right now that we've got locked behind a firewall, but I'm hoping to move that to a public facing server in the next week and I'd be happy to give you an account on the wiki.

B

On May 30, 2012, at 6:54 AM, Carson Holt wrote:

It's not an option in exactly the way you are specifying, but there is
something I usually do for annotation that works well.  I run interproscan
or rpsblast on the non_overlapping.proteins.fasta file and select just
those non-overlapping models that have a recognizable protein domain (just
searching the pfam doamin space is more than sufficient).  Then I provide
the selected results to model_gff, and provide the previous maker results
to the maker_gff option with (all reannotation pass options set to 1 and
all analysis options turned off).  This adds models with at least
recognizable domains (as even multiple gene predictors can overpredict in
a similar way).

Attached is a script to help select predictions and upgrade them to models
in GFF3 format.  If you have question let me know.

Thanks,
Carson



On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebiomed.org>> wrote:

Hi Carson,
Thanks for all the help during the long weekend, in spite of that long
drive. I am still trying to imagine that.

I now have maker to consider our own prediction via pred_gff, and use
augustus and gene mark (with our training model). And i was able to use
altest and protein evidences. Maker happily picks one gene model when
there is a overlap between three different predictions. But, when I look
at the gff, it seems like it picks a gene model only when there is an
est/protein evidence. It leaves out some genes even though, they are
predicted by all three algorithms. Of course, keep_pred=1 helps to keep
all the models. This kind of leads to over prediction.

But, I am looking for something in between. And would like to know if
that is possible?
1) Pick a gene model if it has an evidence from (est/prot etc...)
irrespective of how many algorithms predicted it
2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
if that is predicted by at least two algorithms.

Or even simpler:
I have ab-initio predictions from three algorithms, Can I output, those
genes that is supported by at least two of them. I care less about
exactness of gene boundaries.

Thanks,
Gowthaman

PS: With my recent attempts, i learned couple things about maker/other
associated tools that is not documented in gmod-maker wiki. Is it
possible/ok if I add contents to it. I am okay with running it by you
before making it public.

<gff3_preds2models>_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543







From carsonhh at gmail.com  Fri Jun  1 13:23:59 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 01 Jun 2012 15:23:59 -0400
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>
Message-ID: <CBEE8C00.D465%carsonhh@gmail.com>

The metric AED is Annotation Edit Distance (original paper -->
http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
the sensitivity/specificity measure used to quantify the performance of
gene predictors and can be used to measure changes in gene models across
releases, and I further adapted use it for some slightly different purpose
than given in the original paper above.

This is copied from the MAKER2 paper -->
"Given a gene prediction i and a reference j, the base pair level
sensitivity can be calculated using the formula SN = |i?j|/|j|; where
|i?j| represents the number overlapping nucleotides between i and j, and
|j| represents the total number of nucleotides in the reference j.
Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
and accuracy is the average of the two.  Because we are not comparing to a
high quality reference (reference is arbitrary for AED), it is more
correct to refer to the average of sensitivity and specificity as the
congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
distance between i and j, then becomes D = 1-C, with a value of 0
indicating complete agreement of an annotation to the evidence, and values
at or near 1 indicating disagreement or no evidence support."



The ab-initio AED in comparison is the pairwise AED calculated between
each overlapping prediction and then averaged.  Each pair then have a
score representing it's average distance from the overlapping set of
predictions as a whole.  So a value of .1 would be 10% average
incongruency or 90% average congruency.

Thanks,
Carson



On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>That sounds really good.
>
>Just wondering what would that float point mean?
>
>fraction of gene prediction algorithms predicted that region to contain a
>gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>predicted it?? 
>Or 
>it just indicates lever of concordance (in maker language) and user has
>to try different values before settling on one?
>
>Thanks,
>gowthaman
>________________________________________
>From: Carson Holt [carsonhh at gmail.com]
>Sent: Friday, June 01, 2012 11:52 AM
>To: Barry Moore
>Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>One idea related to this.  I could have keep_preds be a floating point
>value between 0 and 1.  This would then represent a threshold for an
>internal MAKER value called the ab-initio AED (it already exists
>internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>1 would keep everything (as it does now), and values in between would
>allow the user to dial in the degree of consensus among overlapping
>predictions when considering them without evidence.  The ab-initio AED
>already works similar to AED, with 0 being perfect concordance and 1
>being complete discordance.
>
>--Carson
>
>
>
>From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Date: Friday, 1 June, 2012 2:41 PM
>To: Barry Moore 
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>, 
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>While I could add an option to keep them if there are more than one, the
>actual implementation is not as trivial as it seems.  On some organisms
>like fungi and oomycetes, the predictions that don't overlap evidence
>tend to be similar to each other across predictors, but on other
>eukaryotes with difficult and complex intron/exon structure like lamprey
>or even planaria about the only time two predictors will produce similar
>results coorelated with when there is evidence supporting them, and all
>the unsupported regions are messy with weird partial overlaps (sometimes
>even conflicting reading frames).  I have a figure in the MAKER2 paper
>showing how poorly these algorithms perform on such organisms and how
>additional evidence based feedback provided by MAKER produces
>dramatically improved results.
>
>The way I get around the issues when choosing the non-redundant
>non-overlapping proteins recorded at the end of a MAKER run uses a
>complex variant of the AED calculation across the alternate predictions
>to build a consensus.  So in short it's not exactly as simple as just
>saying there are two predictions at a given locus.  It would require some
>thought (as well as good documentation), but it could probably be done.
>
>--Carson
>
>From: Barry Moore 
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Date: Friday, 1 June, 2012 2:22 PM
>To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>, 
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>Carson,
>
>How hard would it be to have maker take an option something like
>'require_abinits=2' that would instruct maker to promote predictions that
>overlap with (2, 3 or more) other predictions?  Seems like the maker
>might have all that info in one place at some point already?
>
>Gowthaman, your contributions to the maker tutorial would be most
>welcome.  I've got an offline copy of a newer tutorial wiki that is more
>up to date than the GMOD version.  It's on a server right now that we've
>got locked behind a firewall, but I'm hoping to move that to a public
>facing server in the next week and I'd be happy to give you an account on
>the wiki.
>
>B
>
>On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>
>It's not an option in exactly the way you are specifying, but there is
>something I usually do for annotation that works well.  I run interproscan
>or rpsblast on the non_overlapping.proteins.fasta file and select just
>those non-overlapping models that have a recognizable protein domain (just
>searching the pfam doamin space is more than sufficient).  Then I provide
>the selected results to model_gff, and provide the previous maker results
>to the maker_gff option with (all reannotation pass options set to 1 and
>all analysis options turned off).  This adds models with at least
>recognizable domains (as even multiple gene predictors can overpredict in
>a similar way).
>
>Attached is a script to help select predictions and upgrade them to models
>in GFF3 format.  If you have question let me know.
>
>Thanks,
>Carson
>
>
>
>On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>> wrote:
>
>Hi Carson,
>Thanks for all the help during the long weekend, in spite of that long
>drive. I am still trying to imagine that.
>
>I now have maker to consider our own prediction via pred_gff, and use
>augustus and gene mark (with our training model). And i was able to use
>altest and protein evidences. Maker happily picks one gene model when
>there is a overlap between three different predictions. But, when I look
>at the gff, it seems like it picks a gene model only when there is an
>est/protein evidence. It leaves out some genes even though, they are
>predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>all the models. This kind of leads to over prediction.
>
>But, I am looking for something in between. And would like to know if
>that is possible?
>1) Pick a gene model if it has an evidence from (est/prot etc...)
>irrespective of how many algorithms predicted it
>2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>if that is predicted by at least two algorithms.
>
>Or even simpler:
>I have ab-initio predictions from three algorithms, Can I output, those
>genes that is supported by at least two of them. I care less about
>exactness of gene boundaries.
>
>Thanks,
>Gowthaman
>
>PS: With my recent attempts, i learned couple things about maker/other
>associated tools that is not documented in gmod-maker wiki. Is it
>possible/ok if I add contents to it. I am okay with running it by you
>before making it public.
>
><gff3_preds2models>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>Barry Moore
>Research Scientist
>Dept. of Human Genetics
>University of Utah
>Salt Lake City, UT 84112
>--------------------------------------------
>(801) 585-3543
>
>
>
>





From gowthaman.ramasamy at seattlebiomed.org  Fri Jun  1 13:28:21 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Fri, 1 Jun 2012 12:28:21 -0700
Subject: [maker-devel] Can maker select a gene model based on
 #algoritham predicted it
In-Reply-To: <CBEE8C00.D465%carsonhh@gmail.com>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F904@mail02.sbri.org>,
	<CBEE8C00.D465%carsonhh@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F906@mail02.sbri.org>

That sounds really neat. I will read those papers. Thanks for sharing.

Gowthaman
________________________________________
From: Carson Holt [carsonhh at gmail.com]
Sent: Friday, June 01, 2012 12:23 PM
To: Gowthaman Ramasamy; Barry Moore
Cc: maker-devel at yandell-lab.org
Subject: Re: [maker-devel] Can maker select a gene model based on #algoritham predicted it

The metric AED is Annotation Edit Distance (original paper -->
http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
the sensitivity/specificity measure used to quantify the performance of
gene predictors and can be used to measure changes in gene models across
releases, and I further adapted use it for some slightly different purpose
than given in the original paper above.

This is copied from the MAKER2 paper -->
"Given a gene prediction i and a reference j, the base pair level
sensitivity can be calculated using the formula SN = |i?j|/|j|; where
|i?j| represents the number overlapping nucleotides between i and j, and
|j| represents the total number of nucleotides in the reference j.
Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
and accuracy is the average of the two.  Because we are not comparing to a
high quality reference (reference is arbitrary for AED), it is more
correct to refer to the average of sensitivity and specificity as the
congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
distance between i and j, then becomes D = 1-C, with a value of 0
indicating complete agreement of an annotation to the evidence, and values
at or near 1 indicating disagreement or no evidence support."



The ab-initio AED in comparison is the pairwise AED calculated between
each overlapping prediction and then averaged.  Each pair then have a
score representing it's average distance from the overlapping set of
predictions as a whole.  So a value of .1 would be 10% average
incongruency or 90% average congruency.

Thanks,
Carson



On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>That sounds really good.
>
>Just wondering what would that float point mean?
>
>fraction of gene prediction algorithms predicted that region to contain a
>gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>predicted it??
>Or
>it just indicates lever of concordance (in maker language) and user has
>to try different values before settling on one?
>
>Thanks,
>gowthaman
>________________________________________
>From: Carson Holt [carsonhh at gmail.com]
>Sent: Friday, June 01, 2012 11:52 AM
>To: Barry Moore
>Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>One idea related to this.  I could have keep_preds be a floating point
>value between 0 and 1.  This would then represent a threshold for an
>internal MAKER value called the ab-initio AED (it already exists
>internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>1 would keep everything (as it does now), and values in between would
>allow the user to dial in the degree of consensus among overlapping
>predictions when considering them without evidence.  The ab-initio AED
>already works similar to AED, with 0 being perfect concordance and 1
>being complete discordance.
>
>--Carson
>
>
>
>From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Date: Friday, 1 June, 2012 2:41 PM
>To: Barry Moore
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>,
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>While I could add an option to keep them if there are more than one, the
>actual implementation is not as trivial as it seems.  On some organisms
>like fungi and oomycetes, the predictions that don't overlap evidence
>tend to be similar to each other across predictors, but on other
>eukaryotes with difficult and complex intron/exon structure like lamprey
>or even planaria about the only time two predictors will produce similar
>results coorelated with when there is evidence supporting them, and all
>the unsupported regions are messy with weird partial overlaps (sometimes
>even conflicting reading frames).  I have a figure in the MAKER2 paper
>showing how poorly these algorithms perform on such organisms and how
>additional evidence based feedback provided by MAKER produces
>dramatically improved results.
>
>The way I get around the issues when choosing the non-redundant
>non-overlapping proteins recorded at the end of a MAKER run uses a
>complex variant of the AED calculation across the alternate predictions
>to build a consensus.  So in short it's not exactly as simple as just
>saying there are two predictions at a given locus.  It would require some
>thought (as well as good documentation), but it could probably be done.
>
>--Carson
>
>From: Barry Moore
><barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>Date: Friday, 1 June, 2012 2:22 PM
>To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>Cc: Gowthaman Ramasamy
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>>,
>"maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
><maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>Subject: Re: [maker-devel] Can maker select a gene model based on
>#algoritham predicted it
>
>Carson,
>
>How hard would it be to have maker take an option something like
>'require_abinits=2' that would instruct maker to promote predictions that
>overlap with (2, 3 or more) other predictions?  Seems like the maker
>might have all that info in one place at some point already?
>
>Gowthaman, your contributions to the maker tutorial would be most
>welcome.  I've got an offline copy of a newer tutorial wiki that is more
>up to date than the GMOD version.  It's on a server right now that we've
>got locked behind a firewall, but I'm hoping to move that to a public
>facing server in the next week and I'd be happy to give you an account on
>the wiki.
>
>B
>
>On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>
>It's not an option in exactly the way you are specifying, but there is
>something I usually do for annotation that works well.  I run interproscan
>or rpsblast on the non_overlapping.proteins.fasta file and select just
>those non-overlapping models that have a recognizable protein domain (just
>searching the pfam doamin space is more than sufficient).  Then I provide
>the selected results to model_gff, and provide the previous maker results
>to the maker_gff option with (all reannotation pass options set to 1 and
>all analysis options turned off).  This adds models with at least
>recognizable domains (as even multiple gene predictors can overpredict in
>a similar way).
>
>Attached is a script to help select predictions and upgrade them to models
>in GFF3 format.  If you have question let me know.
>
>Thanks,
>Carson
>
>
>
>On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
><gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>med.org>> wrote:
>
>Hi Carson,
>Thanks for all the help during the long weekend, in spite of that long
>drive. I am still trying to imagine that.
>
>I now have maker to consider our own prediction via pred_gff, and use
>augustus and gene mark (with our training model). And i was able to use
>altest and protein evidences. Maker happily picks one gene model when
>there is a overlap between three different predictions. But, when I look
>at the gff, it seems like it picks a gene model only when there is an
>est/protein evidence. It leaves out some genes even though, they are
>predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>all the models. This kind of leads to over prediction.
>
>But, I am looking for something in between. And would like to know if
>that is possible?
>1) Pick a gene model if it has an evidence from (est/prot etc...)
>irrespective of how many algorithms predicted it
>2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>if that is predicted by at least two algorithms.
>
>Or even simpler:
>I have ab-initio predictions from three algorithms, Can I output, those
>genes that is supported by at least two of them. I care less about
>exactness of gene boundaries.
>
>Thanks,
>Gowthaman
>
>PS: With my recent attempts, i learned couple things about maker/other
>associated tools that is not documented in gmod-maker wiki. Is it
>possible/ok if I add contents to it. I am okay with running it by you
>before making it public.
>
><gff3_preds2models>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>Barry Moore
>Research Scientist
>Dept. of Human Genetics
>University of Utah
>Salt Lake City, UT 84112
>--------------------------------------------
>(801) 585-3543
>
>
>
>





From barry.moore at genetics.utah.edu  Fri Jun  1 14:39:25 2012
From: barry.moore at genetics.utah.edu (Barry Moore)
Date: Fri, 1 Jun 2012 14:39:25 -0600
Subject: [maker-devel] Can maker select a gene model based on
	#algoritham predicted it
In-Reply-To: <CBEE8C00.D465%carsonhh@gmail.com>
References: <CBEE8C00.D465%carsonhh@gmail.com>
Message-ID: <B876750E-47CD-4DEC-81F1-5E5EC5F6B754@genetics.utah.edu>

I like this a lot Carson - for two reasons:  First, it sounds like it's fairly easy to implement with that data and code that already exists within MAKER! And second it sounds like the right way to be doing this - the more the abintis agree the more likely to they are to be correct.

B

On Jun 1, 2012, at 1:23 PM, Carson Holt wrote:

> The metric AED is Annotation Edit Distance (original paper -->
> http://www.biomedcentral.com/1471-2105/10/67).  It's roughly related to
> the sensitivity/specificity measure used to quantify the performance of
> gene predictors and can be used to measure changes in gene models across
> releases, and I further adapted use it for some slightly different purpose
> than given in the original paper above.
> 
> This is copied from the MAKER2 paper -->
> "Given a gene prediction i and a reference j, the base pair level
> sensitivity can be calculated using the formula SN = |i?j|/|j|; where
> |i?j| represents the number overlapping nucleotides between i and j, and
> |j| represents the total number of nucleotides in the reference j.
> Alternatively, specificity is calculated using the formula SP = |i?j|/|i|,
> and accuracy is the average of the two.  Because we are not comparing to a
> high quality reference (reference is arbitrary for AED), it is more
> correct to refer to the average of sensitivity and specificity as the
> congruency rather than accuracy; where C = (SN+SP)/2. The incongruency, or
> distance between i and j, then becomes D = 1-C, with a value of 0
> indicating complete agreement of an annotation to the evidence, and values
> at or near 1 indicating disagreement or no evidence support."
> 
> 
> 
> The ab-initio AED in comparison is the pairwise AED calculated between
> each overlapping prediction and then averaged.  Each pair then have a
> score representing it's average distance from the overlapping set of
> predictions as a whole.  So a value of .1 would be 10% average
> incongruency or 90% average congruency.
> 
> Thanks,
> Carson
> 
> 
> 
> On 12-06-01 3:07 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> That sounds really good.
>> 
>> Just wondering what would that float point mean?
>> 
>> fraction of gene prediction algorithms predicted that region to contain a
>> gene (irrespective of boundaries matching) so 0.2 means 20% of algorithms
>> predicted it?? 
>> Or 
>> it just indicates lever of concordance (in maker language) and user has
>> to try different values before settling on one?
>> 
>> Thanks,
>> gowthaman
>> ________________________________________
>> From: Carson Holt [carsonhh at gmail.com]
>> Sent: Friday, June 01, 2012 11:52 AM
>> To: Barry Moore
>> Cc: Gowthaman Ramasamy; maker-devel at yandell-lab.org
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> One idea related to this.  I could have keep_preds be a floating point
>> value between 0 and 1.  This would then represent a threshold for an
>> internal MAKER value called the ab-initio AED (it already exists
>> internally deep in MAKER).  0 would turn keep_preds off (as it does now),
>> 1 would keep everything (as it does now), and values in between would
>> allow the user to dial in the degree of consensus among overlapping
>> predictions when considering them without evidence.  The ab-initio AED
>> already works similar to AED, with 0 being perfect concordance and 1
>> being complete discordance.
>> 
>> --Carson
>> 
>> 
>> 
>> From: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>> Date: Friday, 1 June, 2012 2:41 PM
>> To: Barry Moore 
>> <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>> Cc: Gowthaman Ramasamy
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>>, 
>> "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
>> <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> While I could add an option to keep them if there are more than one, the
>> actual implementation is not as trivial as it seems.  On some organisms
>> like fungi and oomycetes, the predictions that don't overlap evidence
>> tend to be similar to each other across predictors, but on other
>> eukaryotes with difficult and complex intron/exon structure like lamprey
>> or even planaria about the only time two predictors will produce similar
>> results coorelated with when there is evidence supporting them, and all
>> the unsupported regions are messy with weird partial overlaps (sometimes
>> even conflicting reading frames).  I have a figure in the MAKER2 paper
>> showing how poorly these algorithms perform on such organisms and how
>> additional evidence based feedback provided by MAKER produces
>> dramatically improved results.
>> 
>> The way I get around the issues when choosing the non-redundant
>> non-overlapping proteins recorded at the end of a MAKER run uses a
>> complex variant of the AED calculation across the alternate predictions
>> to build a consensus.  So in short it's not exactly as simple as just
>> saying there are two predictions at a given locus.  It would require some
>> thought (as well as good documentation), but it could probably be done.
>> 
>> --Carson
>> 
>> From: Barry Moore 
>> <barry.moore at genetics.utah.edu<mailto:barry.moore at genetics.utah.edu>>
>> Date: Friday, 1 June, 2012 2:22 PM
>> To: Carson Holt <carsonhh at gmail.com<mailto:carsonhh at gmail.com>>
>> Cc: Gowthaman Ramasamy
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>>, 
>> "maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>"
>> <maker-devel at yandell-lab.org<mailto:maker-devel at yandell-lab.org>>
>> Subject: Re: [maker-devel] Can maker select a gene model based on
>> #algoritham predicted it
>> 
>> Carson,
>> 
>> How hard would it be to have maker take an option something like
>> 'require_abinits=2' that would instruct maker to promote predictions that
>> overlap with (2, 3 or more) other predictions?  Seems like the maker
>> might have all that info in one place at some point already?
>> 
>> Gowthaman, your contributions to the maker tutorial would be most
>> welcome.  I've got an offline copy of a newer tutorial wiki that is more
>> up to date than the GMOD version.  It's on a server right now that we've
>> got locked behind a firewall, but I'm hoping to move that to a public
>> facing server in the next week and I'd be happy to give you an account on
>> the wiki.
>> 
>> B
>> 
>> On May 30, 2012, at 6:54 AM, Carson Holt wrote:
>> 
>> It's not an option in exactly the way you are specifying, but there is
>> something I usually do for annotation that works well.  I run interproscan
>> or rpsblast on the non_overlapping.proteins.fasta file and select just
>> those non-overlapping models that have a recognizable protein domain (just
>> searching the pfam doamin space is more than sufficient).  Then I provide
>> the selected results to model_gff, and provide the previous maker results
>> to the maker_gff option with (all reannotation pass options set to 1 and
>> all analysis options turned off).  This adds models with at least
>> recognizable domains (as even multiple gene predictors can overpredict in
>> a similar way).
>> 
>> Attached is a script to help select predictions and upgrade them to models
>> in GFF3 format.  If you have question let me know.
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> On 12-05-29 5:54 PM, "Gowthaman Ramasamy"
>> <gowthaman.ramasamy at seattlebiomed.org<mailto:gowthaman.ramasamy at seattlebio
>> med.org>> wrote:
>> 
>> Hi Carson,
>> Thanks for all the help during the long weekend, in spite of that long
>> drive. I am still trying to imagine that.
>> 
>> I now have maker to consider our own prediction via pred_gff, and use
>> augustus and gene mark (with our training model). And i was able to use
>> altest and protein evidences. Maker happily picks one gene model when
>> there is a overlap between three different predictions. But, when I look
>> at the gff, it seems like it picks a gene model only when there is an
>> est/protein evidence. It leaves out some genes even though, they are
>> predicted by all three algorithms. Of course, keep_pred=1 helps to keep
>> all the models. This kind of leads to over prediction.
>> 
>> But, I am looking for something in between. And would like to know if
>> that is possible?
>> 1) Pick a gene model if it has an evidence from (est/prot etc...)
>> irrespective of how many algorithms predicted it
>> 2) In the absence of extrinsic evidence (est/prot etc), pick a gene model
>> if that is predicted by at least two algorithms.
>> 
>> Or even simpler:
>> I have ab-initio predictions from three algorithms, Can I output, those
>> genes that is supported by at least two of them. I care less about
>> exactness of gene boundaries.
>> 
>> Thanks,
>> Gowthaman
>> 
>> PS: With my recent attempts, i learned couple things about maker/other
>> associated tools that is not documented in gmod-maker wiki. Is it
>> possible/ok if I add contents to it. I am okay with running it by you
>> before making it public.
>> 
>> <gff3_preds2models>_______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> Barry Moore
>> Research Scientist
>> Dept. of Human Genetics
>> University of Utah
>> Salt Lake City, UT 84112
>> --------------------------------------------
>> (801) 585-3543
>> 
>> 
>> 
>> 
> 
> 

Barry Moore
Research Scientist
Dept. of Human Genetics
University of Utah
Salt Lake City, UT 84112
--------------------------------------------
(801) 585-3543




-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120601/c444140d/attachment-0003.html>

From weckalba at asu.edu  Mon Jun  4 11:41:14 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Mon, 4 Jun 2012 10:41:14 -0700
Subject: [maker-devel] question regarding alternate splicing annotation
Message-ID: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>

Hi Maker developers,

I am trying to expand on some current annotations that are already quite
good, but only predict protein coding sequence and one isoform per gene, to
add UTRs and alternative splice forms from cufflinks data.  To do this I
put the current annotations in both the model_gff and pred_gff field, plus
the cufflinks gff3 for the ests (as I noticed was suggested in a previous
email).  I've left everything else as default, except changing
alt_splice=1. I am watching the progress of the *.gff.ann files, but I'm
not noticing alternate splicing being added, while UTRs are being picked up
(exons being added, etc.).  This is a vertebrate genome, so run times are
fairly long and I just wanted to double check if I wasn't missing
something.  Will maker go back through a second step to annotate
alternative splicing?  Or should I be trying something a little different.

Thanks,

Walter
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120604/80ac7225/attachment-0003.html>

From carsonhh at gmail.com  Mon Jun  4 12:02:19 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Mon, 04 Jun 2012 14:02:19 -0400
Subject: [maker-devel] question regarding alternate splicing annotation
In-Reply-To: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>
Message-ID: <CBF26EB9.D534%carsonhh@gmail.com>

Using GFF3 pass-through options alone won't allow for the alternate splice
prediction to work.  You have to also allow gene predictors like SNAP and
Augustus to run.  MAKER uses mutually exclusive EST data to produce separate
hint files in some cases that can produce alternate splice forms from the ab
initio predictors.  The EST evidence must be very long in general or they
will not produce alternate forms.  These alternate splice model can then
compete against your existing gene models based on scoring statistics MAKER
produces and potentially replace them.  This may not be what you want
though.  The alternate splice prediction works better De Novo than for
re-annotation.

The alternate splicing option still needs more work, but I would appreciate
any feedback.

Thanks,
Carson




From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Monday, 4 June, 2012 1:41 PM
To:  <maker-devel at yandell-lab.org>
Subject:  [maker-devel] question regarding alternate splicing annotation

Hi Maker developers,

I am trying to expand on some current annotations that are already quite
good, but only predict protein coding sequence and one isoform per gene, to
add UTRs and alternative splice forms from cufflinks data.  To do this I put
the current annotations in both the model_gff andusing the gff_field, plus
the cufflinks gff3 for the ests (as I noticed was suggested in a previous
email).  I've left everything else as default, except changing alt_splice=1.
I am watching the progress of the *.gff.ann files, but I'm not noticing
alternate splicing being added, while UTRs are being picked up (exons being
added, etc.).  This is a vertebrate genome, so run times are fairly long and
I just wanted to double check if I wasn't missing something.  Will maker go
back through a second step to annotate alternative splicing?  Or should I be
trying something a little different.

Thanks,

Walter
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120604/01844803/attachment-0003.html>

From weckalba at asu.edu  Mon Jun  4 12:23:18 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Mon, 4 Jun 2012 11:23:18 -0700
Subject: [maker-devel] question regarding alternate splicing annotation
In-Reply-To: <CBF26EB9.D534%carsonhh@gmail.com>
References: <CANRPJScxamceGLvpYJxvvY0a4O=qHccbpx6q49LqiUoamUocbA@mail.gmail.com>
	<CBF26EB9.D534%carsonhh@gmail.com>
Message-ID: <CANRPJSfXK1Py7297bTg3_nQXuUkce4c0WueSM_iYA0MLvXP_OQ@mail.gmail.com>

Hi Carson,

Thanks for the quick reply.  I have already trained SNAP and Augustus based
on the de novo assembly from the same RNA-seq data used to generate the
cufflinks annotations.  Those SNAP and Augustus predictions were part of my
initial annotation, along with the de novo assembled transcripts, previous
reference annotations, and related species protein alignments.  I had
broken this up because of run time issues, and thought it might speed
things along.  I will switch gears to add in the SNAP and Augustus ab
initio predictions.

As you might infer, I have a great deal of formats this transcript data
could come in (ie outputs from cufflinks for each sample, cuffmerge,
tophat, trinity, or raw).  Do you have any suggestions for what might be a
good balance between speed and completeness?  I also can not for life of me
get Maker install on our cluster, but I do have Augustus and SNAP installed
there.  I have a massive amount of RNA-seq data I'm trying to incorporate,
so I'm confident plenty of alternative splicing could be found, but I'm
hitting time issues due to the scale (ie four day wall limit on the cluster
and only having an 8-core in house).

I've tried other programs to do this, but obviously cufflinks gives you way
too much, and I'm finding EVM, while fast, is too happy to shorten gene
models based on partial transcript evidence, which requires way more manual
correction than we are capable of doing.

I'll start with just letting Maker run SNAP and Augustus, and let you know
how it goes.

Walter


On 4 June 2012 11:02, Carson Holt <carsonhh at gmail.com> wrote:

> Using GFF3 pass-through options alone won't allow for the alternate splice
> prediction to work.  You have to also allow gene predictors like SNAP and
> Augustus to run.  MAKER uses mutually exclusive EST data to produce
> separate hint files in some cases that can produce alternate splice forms
> from the ab initio predictors.  The EST evidence must be very long in
> general or they will not produce alternate forms.  These alternate splice
> model can then compete against your existing gene models based on scoring
> statistics MAKER produces and potentially replace them.  This may not be
> what you want though.  The alternate splice prediction works better De Novo
> than for re-annotation.
>
> The alternate splicing option still needs more work, but I would
> appreciate any feedback.
>
> Thanks,
> Carson
>
>
>
>
> From: Walter Eckalbar <weckalba at asu.edu>
> Date: Monday, 4 June, 2012 1:41 PM
> To: <maker-devel at yandell-lab.org>
> Subject: [maker-devel] question regarding alternate splicing annotation
>
> Hi Maker developers,
>
> I am trying to expand on some current annotations that are already quite
> good, but only predict protein coding sequence and one isoform per gene, to
> add UTRs and alternative splice forms from cufflinks data.  To do this I
> put the current annotations in both the model_gff andusing the gff_field,
> plus the cufflinks gff3 for the ests (as I noticed was suggested in a
> previous email).  I've left everything else as default, except changing
> alt_splice=1. I am watching the progress of the *.gff.ann files, but I'm
> not noticing alternate splicing being added, while UTRs are being picked up
> (exons being added, etc.).  This is a vertebrate genome, so run times are
> fairly long and I just wanted to double check if I wasn't missing
> something.  Will maker go back through a second step to annotate
> alternative splicing?  Or should I be trying something a little different.
>
> Thanks,
>
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120604/7e44220c/attachment-0003.html>

From jrliberto at yahoo.com  Wed Jun  6 12:22:46 2012
From: jrliberto at yahoo.com (Jennifer Liberto)
Date: Wed, 6 Jun 2012 11:22:46 -0700 (PDT)
Subject: [maker-devel] MAKER output concerns
Message-ID: <1339006966.41760.YahooMailNeo@web110112.mail.gq1.yahoo.com>

To whom this may concern,
?
I am brand new to MAKER and I am concerned about the output
files that I am receiving.? My
partner and I were able to run the dpp test with no errors, all the files and
directories were accounted for.? However, when we tried to run it on our own small dataset of 5 genes,
and a surfperch genome, we were missing 2 files in the output of every contig:
?
Snig2_XXXXXXX.maker.proteins.fasta
Snig2_XXXXXXX.maker.transcripts.fasta
?
When I look at the run log for each of the contigs, I see that
blastx, blastn, tblastx, augustus, snap, and repeatrunner were called but not
exonerate; I have attached a sample run log with this post. Also, our gff files
contain only short 52 bp repeat sequences (I have attached one of these here as
well in a .txt format) and looks nothing like the gff file we received in out
dpp test.? If you could give any
pointers or hints as to why we are not receiving the two files, why exonerate
is not being called, and why our gff files contain only uniformly small repeat
sequences, the help would be greatly appreciated.? 
?
Thank you for your time,
Jennifer Liberto
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/3394c6ed/attachment-0003.html>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: run.log
Type: application/octet-stream
Size: 5078 bytes
Desc: not available
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/3394c6ed/attachment-0003.obj>
-------------- next part --------------
##gff-version 3
Snig2_1983881	.	contig	1	52	.	.	.	ID=Snig2_1983881;Name=Snig2_1983881;
Snig2_1983881	repeatmasker	match	8	52	405	+	.	ID=Snig2_1983881:hit:14530;Name=species:%28CA%29n%20genus:Simple_repeat;Target=species:%28CA%29n%20genus:Simple_repeat 1 45 +;
Snig2_1983881	repeatmasker	match_part	8	52	405	+	.	ID=Snig2_1983881:hsp:14530;Parent=Snig2_1983881:hit:14530;Name=species:%2528CA%2529n%2520genus:Simple_repeat;Target=species:%2528CA%2529n%2520genus:Simple_repeat 1 45 +;
Snig2_1983881	repeatmasker	match	8	52	405	+	.	ID=Snig2_1983881:hit:14531;Name=species:%28CA%29n%20genus:Simple_repeat;Target=species:%28CA%29n%20genus:Simple_repeat 1 45 +;
Snig2_1983881	repeatmasker	match_part	8	52	405	+	.	ID=Snig2_1983881:hsp:14531;Parent=Snig2_1983881:hit:14531;Name=species:%2528CA%2529n%2520genus:Simple_repeat;Target=species:%2528CA%2529n%2520genus:Simple_repeat 1 45 +;
##FASTA
>Snig2_1983881
TTGGCGCCACACACACACACACACACACACACACACACACACACACACACAC

From carsonhh at gmail.com  Wed Jun  6 12:39:42 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 06 Jun 2012 14:39:42 -0400
Subject: [maker-devel] MAKER output concerns
In-Reply-To: <1339006966.41760.YahooMailNeo@web110112.mail.gq1.yahoo.com>
Message-ID: <CBF51A5C.D620%carsonhh@gmail.com>

Hi Jennifer,

The contig you ran with was only 52 bp in length and contained only
repetitive sequence.  Exonerate only runs if there are BLAST results that
need polishing, which there weren't.
The Snig2_XXXXXXX.maker.proteins.fasta and
Snig2_XXXXXXX.maker.transcripts.fasta were not produced because there were
no proteins or transcripts to report.

In general running on sequence shorter than 10,000 bp isn't useful.  This is
because programs like SNAP and Augustus need sequence flanking the actual
gene to make their calls, and with intron/exon structure you are unlikely to
fully capture a gene (end to end) at random in under 10kb for many
eukaryotic organisms.

If you are trying to use raw reads, you will need to assemble them first
before running MAKER.  Let us know specifically what you are trying to do,
and we can give you pointers on how to proceed.

Thanks,
Carson



From:  Jennifer Liberto <jrliberto at yahoo.com>
Reply-To:  Jennifer Liberto <jrliberto at yahoo.com>
Date:  Wednesday, 6 June, 2012 2:22 PM
To:  "maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  [maker-devel] MAKER output concerns

To whom this may concern,
 
I am brand new to MAKER and I am concerned about the output files that I am
receiving.  My partner and I were able to run the dpp test with no errors,
all the files and directories were accounted for. However, when we tried to
run it on our own small dataset of 5 genes, and a surfperch genome, we were
missing 2 files in the output of every contig:
 
Snig2_XXXXXXX.maker.proteins.fasta
Snig2_XXXXXXX.maker.transcripts.fasta
 
When I look at the run log for each of the contigs, I see that blastx,
blastn, tblastx, augustus, snap, and repeatrunner were called but not
exonerate; I have attached a sample run log with this post. Also, our gff
files contain only short 52 bp repeat sequences (I have attached one of
these here as well in a .txt format) and looks nothing like the gff file we
received in out dpp test.  If you could give any pointers or hints as to why
we are not receiving the two files, why exonerate is not being called, and
why our gff files contain only uniformly small repeat sequences, the help
would be greatly appreciated.
 
Thank you for your time,
Jennifer Liberto
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/237aa6e6/attachment-0003.html>

From gowthaman.ramasamy at seattlebiomed.org  Thu Jun  7 07:36:38 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Thu, 7 Jun 2012 06:36:38 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <CBF61973.D683%carson.holt@oicr.on.ca>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>,
	<CBF61973.D683%carson.holt@oicr.on.ca>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F928@mail02.sbri.org>

Thats a very nice catch. I will adjust parent to Parent and try. 

Its nice idea to run maker first with prok. mode. I will keep that in mind.

Thanks,
Gowtham

_____________________________
From: Carson Holt [Carson.Holt at oicr.on.ca]
Sent: Thursday, June 07, 2012 6:28 AM
To: Gowthaman Ramasamy; maker-devel at yandell-lab.org
Subject: Re: GFF3 file format not accepted by pred_gff options

You have parent= instead of Parent=.  In GFF3, attribute tags are case
sensitive.  Those starting with uppercase letters represent reserved
words, and all others represent ad hoc tags.
The modencode validator would not check parent= for validity because it
sees it as an ad hoc tag (thus not producing an error).

Try changing parent= to some invalid value and compare with what you get
when Parent= is set to an invalid value in the modencode validator, and
you will see what I mean.


The fixed version is attached.


Also the genemark_gtf2gff script was made for converting the GeneMark-ES
output, so I'm not surprised it didn't work on the prokaryote version, but
you should
be fine just by fixing the parent= tag on the conversion you made.  You
could also have run MAKER once in prokaryote mode with the prokaryotic
parameter file to get it to produce a GFF3 for you.

Thanks,
Carson




On 12-06-06 9:53 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Carson,
>As I wrote to you earlier, I was able to successfully create a gff3 file
>from our predictor to be used in pred_gff option. But, now, I am trying
>to add another abinitio prediction (GeneMark-prokaryotic).  For some
>weird reasons,  I would like to run GeneMark-prokaryote and
>Augustus-eukaryotes. So, i am not able to run both inside maker.
>
>But, that gff3 was not used by pred_gff. I tried to make it as similar to
>the working gffs as possible. Still in vein. Would you mind having look
>at the attached gff file. I even run it by gff validator at
>modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All
>passed.
>
>In the maker produced gff i just see one pair of match-matchpart that
>corresponds to entire supercontig from GeneMark. Not corresponding to
>genes.
>
>I really appreciate your time and help.
>
>Gowthaman




From gowthaman.ramasamy at seattlebiomed.org  Wed Jun  6 19:53:20 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Wed, 6 Jun 2012 18:53:20 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>

Hi Carson,
As I wrote to you earlier, I was able to successfully create a gff3 file from our predictor to be used in pred_gff option. But, now, I am trying to add another abinitio prediction (GeneMark-prokaryotic).  For some weird reasons,  I would like to run GeneMark-prokaryote and Augustus-eukaryotes. So, i am not able to run both inside maker.

But, that gff3 was not used by pred_gff. I tried to make it as similar to the working gffs as possible. Still in vein. Would you mind having look at the attached gff file. I even run it by gff validator at modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All passed.

In the maker produced gff i just see one pair of match-matchpart that corresponds to entire supercontig from GeneMark. Not corresponding to genes.

I really appreciate your time and help. 

Gowthaman

-------------- next part --------------
A non-text attachment was scrubbed...
Name: Contig23.GMprok.gff
Type: application/octet-stream
Size: 291755 bytes
Desc: Contig23.GMprok.gff
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/2c5bf543/attachment-0003.obj>

From gowthaman.ramasamy at seattlebiomed.org  Wed Jun  6 19:59:33 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Wed, 6 Jun 2012 18:59:33 -0700
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
References: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F927@mail02.sbri.org>

Carson,
I also tried to use maker's genemart_gtf2gff script to create valid gff3 file. I seem to have problems with it too.
Here is what I see...

-bash-3.2$ ~/software/maker/bin/genemark_gtf2gff3 CrfA_v13.3.5_supercontigs.gff2
ERROR: Cannot understand format
expecting -> gene_id "xxxx"; transcript_id "xxxx";

Attached is first 10000 lines of the GTF output from genemark.

Any help/pointers will be really appreciated.

Thanks again,
Gowthaman
________________________________________
From: Gowthaman Ramasamy
Sent: Wednesday, June 06, 2012 6:53 PM
To: Carson Holt; maker-devel at yandell-lab.org
Subject: GFF3 file format not accepted by pred_gff options

Hi Carson,
As I wrote to you earlier, I was able to successfully create a gff3 file from our predictor to be used in pred_gff option. But, now, I am trying to add another abinitio prediction (GeneMark-prokaryotic).  For some weird reasons,  I would like to run GeneMark-prokaryote and Augustus-eukaryotes. So, i am not able to run both inside maker.

But, that gff3 was not used by pred_gff. I tried to make it as similar to the working gffs as possible. Still in vein. Would you mind having look at the attached gff file. I even run it by gff validator at modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All passed.

In the maker produced gff i just see one pair of match-matchpart that corresponds to entire supercontig from GeneMark. Not corresponding to genes.

I really appreciate your time and help.

Gowthaman
-------------- next part --------------
A non-text attachment was scrubbed...
Name: tiny_genemark-prok.gtf.bz2
Type: application/x-bzip2
Size: 209923 bytes
Desc: tiny_genemark-prok.gtf.bz2
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120606/ace7deee/attachment-0001.bz2>

From Carson.Holt at oicr.on.ca  Thu Jun  7 07:28:06 2012
From: Carson.Holt at oicr.on.ca (Carson Holt)
Date: Thu, 7 Jun 2012 13:28:06 +0000
Subject: [maker-devel] GFF3 file format not accepted by pred_gff options
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F926@mail02.sbri.org>
Message-ID: <CBF61973.D683%carson.holt@oicr.on.ca>

You have parent= instead of Parent=.  In GFF3, attribute tags are case
sensitive.  Those starting with uppercase letters represent reserved
words, and all others represent ad hoc tags.
The modencode validator would not check parent= for validity because it
sees it as an ad hoc tag (thus not producing an error).

Try changing parent= to some invalid value and compare with what you get
when Parent= is set to an invalid value in the modencode validator, and
you will see what I mean.


The fixed version is attached.


Also the genemark_gtf2gff script was made for converting the GeneMark-ES
output, so I'm not surprised it didn't work on the prokaryote version, but
you should 
be fine just by fixing the parent= tag on the conversion you made.  You
could also have run MAKER once in prokaryote mode with the prokaryotic
parameter file to get it to produce a GFF3 for you.

Thanks,
Carson




On 12-06-06 9:53 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Carson,
>As I wrote to you earlier, I was able to successfully create a gff3 file
>from our predictor to be used in pred_gff option. But, now, I am trying
>to add another abinitio prediction (GeneMark-prokaryotic).  For some
>weird reasons,  I would like to run GeneMark-prokaryote and
>Augustus-eukaryotes. So, i am not able to run both inside maker.
>
>But, that gff3 was not used by pred_gff. I tried to make it as similar to
>the working gffs as possible. Still in vein. Would you mind having look
>at the attached gff file. I even run it by gff validator at
>modencode(http://modencode.oicr.on.ca/cgi-bin/validate_gff3_online). All
>passed.
>
>In the maker produced gff i just see one pair of match-matchpart that
>corresponds to entire supercontig from GeneMark. Not corresponding to
>genes.
>
>I really appreciate your time and help.
>
>Gowthaman

-------------- next part --------------
A non-text attachment was scrubbed...
Name: Contig23.GMprok.gff
Type: application/octet-stream
Size: 291755 bytes
Desc: Contig23.GMprok.gff
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120607/685ec79a/attachment-0003.obj>

From weckalba at asu.edu  Thu Jun  7 14:40:20 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Thu, 7 Jun 2012 13:40:20 -0700
Subject: [maker-devel] cluster error running maker
Message-ID: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>

Hi everyone,

I have been retrying installing maker on our university cluster, everything
seems to install correctly, but when I run maker I find the following error
message:

Ran into unknown state (hex char: 29) at
/home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
A data structure will be created for you at:
/scratch/weckalba/Maker/genome.maker.output/genome_datastore

To access files for individual sequences use the datastore index:
/scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log

DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.


Seems to have something to do with permissions and DBD::SQLite.  I
installed DBD::SQLite on my own home directories and routed the perl path
to it (and other CPAN installs in the same directories).

I was wondering if anyone ever encountered this before and knew a work
around.  The admins for our cluster are unfortunately very slow to respond.

Thanks

Walter
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120607/b3459baf/attachment-0003.html>

From carsonhh at gmail.com  Fri Jun  8 06:45:42 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 08 Jun 2012 08:45:42 -0400
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>
Message-ID: <CBF76A49.D740%carsonhh@gmail.com>

Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to Volker
Brendel at Iowa State for this one.

> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
> 646785-and-handle-Hex29.patch
> 
> This adds to previously posted 646785 patch.  At least on some systems,
> commands can contain "(" and ")".  See comments in the code.
> 

Download Proc-ProcessTable-0.45 to reinstall before applying the patch.


I'll also send you a link in a separate e-mail to download a maker 2.26 test
version where I've replaced Proc::ProcessTable with a different module
because of the failure on some systems.

Thanks,
Carson




From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Thursday, 7 June, 2012 4:40 PM
To:  <maker-devel at yandell-lab.org>
Subject:  [maker-devel] cluster error running maker

Hi everyone,

I have been retrying installing maker on our university cluster, everything
seems to install correctly, but when I run maker I find the following error
message:

Ran into unknown state (hex char: 29) at
/home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
A data structure will be created for you at:
/scratch/weckalba/Maker/genome.maker.output/genome_datastore

To access files for individual sequences use the datastore index:
/scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.lo
g

DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
DBD::SQLite::db do failed: disk I/O error at
/home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.


Seems to have something to do with permissions and DBD::SQLite.  I installed
DBD::SQLite on my own home directories and routed the perl path to it (and
other CPAN installs in the same directories).

I was wondering if anyone ever encountered this before and knew a work
around.  The admins for our cluster are unfortunately very slow to respond.

Thanks

Walter
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/87256d43/attachment-0003.html>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: 646785-and-handle-Hex29.patch
Type: application/octet-stream
Size: 4619 bytes
Desc: not available
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/87256d43/attachment-0003.obj>

From weckalba at asu.edu  Fri Jun  8 10:15:38 2012
From: weckalba at asu.edu (Walter Eckalbar)
Date: Fri, 8 Jun 2012 09:15:38 -0700
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CBF76A49.D740%carsonhh@gmail.com>
References: <CANRPJScm_W9fm8qLYy3agt59Ah+nP8eLMqHiWdvu1AJHc-PBMA@mail.gmail.com>
	<CBF76A49.D740%carsonhh@gmail.com>
Message-ID: <CANRPJScgVoFkm2-fO5Y7MUyFngSgMjN71fPJL3tfr5k-dPDDYA@mail.gmail.com>

Hi Carson,

I will try this as well to get my 2.25 version of maker running.

I have hit another error on my local machine.  This only seems to come up
with scaffolds > 5Mbp.  And am hitting this same error with version 2.10
and 2.25.

  [0] = Make
  [1] = 0
  [2] = additional
  [3] = prediction
  [4] = runs.
dead in Widget::augustus::parse_gene unknown feature type:additional
ERROR: Failed while preparing ab-inits
ERROR: Chunk failed at level:4, tier_type:0
FAILED CONTIG:GL343198.1

Do you have a suggestion for this one?

Thanks for all your help,

Walter


On 8 June 2012 05:45, Carson Holt <carsonhh at gmail.com> wrote:

> Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to
> Volker Brendel at Iowa State for this one.
>
> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
> 646785-and-handle-Hex29.patch
>
> This adds to previously posted 646785 patch.  At least on some
> systems, commands can contain "(" and ")".  See comments in the code.
>
>
> Download Proc-ProcessTable-0.45 to reinstall before applying the patch.
>
>
> I'll also send you a link in a separate e-mail to download a maker 2.26
> test version where I've replaced Proc::ProcessTable with a different module
> because of the failure on some systems.
>
> Thanks,
> Carson
>
>
>
>
> From: Walter Eckalbar <weckalba at asu.edu>
> Date: Thursday, 7 June, 2012 4:40 PM
> To: <maker-devel at yandell-lab.org>
> Subject: [maker-devel] cluster error running maker
>
> Hi everyone,
>
> I have been retrying installing maker on our university cluster,
> everything seems to install correctly, but when I run maker I find the
> following error message:
>
> Ran into unknown state (hex char: 29) at
> /home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
> A data structure will be created for you at:
> /scratch/weckalba/Maker/genome.maker.output/genome_datastore
>
> To access files for individual sequences use the datastore index:
>
> /scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log
>
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
> DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.
>
>
> Seems to have something to do with permissions and DBD::SQLite.  I
> installed DBD::SQLite on my own home directories and routed the perl path
> to it (and other CPAN installs in the same directories).
>
> I was wondering if anyone ever encountered this before and knew a work
> around.  The admins for our cluster are unfortunately very slow to respond.
>
> Thanks
>
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/f5a6a74f/attachment-0003.html>

From carsonhh at gmail.com  Fri Jun  8 10:28:36 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Fri, 08 Jun 2012 12:28:36 -0400
Subject: [maker-devel] cluster error running maker
In-Reply-To: <CANRPJScgVoFkm2-fO5Y7MUyFngSgMjN71fPJL3tfr5k-dPDDYA@mail.gmail.com>
Message-ID: <CBF79DE3.D7AE%carsonhh@gmail.com>

That is one I haven't seen before (including on large multi-megabase contigs
).

Right before the error, it will say the location of the file that is being
read.  It will terminate in  ".augustus".  Could you send that file to me?
Augustus seems to be producing something weird in it's output.

Thanks,
Carson



From:  Walter Eckalbar <weckalba at asu.edu>
Date:  Friday, 8 June, 2012 12:15 PM
To:  Carson Holt <carsonhh at gmail.com>
Cc:  <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] cluster error running maker

Hi Carson,

I will try this as well to get my 2.25 version of maker running.

I have hit another error on my local machine.  This only seems to come up
with scaffolds > 5Mbp.  And am hitting this same error with version 2.10 and
2.25.

  [0] = Make
  [1] = 0
  [2] = additional
  [3] = prediction
  [4] = runs.
dead in Widget::augustus::parse_gene unknown feature type:additional
ERROR: Failed while preparing ab-inits
ERROR: Chunk failed at level:4, tier_type:0
FAILED CONTIG:GL343198.1

Do you have a suggestion for this one?

Thanks for all your help,

Walter


On 8 June 2012 05:45, Carson Holt <carsonhh at gmail.com> wrote:
> Here is a patch for the Proc::ProcessTable module in Perl.  Thanks to Volker
> Brendel at Iowa State for this one.
> 
>> Apply in Proc-ProcessTable-0.45 directory with --> patch -np1 <
>> 646785-and-handle-Hex29.patch
>> 
>> This adds to previously posted 646785 patch.  At least on some systems,
>> commands can contain "(" and ")".  See comments in the code.
>> 
> 
> Download Proc-ProcessTable-0.45 to reinstall before applying the patch.
> 
> 
> I'll also send you a link in a separate e-mail to download a maker 2.26 test
> version where I've replaced Proc::ProcessTable with a different module because
> of the failure on some systems.
> 
> Thanks,
> Carson
> 
> 
> 
> 
> From:  Walter Eckalbar <weckalba at asu.edu>
> Date:  Thursday, 7 June, 2012 4:40 PM
> To:  <maker-devel at yandell-lab.org>
> Subject:  [maker-devel] cluster error running maker
> 
> Hi everyone,
> 
> I have been retrying installing maker on our university cluster, everything
> seems to install correctly, but when I run maker I find the following error
> message:
> 
> Ran into unknown state (hex char: 29) at
> /home/weckalba/RNAseq/maker/lib/File/..//Proc/Signal.pm line 94.
> A data structure will be created for you at:
> /scratch/weckalba/Maker/genome.maker.output/genome_datastore
> 
> To access files for individual sequences use the datastore index:
> /scratch/weckalba/Maker/genome.maker.output/genome_master_datastore_index.log
> 
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 88.
> DBD::SQLite::db selectcol_arrayref failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 90.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 92.
> DBD::SQLite::db do failed: disk I/O error at
> /home/weckalba/RNAseq/maker/bin/../lib/GFFDB.pm line 161.
> 
> 
> Seems to have something to do with permissions and DBD::SQLite.  I installed
> DBD::SQLite on my own home directories and routed the perl path to it (and
> other CPAN installs in the same directories).
> 
> I was wondering if anyone ever encountered this before and knew a work around.
> The admins for our cluster are unfortunately very slow to respond.
> 
> Thanks
> 
> Walter
> _______________________________________________ maker-devel mailing list
> maker-devel at box290.bluehost.comhttp://box290.bluehost.com/mailman/listinfo/mak
> er-devel_yandell-lab.org



-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120608/8b777a77/attachment-0003.html>

From daniel.standage at gmail.com  Thu Jun 14 12:26:18 2012
From: daniel.standage at gmail.com (Daniel Standage)
Date: Thu, 14 Jun 2012 13:26:18 -0500
Subject: [maker-devel] Quick question about re-annotation
Message-ID: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>

Greetings!

I have a quick question about re-annotation with Maker. I have successfully
completed a Maker run, but now I would like to re-run Maker with some
additional EST evidence (from a related organism, aligned and in GFF3
format). I simply added the file to the *altest_gff* configuration setting
and re-ran Maker. However, from  the log messages it looked like Maker was
starting from scratch rather than using what had already been completed in
the initial run. Luckily, I had made a backup of the complete Maker data
structure, so I killed the job, deleted the data structure, and restored
from the backup.

Before I try to run this again, do I need to change any other configuration
settings to do this re-annotation? The stanza under *Re-annotation Using
MAKER Derived GFF3* looks relevant, but it is not clear to me which
settings need to be set.

Thanks!

--
Daniel S. Standage
Ph.D. Candidate
Bioinformatics and Computational Biology Program
Department of Genetics, Development, and Cell Biology
Iowa State University
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120614/13e8189c/attachment-0003.html>

From gowthaman.ramasamy at seattlebiomed.org  Thu Jun 14 12:48:01 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Thu, 14 Jun 2012 11:48:01 -0700
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
References: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>

Of course, Carson knows the best answer.

But, I think, you need to grab the GFFs from your previous maker run, and pass it as model_gff= option. That way, gene models in GFFs are used as a starting point and now will check for evidences from your alt_est dataset....

-Gowthaman
________________________________________
From: maker-devel-bounces at yandell-lab.org [maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage [daniel.standage at gmail.com]
Sent: Thursday, June 14, 2012 11:26 AM
To: Maker Mailing List
Subject: [maker-devel] Quick question about re-annotation

Greetings!

I have a quick question about re-annotation with Maker. I have successfully completed a Maker run, but now I would like to re-run Maker with some additional EST evidence (from a related organism, aligned and in GFF3 format). I simply added the file to the altest_gff configuration setting and re-ran Maker. However, from  the log messages it looked like Maker was starting from scratch rather than using what had already been completed in the initial run. Luckily, I had made a backup of the complete Maker data structure, so I killed the job, deleted the data structure, and restored from the backup.

Before I try to run this again, do I need to change any other configuration settings to do this re-annotation? The stanza under Re-annotation Using MAKER Derived GFF3 looks relevant, but it is not clear to me which settings need to be set.

Thanks!

--
Daniel S. Standage
Ph.D. Candidate
Bioinformatics and Computational Biology Program
Department of Genetics, Development, and Cell Biology
Iowa State University




From jason.stajich at gmail.com  Sun Jun 17 01:30:20 2012
From: jason.stajich at gmail.com (Jason Stajich)
Date: Sun, 17 Jun 2012 08:30:20 +0100
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>
References: <CAOfLjHUNhXA-P-6d+D-R_3LL8VJrbTjYQZ2L3PeP+Nos0zf0qQ@mail.gmail.com>
	<89080953C3D300419AACB6E63A7EEFBA5C8409F94D@mail02.sbri.org>
Message-ID: <CALf8Lpwq4kQu2-VrviAKK9R7EG2vRG3ATQo8g_LjM=stO1tLpA@mail.gmail.com>

Well remember that ESTs are used as extra helper information to the ab
initio gene predictors so it will want to run all those predictions again
and re-call the gene structures from the combined output with this extra
info added in. So you will need to decide how you want these to be
incorporated and if you are willing to wait for the analysis to complete
again with this info. The pass through of the previous run will allow you
to keep the names from that previous run if they are important to you.

Jason Stajich


On Thu, Jun 14, 2012 at 7:48 PM, Gowthaman Ramasamy <
gowthaman.ramasamy at seattlebiomed.org> wrote:

> Of course, Carson knows the best answer.
>
> But, I think, you need to grab the GFFs from your previous maker run, and
> pass it as model_gff= option. That way, gene models in GFFs are used as a
> starting point and now will check for evidences from your alt_est
> dataset....
>
> -Gowthaman
> ________________________________________
> From: maker-devel-bounces at yandell-lab.org [
> maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage [
> daniel.standage at gmail.com]
> Sent: Thursday, June 14, 2012 11:26 AM
> To: Maker Mailing List
> Subject: [maker-devel] Quick question about re-annotation
>
> Greetings!
>
> I have a quick question about re-annotation with Maker. I have
> successfully completed a Maker run, but now I would like to re-run Maker
> with some additional EST evidence (from a related organism, aligned and in
> GFF3 format). I simply added the file to the altest_gff configuration
> setting and re-ran Maker. However, from  the log messages it looked like
> Maker was starting from scratch rather than using what had already been
> completed in the initial run. Luckily, I had made a backup of the complete
> Maker data structure, so I killed the job, deleted the data structure, and
> restored from the backup.
>
> Before I try to run this again, do I need to change any other
> configuration settings to do this re-annotation? The stanza under
> Re-annotation Using MAKER Derived GFF3 looks relevant, but it is not clear
> to me which settings need to be set.
>
> Thanks!
>
> --
> Daniel S. Standage
> Ph.D. Candidate
> Bioinformatics and Computational Biology Program
> Department of Genetics, Development, and Cell Biology
> Iowa State University
>
>
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120617/522b4820/attachment-0003.html>

From alvinchen2002 at gmail.com  Fri Jun 15 13:41:52 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Fri, 15 Jun 2012 15:41:52 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
Message-ID: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>

Hi, 

	This is my first time to use maker. I have installed everything that required by maker, and use the data in "data" folder to test this program. But I got a "Segmentation fault" message after "Maker is now finished!!!". And I can't find gff file anywhere. Does anyone have a clue of this?

Thanks, 
Alvin

Here is the output of the program:

[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
WARNING: blast_type is set to 'wublast' but executables cannot be located
The blast_type 'ncbi' will be used instead.

A data structure will be created for you at:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore

To access files for individual sequences use the datastore index:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_datastore_index.log




--Next Contig--

#---------------------------------------------------------------------
Now starting the contig!!
SeqID: contig-dpp-500-500
Length: 32156
#---------------------------------------------------------------------


running  repeat masker.
#--------- command -------------#
Widget::RepeatMasker:
/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.all.rb -species all -dir /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
#-------------------------------#
processing output: 
cycle 1 
cycle 2 
cycle 3 
cycle 4 
cycle 5 
cycle 6 
cycle 7 
cycle 8 
cycle 9 
cycle 10 
Generating output... 
masking
done
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.repeatrunner
#-------------------------------#
deleted:0 hits
 in cluster:shadow cluster...
    i_size:5 j_size:3
 sorting hits in shadow cluster...
... finished.
 i_size:5   current i:0
 i_size:5   current i:1
 i_size:5   current i:2
 i_size:5   current i:3
 i_size:5   current i:4
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastn:
/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
#-------------------------------#
deleted:-1 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
#-------------------------------#
deleted:0 hits
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.dpp-mRNA-5.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.dpp-mRNA-4.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.dpp-mRNA-3.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.dpp-mRNA-2.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.dpp-mRNA-1.est_exonerate
#-------------------------------#
cleaning blastn...
cleaning tblastx...
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-5.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-4.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-3.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-2.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-1.p_exonerate
#-------------------------------#
cleaning blastx...
Preparing evidence for hint based annotation
 in cluster:shadow cluster...
    i_size:15 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:15   current i:0
 i_size:15   current i:1
 i_size:15   current i:2
 i_size:15   current i:3
 i_size:15   current i:4
 i_size:15   current i:5
 i_size:15   current i:6
 i_size:15   current i:7
 i_size:15   current i:8
 i_size:15   current i:9
 i_size:15   current i:10
 i_size:15   current i:11
 i_size:15   current i:12
 i_size:15   current i:13
 i_size:15   current i:14
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
 ...processing 0 of 5
 ...processing 1 of 5
 ...processing 2 of 5
 ...processing 3 of 5
Making transcripts
Processing transcripts into genes
 in cluster:shadow cluster...
    i_size:3 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:3   current i:0
 i_size:3   current i:1
 i_size:3   current i:2
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
now careful_clustering....
getting Pairs
doing single linkage clustering
 ...processing 0 of 3
 ...processing 1 of 3
Calculating annotation quality statistics
Choosing best annotations


Maker is now finished!!!

Segmentation fault






From gowthaman.ramasamy at seattlebiomed.org  Mon Jun 18 12:16:00 2012
From: gowthaman.ramasamy at seattlebiomed.org (Gowthaman Ramasamy)
Date: Mon, 18 Jun 2012 11:16:00 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>
References: <A37E3CD7-028C-4E4B-984F-5D81D6270279@gmail.com>
Message-ID: <89080953C3D300419AACB6E63A7EEFBA5C9EAEDA1E@mail02.sbri.org>

Hi Alvin,
I am a relatively new user too. I too get "seg fault" even though, maker did finish making the gff file successfully.

GFFs are actually buried deep down. One possibility is that you were looking only in parent folders.
If you have not done already,  you might want to check for gffs at: /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/*/*/*. ie, three levels down your data store.

what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?

Gowthaman
________________________________________
From: maker-devel-bounces at yandell-lab.org [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen [alvinchen2002 at gmail.com]
Sent: Friday, June 15, 2012 12:41 PM
To: maker-devel at yandell-lab.org
Subject: [maker-devel] maker 2.10 Segmentation fault

Hi,

        This is my first time to use maker. I have installed everything that required by maker, and use the data in "data" folder to test this program. But I got a "Segmentation fault" message after "Maker is now finished!!!". And I can't find gff file anywhere. Does anyone have a clue of this?

Thanks,
Alvin

Here is the output of the program:

[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
WARNING: blast_type is set to 'wublast' but executables cannot be located
The blast_type 'ncbi' will be used instead.

A data structure will be created for you at:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore

To access files for individual sequences use the datastore index:
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_datastore_index.log




--Next Contig--

#---------------------------------------------------------------------
Now starting the contig!!
SeqID: contig-dpp-500-500
Length: 32156
#---------------------------------------------------------------------


running  repeat masker.
#--------- command -------------#
Widget::RepeatMasker:
/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.all.rb -species all -dir /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
#-------------------------------#
processing output:
cycle 1
cycle 2
cycle 3
cycle 4
cycle 5
cycle 6
cycle 7
cycle 8
cycle 9
cycle 10
Generating output...
masking
done
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.repeatrunner
#-------------------------------#
deleted:0 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.repeatrunner
#-------------------------------#
deleted:0 hits
 in cluster:shadow cluster...
    i_size:5 j_size:3
 sorting hits in shadow cluster...
... finished.
 i_size:5   current i:0
 i_size:5   current i:1
 i_size:5   current i:2
 i_size:5   current i:3
 i_size:5   current i:4
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastn:
/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
#-------------------------------#
deleted:-1 hits
formating database...
#--------- command -------------#
Widget::formater:
/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
#-------------------------------#
running  blast search.
#--------- command -------------#
Widget::blastx:
/usr/bin/blastall -p blastx -d /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06 -z 300 -Y 500000000 -a 1 -U -F T -I T -o /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
#-------------------------------#
deleted:0 hits
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26586-31847.dpp-mRNA-5.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.23089-31847.dpp-mRNA-4.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.22854-31847.dpp-mRNA-3.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.20908-31847.dpp-mRNA-2.est_exonerate
#-------------------------------#
running  est2genome search.
#--------- command -------------#
Widget::exonerate::est2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20 --showcigar --percent 20 > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26901-31847.dpp-mRNA-1.est_exonerate
#-------------------------------#
cleaning blastn...
cleaning tblastx...
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-5.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-4.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-3.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-2.p_exonerate
#-------------------------------#
running  exonerate search.
#--------- command -------------#
Widget::exonerate::protein2genome:
/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta -t /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget  --percent 20 --showcigar  > /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500.26918-30804.dpp-CDS-1.p_exonerate
#-------------------------------#
cleaning blastx...
Preparing evidence for hint based annotation
 in cluster:shadow cluster...
    i_size:15 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:15   current i:0
 i_size:15   current i:1
 i_size:15   current i:2
 i_size:15   current i:3
 i_size:15   current i:4
 i_size:15   current i:5
 i_size:15   current i:6
 i_size:15   current i:7
 i_size:15   current i:8
 i_size:15   current i:9
 i_size:15   current i:10
 i_size:15   current i:11
 i_size:15   current i:12
 i_size:15   current i:13
 i_size:15   current i:14
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
 ...processing 0 of 5
 ...processing 1 of 5
 ...processing 2 of 5
 ...processing 3 of 5
Making transcripts
Processing transcripts into genes
 in cluster:shadow cluster...
    i_size:3 j_size:1
 sorting hits in shadow cluster...
... finished.
 i_size:3   current i:0
 i_size:3   current i:1
 i_size:3   current i:2
 in cluster:shadow cluster...
    i_size:0 j_size:0
 sorting hits in shadow cluster...
... finished.
now careful_clustering....
getting Pairs
doing single linkage clustering
 ...processing 0 of 3
 ...processing 1 of 3
Calculating annotation quality statistics
Choosing best annotations


Maker is now finished!!!

Segmentation fault




_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org



From carsonhh at gmail.com  Tue Jun 19 09:30:28 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 08:30:28 -0700
Subject: [maker-devel] Quick question about re-annotation
In-Reply-To: <CALf8Lpwq4kQu2-VrviAKK9R7EG2vRG3ATQo8g_LjM=stO1tLpA@mail.gmail.com>
Message-ID: <CC05E879.EA7E%carsonhh@gmail.com>

Yes the advice given so far is correct.  You can pass back through old
evidence using the maker_gff option and setting est_pass, protein_pass, etc.
to 1.  Set the pred_pass=0 so as to ignore old predictions.  Let MAKER
generate those again to reflect the additional evidence (added to the
alt_est= option).  If you have model_pass=1 and map_forward=1 set then if
any model changes, you can at least maintain the name.

Thanks,
Carson


From:  Jason Stajich <jason.stajich at gmail.com>
Date:  Sunday, 17 June, 2012 12:30 AM
To:  Daniel Standage <daniel.standage at gmail.com>
Cc:  Maker Mailing List <maker-devel at yandell-lab.org>
Subject:  Re: [maker-devel] Quick question about re-annotation

Well remember that ESTs are used as extra helper information to the ab
initio gene predictors so it will want to run all those predictions again
and re-call the gene structures from the combined output with this extra
info added in. So you will need to decide how you want these to be
incorporated and if you are willing to wait for the analysis to complete
again with this info. The pass through of the previous run will allow you to
keep the names from that previous run if they are important to you.

Jason Stajich


On Thu, Jun 14, 2012 at 7:48 PM, Gowthaman Ramasamy
<gowthaman.ramasamy at seattlebiomed.org> wrote:
> Of course, Carson knows the best answer.
> 
> But, I think, you need to grab the GFFs from your previous maker run, and pass
> it as model_gff= option. That way, gene models in GFFs are used as a starting
> point and now will check for evidences from your alt_est dataset....
> 
> -Gowthaman
> ________________________________________
> From: maker-devel-bounces at yandell-lab.org
> [maker-devel-bounces at yandell-lab.org] On Behalf Of Daniel Standage
> [daniel.standage at gmail.com]
> Sent: Thursday, June 14, 2012 11:26 AM
> To: Maker Mailing List
> Subject: [maker-devel] Quick question about re-annotation
> 
> Greetings!
> 
> I have a quick question about re-annotation with Maker. I have successfully
> completed a Maker run, but now I would like to re-run Maker with some
> additional EST evidence (from a related organism, aligned and in GFF3 format).
> I simply added the file to the altest_gff configuration setting and re-ran
> Maker. However, from  the log messages it looked like Maker was starting from
> scratch rather than using what had already been completed in the initial run.
> Luckily, I had made a backup of the complete Maker data structure, so I killed
> the job, deleted the data structure, and restored from the backup.
> 
> Before I try to run this again, do I need to change any other configuration
> settings to do this re-annotation? The stanza under Re-annotation Using MAKER
> Derived GFF3 looks relevant, but it is not clear to me which settings need to
> be set.
> 
> Thanks!
> 
> --
> Daniel S. Standage
> Ph.D. Candidate
> Bioinformatics and Computational Biology Program
> Department of Genetics, Development, and Cell Biology
> Iowa State University
> 
> 
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120619/039e29b4/attachment-0003.html>

From carsonhh at gmail.com  Tue Jun 19 09:39:55 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 08:39:55 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <89080953C3D300419AACB6E63A7EEFBA5C9EAEDA1E@mail02.sbri.org>
Message-ID: <CC05E9A6.EA88%carsonhh@gmail.com>

The "Maker is now finished" message occurs before the Segmentation fault
so it is finished.  The Segmentation fault is probably an issue with your
system reaping the perl threads on completion.  You can try reinstalling
the forks and forks::shared from CPAN.  Also make sure you are using the
2.25 version and no 2.10.  But your job is finished anyways, so it's
really not affecting the output.  MAKER puts the results for each contig
in a separate folder because some downstream programs like Apollo can only
handle one contig at a time.  Use the
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file to see where each contigs output is stored.


If you want a merged output file for everything, use the merge_gff script
in maker and give it the
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file and it will assemble a merged output file for you.
 There are two type of output GFF3 which gives detailed annotation
information and fasta which just produces sequence for each transcript.
Use fasta_merge to get a merged fasta file for all contigs (giving it the
same 
/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
atastore_index.log file).  The fiel you are interested will be the
maker.pteins.fasta and maker.transcripts.fasta file.

More information on MAKER's output here -->
http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output

Thanks,
Carson


On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
<gowthaman.ramasamy at seattlebiomed.org> wrote:

>Hi Alvin,
>I am a relatively new user too. I too get "seg fault" even though, maker
>did finish making the gff file successfully.
>
>GFFs are actually buried deep down. One possibility is that you were
>looking only in parent folders.
>If you have not done already,  you might want to check for gffs at:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/*/*/*. ie, three levels down your data store.
>
>what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?
>
>Gowthaman
>________________________________________
>From: maker-devel-bounces at yandell-lab.org
>[maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>[alvinchen2002 at gmail.com]
>Sent: Friday, June 15, 2012 12:41 PM
>To: maker-devel at yandell-lab.org
>Subject: [maker-devel] maker 2.10 Segmentation fault
>
>Hi,
>
>        This is my first time to use maker. I have installed everything
>that required by maker, and use the data in "data" folder to test this
>program. But I got a "Segmentation fault" message after "Maker is now
>finished!!!". And I can't find gff file anywhere. Does anyone have a clue
>of this?
>
>Thanks,
>Alvin
>
>Here is the output of the program:
>
>[yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
>WARNING: blast_type is set to 'wublast' but executables cannot be located
>The blast_type 'ncbi' will be used instead.
>
>A data structure will be created for you at:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re
>
>To access files for individual sequences use the datastore index:
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_
>datastore_index.log
>
>
>
>
>--Next Contig--
>
>#---------------------------------------------------------------------
>Now starting the contig!!
>SeqID: contig-dpp-500-500
>Length: 32156
>#---------------------------------------------------------------------
>
>
>running  repeat masker.
>#--------- command -------------#
>Widget::RepeatMasker:
>/home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.all.rb -species all -dir
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>#-------------------------------#
>processing output:
>cycle 1
>cycle 2
>cycle 3
>cycle 4
>cycle 5
>cycle 6
>cycle 7
>cycle 8
>cycle 9
>cycle 10
>Generating output...
>masking
>done
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.
>repeatrunner
>#-------------------------------#
>deleted:0 hits
> in cluster:shadow cluster...
>    i_size:5 j_size:3
> sorting hits in shadow cluster...
>... finished.
> i_size:5   current i:0
> i_size:5   current i:1
> i_size:5   current i:2
> i_size:5   current i:3
> i_size:5   current i:4
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastn:
>/usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>-i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>-o 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>#-------------------------------#
>deleted:-1 hits
>formating database...
>#--------- command -------------#
>Widget::formater:
>/usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>#-------------------------------#
>running  blast search.
>#--------- command -------------#
>Widget::blastx:
>/usr/bin/blastall -p blastx -d
>/tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>/tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>-z 300 -Y 500000000 -a 1 -U -F T -I T -o
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
>#-------------------------------#
>deleted:0 hits
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26586-31847.dpp-mRNA-5.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.23089-31847.dpp-mRNA-4.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.22854-31847.dpp-mRNA-3.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.20908-31847.dpp-mRNA-2.est_exonerate
>#-------------------------------#
>running  est2genome search.
>#--------- command -------------#
>Widget::exonerate::est2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>--showcigar --percent 20 >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26901-31847.dpp-mRNA-1.est_exonerate
>#-------------------------------#
>cleaning blastn...
>cleaning tblastx...
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-5.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-4.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-3.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-2.p_exonerate
>#-------------------------------#
>running  exonerate search.
>#--------- command -------------#
>Widget::exonerate::protein2genome:
>/home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>-t 
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>--percent 20 --showcigar  >
>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>.26918-30804.dpp-CDS-1.p_exonerate
>#-------------------------------#
>cleaning blastx...
>Preparing evidence for hint based annotation
> in cluster:shadow cluster...
>    i_size:15 j_size:1
> sorting hits in shadow cluster...
>... finished.
> i_size:15   current i:0
> i_size:15   current i:1
> i_size:15   current i:2
> i_size:15   current i:3
> i_size:15   current i:4
> i_size:15   current i:5
> i_size:15   current i:6
> i_size:15   current i:7
> i_size:15   current i:8
> i_size:15   current i:9
> i_size:15   current i:10
> i_size:15   current i:11
> i_size:15   current i:12
> i_size:15   current i:13
> i_size:15   current i:14
> in cluster:shadow cluster...
>    i_size:0 j_size:0
> sorting hits in shadow cluster...
>... finished.
> ...processing 0 of 5
> ...processing 1 of 5
> ...processing 2 of 5
> ...processing 3 of 5
>Making transcripts
>Processing transcripts into genes
> in cluster:shadow cluster...
>    i_size:3 j_size:1
> sorting hits in shadow cluster...
>... finished.
> i_size:3   current i:0
> i_size:3   current i:1
> i_size:3   current i:2
> in cluster:shadow cluster...
>    i_size:0 j_size:0
> sorting hits in shadow cluster...
>... finished.
>now careful_clustering....
>getting Pairs
>doing single linkage clustering
> ...processing 0 of 3
> ...processing 1 of 3
>Calculating annotation quality statistics
>Choosing best annotations
>
>
>Maker is now finished!!!
>
>Segmentation fault
>
>
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From alvinchen2002 at gmail.com  Tue Jun 19 21:57:33 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Tue, 19 Jun 2012 23:57:33 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC05E9A6.EA88%carsonhh@gmail.com>
References: <CC05E9A6.EA88%carsonhh@gmail.com>
Message-ID: <3C1B46A3-09B2-4BFC-9CDE-BBCFF2B74073@gmail.com>

Hey Carson and Gowthaman, 

	Thanks for your replies! You are right, Carson, the problem caused by "Proc::Signal::reap_children_by_name(9, 'maintain.pl');". dpp_contig_master_datastore_index.log shows that the job has finished. I have installed the newest version of forks and forks::shared. but the version is 0.34 not 2.25, is that correct? The bad news is that the program still crashed at last, but it won't hurt.  I have tried the dpp and hsap data in data folder, and I have got 6 genes for hsap and 3 genes for dpp, is this number correct? I just want make sure everything works fine and I will begin to use it with my data. Thanks!

Best,
Alvin


On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:

> The "Maker is now finished" message occurs before the Segmentation fault
> so it is finished.  The Segmentation fault is probably an issue with your
> system reaping the perl threads on completion.  You can try reinstalling
> the forks and forks::shared from CPAN.  Also make sure you are using the
> 2.25 version and no 2.10.  But your job is finished anyways, so it's
> really not affecting the output.  MAKER puts the results for each contig
> in a separate folder because some downstream programs like Apollo can only
> handle one contig at a time.  Use the
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file to see where each contigs output is stored.
> 
> 
> If you want a merged output file for everything, use the merge_gff script
> in maker and give it the
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file and it will assemble a merged output file for you.
> There are two type of output GFF3 which gives detailed annotation
> information and fasta which just produces sequence for each transcript.
> Use fasta_merge to get a merged fasta file for all contigs (giving it the
> same 
> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_d
> atastore_index.log file).  The fiel you are interested will be the
> maker.pteins.fasta and maker.transcripts.fasta file.
> 
> More information on MAKER's output here -->
> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
> 
> Thanks,
> Carson
> 
> 
> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
> <gowthaman.ramasamy at seattlebiomed.org> wrote:
> 
>> Hi Alvin,
>> I am a relatively new user too. I too get "seg fault" even though, maker
>> did finish making the gff file successfully.
>> 
>> GFFs are actually buried deep down. One possibility is that you were
>> looking only in parent folders.
>> If you have not done already,  you might want to check for gffs at:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/*/*/*. ie, three levels down your data store.
>> 
>> what does "dpp_contig_master_datastore_index.log" says? Failed/Finsihed ?
>> 
>> Gowthaman
>> ________________________________________
>> From: maker-devel-bounces at yandell-lab.org
>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>> [alvinchen2002 at gmail.com]
>> Sent: Friday, June 15, 2012 12:41 PM
>> To: maker-devel at yandell-lab.org
>> Subject: [maker-devel] maker 2.10 Segmentation fault
>> 
>> Hi,
>> 
>>       This is my first time to use maker. I have installed everything
>> that required by maker, and use the data in "data" folder to test this
>> program. But I got a "Segmentation fault" message after "Maker is now
>> finished!!!". And I can't find gff file anywhere. Does anyone have a clue
>> of this?
>> 
>> Thanks,
>> Alvin
>> 
>> Here is the output of the program:
>> 
>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl
>> WARNING: blast_type is set to 'wublast' but executables cannot be located
>> The blast_type 'ncbi' will be used instead.
>> 
>> A data structure will be created for you at:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re
>> 
>> To access files for individual sequences use the datastore index:
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master_
>> datastore_index.log
>> 
>> 
>> 
>> 
>> --Next Contig--
>> 
>> #---------------------------------------------------------------------
>> Now starting the contig!!
>> SeqID: contig-dpp-500-500
>> Length: 32156
>> #---------------------------------------------------------------------
>> 
>> 
>> running  repeat masker.
>> #--------- command -------------#
>> Widget::RepeatMasker:
>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.all.rb -species all -dir
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>> #-------------------------------#
>> processing output:
>> cycle 1
>> cycle 2
>> cycle 3
>> cycle 4
>> cycle 5
>> cycle 6
>> cycle 7
>> cycle 8
>> cycle 9
>> cycle 10
>> Generating output...
>> masking
>> done
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.1.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.2.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.3.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.4.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.5.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.6.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.7.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.8.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.9.
>> repeatrunner
>> #-------------------------------#
>> deleted:0 hits
>> in cluster:shadow cluster...
>>   i_size:5 j_size:3
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:5   current i:0
>> i_size:5   current i:1
>> i_size:5   current i:2
>> i_size:5   current i:3
>> i_size:5   current i:4
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastn:
>> /usr/bin/blastall -p blastn -d /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>> -o 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>> #-------------------------------#
>> deleted:-1 hits
>> formating database...
>> #--------- command -------------#
>> Widget::formater:
>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>> #-------------------------------#
>> running  blast search.
>> #--------- command -------------#
>> Widget::blastx:
>> /usr/bin/blastall -p blastx -d
>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e 1e-06
>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blastx
>> #-------------------------------#
>> deleted:0 hits
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26586-31847.dpp-mRNA-5.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .23089-31847.dpp-mRNA-4.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .22854-31847.dpp-mRNA-3.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .20908-31847.dpp-mRNA-2.est_exonerate
>> #-------------------------------#
>> running  est2genome search.
>> #--------- command -------------#
>> Widget::exonerate::est2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>> --showcigar --percent 20 >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26901-31847.dpp-mRNA-1.est_exonerate
>> #-------------------------------#
>> cleaning blastn...
>> cleaning tblastx...
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-5.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-4.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-3.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-2.p_exonerate
>> #-------------------------------#
>> running  exonerate search.
>> #--------- command -------------#
>> Widget::exonerate::protein2genome:
>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>> -t 
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>> --percent 20 --showcigar  >
>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datasto
>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-500
>> .26918-30804.dpp-CDS-1.p_exonerate
>> #-------------------------------#
>> cleaning blastx...
>> Preparing evidence for hint based annotation
>> in cluster:shadow cluster...
>>   i_size:15 j_size:1
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:15   current i:0
>> i_size:15   current i:1
>> i_size:15   current i:2
>> i_size:15   current i:3
>> i_size:15   current i:4
>> i_size:15   current i:5
>> i_size:15   current i:6
>> i_size:15   current i:7
>> i_size:15   current i:8
>> i_size:15   current i:9
>> i_size:15   current i:10
>> i_size:15   current i:11
>> i_size:15   current i:12
>> i_size:15   current i:13
>> i_size:15   current i:14
>> in cluster:shadow cluster...
>>   i_size:0 j_size:0
>> sorting hits in shadow cluster...
>> ... finished.
>> ...processing 0 of 5
>> ...processing 1 of 5
>> ...processing 2 of 5
>> ...processing 3 of 5
>> Making transcripts
>> Processing transcripts into genes
>> in cluster:shadow cluster...
>>   i_size:3 j_size:1
>> sorting hits in shadow cluster...
>> ... finished.
>> i_size:3   current i:0
>> i_size:3   current i:1
>> i_size:3   current i:2
>> in cluster:shadow cluster...
>>   i_size:0 j_size:0
>> sorting hits in shadow cluster...
>> ... finished.
>> now careful_clustering....
>> getting Pairs
>> doing single linkage clustering
>> ...processing 0 of 3
>> ...processing 1 of 3
>> Calculating annotation quality statistics
>> Choosing best annotations
>> 
>> 
>> Maker is now finished!!!
>> 
>> Segmentation fault
>> 
>> 
>> 
>> 
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
> 
> 




From carsonhh at gmail.com  Tue Jun 19 23:03:14 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:03:14 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <3C1B46A3-09B2-4BFC-9CDE-BBCFF2B74073@gmail.com>
Message-ID: <CC06A670.EACE%carsonhh@gmail.com>

Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
version 2.25 (type maker -v to see the version you are using).  The
reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
process fails to respond to signals upstream in the code.  The 2.25
version of MAKER does some extra things that should even further avoid the
need for the call compared to MAKER 2.10.

Thanks,
Carson






On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey Carson and Gowthaman,
>
>	Thanks for your replies! You are right, Carson, the problem caused by
>"Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>dpp_contig_master_datastore_index.log shows that the job has finished. I
>have installed the newest version of forks and forks::shared. but the
>version is 0.34 not 2.25, is that correct? The bad news is that the
>program still crashed at last, but it won't hurt.  I have tried the dpp
>and hsap data in data folder, and I have got 6 genes for hsap and 3 genes
>for dpp, is this number correct? I just want make sure everything works
>fine and I will begin to use it with my data. Thanks!
>
>Best,
>Alvin
>
>
>On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>
>> The "Maker is now finished" message occurs before the Segmentation fault
>> so it is finished.  The Segmentation fault is probably an issue with
>>your
>> system reaping the perl threads on completion.  You can try reinstalling
>> the forks and forks::shared from CPAN.  Also make sure you are using the
>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>> really not affecting the output.  MAKER puts the results for each contig
>> in a separate folder because some downstream programs like Apollo can
>>only
>> handle one contig at a time.  Use the
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file to see where each contigs output is stored.
>> 
>> 
>> If you want a merged output file for everything, use the merge_gff
>>script
>> in maker and give it the
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file and it will assemble a merged output file for
>>you.
>> There are two type of output GFF3 which gives detailed annotation
>> information and fasta which just produces sequence for each transcript.
>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>the
>> same 
>> 
>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>_d
>> atastore_index.log file).  The fiel you are interested will be the
>> maker.pteins.fasta and maker.transcripts.fasta file.
>> 
>> More information on MAKER's output here -->
>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>> 
>> Thanks,
>> Carson
>> 
>> 
>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>> 
>>> Hi Alvin,
>>> I am a relatively new user too. I too get "seg fault" even though,
>>>maker
>>> did finish making the gff file successfully.
>>> 
>>> GFFs are actually buried deep down. One possibility is that you were
>>> looking only in parent folders.
>>> If you have not done already,  you might want to check for gffs at:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/*/*/*. ie, three levels down your data store.
>>> 
>>> what does "dpp_contig_master_datastore_index.log" says?
>>>Failed/Finsihed ?
>>> 
>>> Gowthaman
>>> ________________________________________
>>> From: maker-devel-bounces at yandell-lab.org
>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>> [alvinchen2002 at gmail.com]
>>> Sent: Friday, June 15, 2012 12:41 PM
>>> To: maker-devel at yandell-lab.org
>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>> 
>>> Hi,
>>> 
>>>       This is my first time to use maker. I have installed everything
>>> that required by maker, and use the data in "data" folder to test this
>>> program. But I got a "Segmentation fault" message after "Maker is now
>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>clue
>>> of this?
>>> 
>>> Thanks,
>>> Alvin
>>> 
>>> Here is the output of the program:
>>> 
>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>maker_exe.ctl
>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>located
>>> The blast_type 'ncbi' will be used instead.
>>> 
>>> A data structure will be created for you at:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re
>>> 
>>> To access files for individual sequences use the datastore index:
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_maste
>>>r_
>>> datastore_index.log
>>> 
>>> 
>>> 
>>> 
>>> --Next Contig--
>>> 
>>> #---------------------------------------------------------------------
>>> Now starting the contig!!
>>> SeqID: contig-dpp-500-500
>>> Length: 32156
>>> #---------------------------------------------------------------------
>>> 
>>> 
>>> running  repeat masker.
>>> #--------- command -------------#
>>> Widget::RepeatMasker:
>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .0.all.rb -species all -dir
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>> #-------------------------------#
>>> processing output:
>>> cycle 1
>>> cycle 2
>>> cycle 3
>>> cycle 4
>>> cycle 5
>>> cycle 6
>>> cycle 7
>>> cycle 8
>>> cycle 9
>>> cycle 10
>>> Generating output...
>>> masking
>>> done
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>0.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>1.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>2.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>3.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>4.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>5.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>6.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>7.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>8.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i
>>>/tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>9.
>>> repeatrunner
>>> #-------------------------------#
>>> deleted:0 hits
>>> in cluster:shadow cluster...
>>>   i_size:5 j_size:3
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:5   current i:0
>>> i_size:5   current i:1
>>> i_size:5   current i:2
>>> i_size:5   current i:3
>>> i_size:5   current i:4
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastn:
>>> /usr/bin/blastall -p blastn -d
>>>/tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>>> -o 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>> #-------------------------------#
>>> deleted:-1 hits
>>> formating database...
>>> #--------- command -------------#
>>> Widget::formater:
>>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>> #-------------------------------#
>>> running  blast search.
>>> #--------- command -------------#
>>> Widget::blastx:
>>> /usr/bin/blastall -p blastx -d
>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>1e-06
>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> 
>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blast
>>>x
>>> #-------------------------------#
>>> deleted:0 hits
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>> #-------------------------------#
>>> running  est2genome search.
>>> #--------- command -------------#
>>> Widget::exonerate::est2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>> --showcigar --percent 20 >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>> #-------------------------------#
>>> cleaning blastn...
>>> cleaning tblastx...
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-5.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-4.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-3.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-2.p_exonerate
>>> #-------------------------------#
>>> running  exonerate search.
>>> #--------- command -------------#
>>> Widget::exonerate::protein2genome:
>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>>> -t 
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>> --percent 20 --showcigar  >
>>> 
>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>to
>>> 
>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>00
>>> .26918-30804.dpp-CDS-1.p_exonerate
>>> #-------------------------------#
>>> cleaning blastx...
>>> Preparing evidence for hint based annotation
>>> in cluster:shadow cluster...
>>>   i_size:15 j_size:1
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:15   current i:0
>>> i_size:15   current i:1
>>> i_size:15   current i:2
>>> i_size:15   current i:3
>>> i_size:15   current i:4
>>> i_size:15   current i:5
>>> i_size:15   current i:6
>>> i_size:15   current i:7
>>> i_size:15   current i:8
>>> i_size:15   current i:9
>>> i_size:15   current i:10
>>> i_size:15   current i:11
>>> i_size:15   current i:12
>>> i_size:15   current i:13
>>> i_size:15   current i:14
>>> in cluster:shadow cluster...
>>>   i_size:0 j_size:0
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> ...processing 0 of 5
>>> ...processing 1 of 5
>>> ...processing 2 of 5
>>> ...processing 3 of 5
>>> Making transcripts
>>> Processing transcripts into genes
>>> in cluster:shadow cluster...
>>>   i_size:3 j_size:1
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> i_size:3   current i:0
>>> i_size:3   current i:1
>>> i_size:3   current i:2
>>> in cluster:shadow cluster...
>>>   i_size:0 j_size:0
>>> sorting hits in shadow cluster...
>>> ... finished.
>>> now careful_clustering....
>>> getting Pairs
>>> doing single linkage clustering
>>> ...processing 0 of 3
>>> ...processing 1 of 3
>>> Calculating annotation quality statistics
>>> Choosing best annotations
>>> 
>>> 
>>> Maker is now finished!!!
>>> 
>>> Segmentation fault
>>> 
>>> 
>>> 
>>> 
>>> _______________________________________________
>>> maker-devel mailing list
>>> maker-devel at box290.bluehost.com
>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>> 
>>> _______________________________________________
>>> maker-devel mailing list
>>> maker-devel at box290.bluehost.com
>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>> 
>> 
>





From alvinchen2002 at gmail.com  Tue Jun 19 23:15:24 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Wed, 20 Jun 2012 01:15:24 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC06A670.EACE%carsonhh@gmail.com>
References: <CC06A670.EACE%carsonhh@gmail.com>
Message-ID: <ACAA26CD-8208-4027-9831-2139093467A2@gmail.com>

Hey  Carson,

	I am still using 2.10, because 2.25 get crashed at the beginning. I think it may be caused by these codes:

Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up maintainers
Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up maintainers"

You have added them at the top of the scripts in the new version. 

Alvin

On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:

> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
> version 2.25 (type maker -v to see the version you are using).  The
> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
> process fails to respond to signals upstream in the code.  The 2.25
> version of MAKER does some extra things that should even further avoid the
> need for the call compared to MAKER 2.10.
> 
> Thanks,
> Carson
> 
> 
> 
> 
> 
> 
> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
> 
>> Hey Carson and Gowthaman,
>> 
>> 	Thanks for your replies! You are right, Carson, the problem caused by
>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>> dpp_contig_master_datastore_index.log shows that the job has finished. I
>> have installed the newest version of forks and forks::shared. but the
>> version is 0.34 not 2.25, is that correct? The bad news is that the
>> program still crashed at last, but it won't hurt.  I have tried the dpp
>> and hsap data in data folder, and I have got 6 genes for hsap and 3 genes
>> for dpp, is this number correct? I just want make sure everything works
>> fine and I will begin to use it with my data. Thanks!
>> 
>> Best,
>> Alvin
>> 
>> 
>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>> 
>>> The "Maker is now finished" message occurs before the Segmentation fault
>>> so it is finished.  The Segmentation fault is probably an issue with
>>> your
>>> system reaping the perl threads on completion.  You can try reinstalling
>>> the forks and forks::shared from CPAN.  Also make sure you are using the
>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>> really not affecting the output.  MAKER puts the results for each contig
>>> in a separate folder because some downstream programs like Apollo can
>>> only
>>> handle one contig at a time.  Use the
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file to see where each contigs output is stored.
>>> 
>>> 
>>> If you want a merged output file for everything, use the merge_gff
>>> script
>>> in maker and give it the
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file and it will assemble a merged output file for
>>> you.
>>> There are two type of output GFF3 which gives detailed annotation
>>> information and fasta which just produces sequence for each transcript.
>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>> the
>>> same 
>>> 
>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_master
>>> _d
>>> atastore_index.log file).  The fiel you are interested will be the
>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>> 
>>> More information on MAKER's output here -->
>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>> 
>>> Thanks,
>>> Carson
>>> 
>>> 
>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>> 
>>>> Hi Alvin,
>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>> maker
>>>> did finish making the gff file successfully.
>>>> 
>>>> GFFs are actually buried deep down. One possibility is that you were
>>>> looking only in parent folders.
>>>> If you have not done already,  you might want to check for gffs at:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/*/*/*. ie, three levels down your data store.
>>>> 
>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>> Failed/Finsihed ?
>>>> 
>>>> Gowthaman
>>>> ________________________________________
>>>> From: maker-devel-bounces at yandell-lab.org
>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>> [alvinchen2002 at gmail.com]
>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>> To: maker-devel at yandell-lab.org
>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>> 
>>>> Hi,
>>>> 
>>>>      This is my first time to use maker. I have installed everything
>>>> that required by maker, and use the data in "data" folder to test this
>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>> clue
>>>> of this?
>>>> 
>>>> Thanks,
>>>> Alvin
>>>> 
>>>> Here is the output of the program:
>>>> 
>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>> maker_exe.ctl
>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>> located
>>>> The blast_type 'ncbi' will be used instead.
>>>> 
>>>> A data structure will be created for you at:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re
>>>> 
>>>> To access files for individual sequences use the datastore index:
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_maste
>>>> r_
>>>> datastore_index.log
>>>> 
>>>> 
>>>> 
>>>> 
>>>> --Next Contig--
>>>> 
>>>> #---------------------------------------------------------------------
>>>> Now starting the contig!!
>>>> SeqID: contig-dpp-500-500
>>>> Length: 32156
>>>> #---------------------------------------------------------------------
>>>> 
>>>> 
>>>> running  repeat masker.
>>>> #--------- command -------------#
>>>> Widget::RepeatMasker:
>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .0.all.rb -species all -dir
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>> #-------------------------------#
>>>> processing output:
>>>> cycle 1
>>>> cycle 2
>>>> cycle 3
>>>> cycle 4
>>>> cycle 5
>>>> cycle 6
>>>> cycle 7
>>>> cycle 8
>>>> cycle 9
>>>> cycle 10
>>>> Generating output...
>>>> masking
>>>> done
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 0.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 1.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 2.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 3.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 4.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 5.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 6.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 7.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 8.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.
>>>> 9.
>>>> repeatrunner
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> in cluster:shadow cluster...
>>>>  i_size:5 j_size:3
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:5   current i:0
>>>> i_size:5   current i:1
>>>> i_size:5   current i:2
>>>> i_size:5   current i:3
>>>> i_size:5   current i:4
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastn:
>>>> /usr/bin/blastall -p blastn -d
>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T -I T
>>>> -o 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>> #-------------------------------#
>>>> deleted:-1 hits
>>>> formating database...
>>>> #--------- command -------------#
>>>> Widget::formater:
>>>> /usr/bin/formatdb -p T -i /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>> #-------------------------------#
>>>> running  blast search.
>>>> #--------- command -------------#
>>>> Widget::blastx:
>>>> /usr/bin/blastall -p blastx -d
>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>> 1e-06
>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> 
>>>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.blast
>>>> x
>>>> #-------------------------------#
>>>> deleted:0 hits
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>> #-------------------------------#
>>>> running  est2genome search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::est2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>> --showcigar --percent 20 >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>> #-------------------------------#
>>>> cleaning blastn...
>>>> cleaning tblastx...
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>> #-------------------------------#
>>>> running  exonerate search.
>>>> #--------- command -------------#
>>>> Widget::exonerate::protein2genome:
>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fasta
>>>> -t 
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome --softmasktarget
>>>> --percent 20 --showcigar  >
>>>> 
>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_datas
>>>> to
>>>> 
>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500-5
>>>> 00
>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>> #-------------------------------#
>>>> cleaning blastx...
>>>> Preparing evidence for hint based annotation
>>>> in cluster:shadow cluster...
>>>>  i_size:15 j_size:1
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:15   current i:0
>>>> i_size:15   current i:1
>>>> i_size:15   current i:2
>>>> i_size:15   current i:3
>>>> i_size:15   current i:4
>>>> i_size:15   current i:5
>>>> i_size:15   current i:6
>>>> i_size:15   current i:7
>>>> i_size:15   current i:8
>>>> i_size:15   current i:9
>>>> i_size:15   current i:10
>>>> i_size:15   current i:11
>>>> i_size:15   current i:12
>>>> i_size:15   current i:13
>>>> i_size:15   current i:14
>>>> in cluster:shadow cluster...
>>>>  i_size:0 j_size:0
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> ...processing 0 of 5
>>>> ...processing 1 of 5
>>>> ...processing 2 of 5
>>>> ...processing 3 of 5
>>>> Making transcripts
>>>> Processing transcripts into genes
>>>> in cluster:shadow cluster...
>>>>  i_size:3 j_size:1
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> i_size:3   current i:0
>>>> i_size:3   current i:1
>>>> i_size:3   current i:2
>>>> in cluster:shadow cluster...
>>>>  i_size:0 j_size:0
>>>> sorting hits in shadow cluster...
>>>> ... finished.
>>>> now careful_clustering....
>>>> getting Pairs
>>>> doing single linkage clustering
>>>> ...processing 0 of 3
>>>> ...processing 1 of 3
>>>> Calculating annotation quality statistics
>>>> Choosing best annotations
>>>> 
>>>> 
>>>> Maker is now finished!!!
>>>> 
>>>> Segmentation fault
>>>> 
>>>> 
>>>> 
>>>> 
>>>> _______________________________________________
>>>> maker-devel mailing list
>>>> maker-devel at box290.bluehost.com
>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>>> 
>>>> _______________________________________________
>>>> maker-devel mailing list
>>>> maker-devel at box290.bluehost.com
>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>>> 
>>> 
>> 
> 
> 




From carsonhh at gmail.com  Tue Jun 19 23:21:22 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:21:22 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <ACAA26CD-8208-4027-9831-2139093467A2@gmail.com>
Message-ID: <CC06AB2D.EAE2%carsonhh@gmail.com>

Those are wrapped in an END block so they only run when perl exits (I.e.
post completion or failure).  If 2.25 is failing it would likely be for
another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
-debug).  Does it produce any output before failure?

Thanks,
Carson





On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey  Carson,
>
>	I am still using 2.10, because 2.25 get crashed at the beginning. I
>think it may be caused by these codes:
>
>Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>maintainers
>Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>maintainers"
>
>You have added them at the top of the scripts in the new version.
>
>Alvin
>
>On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>
>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
>> version 2.25 (type maker -v to see the version you are using).  The
>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>> process fails to respond to signals upstream in the code.  The 2.25
>> version of MAKER does some extra things that should even further avoid
>>the
>> need for the call compared to MAKER 2.10.
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> 
>> 
>> 
>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>> 
>>> Hey Carson and Gowthaman,
>>> 
>>> 	Thanks for your replies! You are right, Carson, the problem caused by
>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>> dpp_contig_master_datastore_index.log shows that the job has finished.
>>>I
>>> have installed the newest version of forks and forks::shared. but the
>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>> program still crashed at last, but it won't hurt.  I have tried the dpp
>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>genes
>>> for dpp, is this number correct? I just want make sure everything works
>>> fine and I will begin to use it with my data. Thanks!
>>> 
>>> Best,
>>> Alvin
>>> 
>>> 
>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>> 
>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>fault
>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>> your
>>>> system reaping the perl threads on completion.  You can try
>>>>reinstalling
>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>the
>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>> really not affecting the output.  MAKER puts the results for each
>>>>contig
>>>> in a separate folder because some downstream programs like Apollo can
>>>> only
>>>> handle one contig at a time.  Use the
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file to see where each contigs output is stored.
>>>> 
>>>> 
>>>> If you want a merged output file for everything, use the merge_gff
>>>> script
>>>> in maker and give it the
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file and it will assemble a merged output file for
>>>> you.
>>>> There are two type of output GFF3 which gives detailed annotation
>>>> information and fasta which just produces sequence for each
>>>>transcript.
>>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>>> the
>>>> same 
>>>> 
>>>> 
>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>er
>>>> _d
>>>> atastore_index.log file).  The fiel you are interested will be the
>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>> 
>>>> More information on MAKER's output here -->
>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>> 
>>>> Thanks,
>>>> Carson
>>>> 
>>>> 
>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>> 
>>>>> Hi Alvin,
>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>> maker
>>>>> did finish making the gff file successfully.
>>>>> 
>>>>> GFFs are actually buried deep down. One possibility is that you were
>>>>> looking only in parent folders.
>>>>> If you have not done already,  you might want to check for gffs at:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re/*/*/*. ie, three levels down your data store.
>>>>> 
>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>> Failed/Finsihed ?
>>>>> 
>>>>> Gowthaman
>>>>> ________________________________________
>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>> [alvinchen2002 at gmail.com]
>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>> To: maker-devel at yandell-lab.org
>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>> 
>>>>> Hi,
>>>>> 
>>>>>      This is my first time to use maker. I have installed everything
>>>>> that required by maker, and use the data in "data" folder to test
>>>>>this
>>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>>> clue
>>>>> of this?
>>>>> 
>>>>> Thanks,
>>>>> Alvin
>>>>> 
>>>>> Here is the output of the program:
>>>>> 
>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>> maker_exe.ctl
>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>> located
>>>>> The blast_type 'ncbi' will be used instead.
>>>>> 
>>>>> A data structure will be created for you at:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re
>>>>> 
>>>>> To access files for individual sequences use the datastore index:
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mas
>>>>>te
>>>>> r_
>>>>> datastore_index.log
>>>>> 
>>>>> 
>>>>> 
>>>>> 
>>>>> --Next Contig--
>>>>> 
>>>>> 
>>>>>#---------------------------------------------------------------------
>>>>> Now starting the contig!!
>>>>> SeqID: contig-dpp-500-500
>>>>> Length: 32156
>>>>> 
>>>>>#---------------------------------------------------------------------
>>>>> 
>>>>> 
>>>>> running  repeat masker.
>>>>> #--------- command -------------#
>>>>> Widget::RepeatMasker:
>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .0.all.rb -species all -dir
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>> #-------------------------------#
>>>>> processing output:
>>>>> cycle 1
>>>>> cycle 2
>>>>> cycle 3
>>>>> cycle 4
>>>>> cycle 5
>>>>> cycle 6
>>>>> cycle 7
>>>>> cycle 8
>>>>> cycle 9
>>>>> cycle 10
>>>>> Generating output...
>>>>> masking
>>>>> done
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 0.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 1.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 2.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 3.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 4.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 5.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 6.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 7.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 8.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>0.
>>>>> 9.
>>>>> repeatrunner
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> in cluster:shadow cluster...
>>>>>  i_size:5 j_size:3
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:5   current i:0
>>>>> i_size:5   current i:1
>>>>> i_size:5   current i:2
>>>>> i_size:5   current i:3
>>>>> i_size:5   current i:4
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastn:
>>>>> /usr/bin/blastall -p blastn -d
>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>-e
>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>-I T
>>>>> -o 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>> #-------------------------------#
>>>>> deleted:-1 hits
>>>>> formating database...
>>>>> #--------- command -------------#
>>>>> Widget::formater:
>>>>> /usr/bin/formatdb -p T -i
>>>>>/tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>> #-------------------------------#
>>>>> running  blast search.
>>>>> #--------- command -------------#
>>>>> Widget::blastx:
>>>>> /usr/bin/blastall -p blastx -d
>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>> 1e-06
>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> 
>>>>> 
>>>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.bla
>>>>>st
>>>>> x
>>>>> #-------------------------------#
>>>>> deleted:0 hits
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>> #-------------------------------#
>>>>> running  est2genome search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::est2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fas
>>>>>ta
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>> --showcigar --percent 20 >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>> #-------------------------------#
>>>>> cleaning blastn...
>>>>> cleaning tblastx...
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>> #-------------------------------#
>>>>> running  exonerate search.
>>>>> #--------- command -------------#
>>>>> Widget::exonerate::protein2genome:
>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fast
>>>>>a
>>>>> -t 
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>--softmasktarget
>>>>> --percent 20 --showcigar  >
>>>>> 
>>>>> 
>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>as
>>>>> to
>>>>> 
>>>>> 
>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>-5
>>>>> 00
>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>> #-------------------------------#
>>>>> cleaning blastx...
>>>>> Preparing evidence for hint based annotation
>>>>> in cluster:shadow cluster...
>>>>>  i_size:15 j_size:1
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:15   current i:0
>>>>> i_size:15   current i:1
>>>>> i_size:15   current i:2
>>>>> i_size:15   current i:3
>>>>> i_size:15   current i:4
>>>>> i_size:15   current i:5
>>>>> i_size:15   current i:6
>>>>> i_size:15   current i:7
>>>>> i_size:15   current i:8
>>>>> i_size:15   current i:9
>>>>> i_size:15   current i:10
>>>>> i_size:15   current i:11
>>>>> i_size:15   current i:12
>>>>> i_size:15   current i:13
>>>>> i_size:15   current i:14
>>>>> in cluster:shadow cluster...
>>>>>  i_size:0 j_size:0
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> ...processing 0 of 5
>>>>> ...processing 1 of 5
>>>>> ...processing 2 of 5
>>>>> ...processing 3 of 5
>>>>> Making transcripts
>>>>> Processing transcripts into genes
>>>>> in cluster:shadow cluster...
>>>>>  i_size:3 j_size:1
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> i_size:3   current i:0
>>>>> i_size:3   current i:1
>>>>> i_size:3   current i:2
>>>>> in cluster:shadow cluster...
>>>>>  i_size:0 j_size:0
>>>>> sorting hits in shadow cluster...
>>>>> ... finished.
>>>>> now careful_clustering....
>>>>> getting Pairs
>>>>> doing single linkage clustering
>>>>> ...processing 0 of 3
>>>>> ...processing 1 of 3
>>>>> Calculating annotation quality statistics
>>>>> Choosing best annotations
>>>>> 
>>>>> 
>>>>> Maker is now finished!!!
>>>>> 
>>>>> Segmentation fault
>>>>> 
>>>>> 
>>>>> 
>>>>> 
>>>>> _______________________________________________
>>>>> maker-devel mailing list
>>>>> maker-devel at box290.bluehost.com
>>>>> 
>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>g
>>>>> 
>>>>> _______________________________________________
>>>>> maker-devel mailing list
>>>>> maker-devel at box290.bluehost.com
>>>>> 
>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>g
>>>> 
>>>> 
>>> 
>> 
>> 
>





From alvinchen2002 at gmail.com  Tue Jun 19 23:48:10 2012
From: alvinchen2002 at gmail.com (Alvin Chen)
Date: Wed, 20 Jun 2012 01:48:10 -0400
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <CC06AB2D.EAE2%carsonhh@gmail.com>
References: <CC06AB2D.EAE2%carsonhh@gmail.com>
Message-ID: <6C911ABF-19AF-4EBB-A990-1ECE85ADD7E3@gmail.com>

Hey Carson, 

	It seems like there is a bug in Proc-ProcessTable 0.45.  I solved the problem by downgraded Proc-ProcessTable from 0.45 to 0.44. I can run 2.25 without any problems now. 

Cheers,
Alvin

On Jun 20, 2012, at 1:21 AM, Carson Holt wrote:

> Those are wrapped in an END block so they only run when perl exits (I.e.
> post completion or failure).  If 2.25 is failing it would likely be for
> another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
> -debug).  Does it produce any output before failure?
> 
> Thanks,
> Carson
> 
> 
> 
> 
> 
> On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
> 
>> Hey  Carson,
>> 
>> 	I am still using 2.10, because 2.25 get crashed at the beginning. I
>> think it may be caused by these codes:
>> 
>> Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>> maintainers
>> Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>> maintainers"
>> 
>> You have added them at the top of the scripts in the new version.
>> 
>> Alvin
>> 
>> On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>> 
>>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant MAKER
>>> version 2.25 (type maker -v to see the version you are using).  The
>>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>>> process fails to respond to signals upstream in the code.  The 2.25
>>> version of MAKER does some extra things that should even further avoid
>>> the
>>> need for the call compared to MAKER 2.10.
>>> 
>>> Thanks,
>>> Carson
>>> 
>>> 
>>> 
>>> 
>>> 
>>> 
>>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>>> 
>>>> Hey Carson and Gowthaman,
>>>> 
>>>> 	Thanks for your replies! You are right, Carson, the problem caused by
>>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>>> dpp_contig_master_datastore_index.log shows that the job has finished.
>>>> I
>>>> have installed the newest version of forks and forks::shared. but the
>>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>>> program still crashed at last, but it won't hurt.  I have tried the dpp
>>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>> genes
>>>> for dpp, is this number correct? I just want make sure everything works
>>>> fine and I will begin to use it with my data. Thanks!
>>>> 
>>>> Best,
>>>> Alvin
>>>> 
>>>> 
>>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>>> 
>>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>> fault
>>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>>> your
>>>>> system reaping the perl threads on completion.  You can try
>>>>> reinstalling
>>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>> the
>>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>>> really not affecting the output.  MAKER puts the results for each
>>>>> contig
>>>>> in a separate folder because some downstream programs like Apollo can
>>>>> only
>>>>> handle one contig at a time.  Use the
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file to see where each contigs output is stored.
>>>>> 
>>>>> 
>>>>> If you want a merged output file for everything, use the merge_gff
>>>>> script
>>>>> in maker and give it the
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file and it will assemble a merged output file for
>>>>> you.
>>>>> There are two type of output GFF3 which gives detailed annotation
>>>>> information and fasta which just produces sequence for each
>>>>> transcript.
>>>>> Use fasta_merge to get a merged fasta file for all contigs (giving it
>>>>> the
>>>>> same 
>>>>> 
>>>>> 
>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mast
>>>>> er
>>>>> _d
>>>>> atastore_index.log file).  The fiel you are interested will be the
>>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>>> 
>>>>> More information on MAKER's output here -->
>>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>>> 
>>>>> Thanks,
>>>>> Carson
>>>>> 
>>>>> 
>>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>>> 
>>>>>> Hi Alvin,
>>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>>> maker
>>>>>> did finish making the gff file successfully.
>>>>>> 
>>>>>> GFFs are actually buried deep down. One possibility is that you were
>>>>>> looking only in parent folders.
>>>>>> If you have not done already,  you might want to check for gffs at:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re/*/*/*. ie, three levels down your data store.
>>>>>> 
>>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>>> Failed/Finsihed ?
>>>>>> 
>>>>>> Gowthaman
>>>>>> ________________________________________
>>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>>> [alvinchen2002 at gmail.com]
>>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>>> To: maker-devel at yandell-lab.org
>>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>>> 
>>>>>> Hi,
>>>>>> 
>>>>>>     This is my first time to use maker. I have installed everything
>>>>>> that required by maker, and use the data in "data" folder to test
>>>>>> this
>>>>>> program. But I got a "Segmentation fault" message after "Maker is now
>>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have a
>>>>>> clue
>>>>>> of this?
>>>>>> 
>>>>>> Thanks,
>>>>>> Alvin
>>>>>> 
>>>>>> Here is the output of the program:
>>>>>> 
>>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>>> maker_exe.ctl
>>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>>> located
>>>>>> The blast_type 'ncbi' will be used instead.
>>>>>> 
>>>>>> A data structure will be created for you at:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re
>>>>>> 
>>>>>> To access files for individual sequences use the datastore index:
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_mas
>>>>>> te
>>>>>> r_
>>>>>> datastore_index.log
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> --Next Contig--
>>>>>> 
>>>>>> 
>>>>>> #---------------------------------------------------------------------
>>>>>> Now starting the contig!!
>>>>>> SeqID: contig-dpp-500-500
>>>>>> Length: 32156
>>>>>> 
>>>>>> #---------------------------------------------------------------------
>>>>>> 
>>>>>> 
>>>>>> running  repeat masker.
>>>>>> #--------- command -------------#
>>>>>> Widget::RepeatMasker:
>>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .0.all.rb -species all -dir
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>>> #-------------------------------#
>>>>>> processing output:
>>>>>> cycle 1
>>>>>> cycle 2
>>>>>> cycle 3
>>>>>> cycle 4
>>>>>> cycle 5
>>>>>> cycle 6
>>>>>> cycle 7
>>>>>> cycle 8
>>>>>> cycle 9
>>>>>> cycle 10
>>>>>> Generating output...
>>>>>> masking
>>>>>> done
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 0.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 1.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 2.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 3.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 4.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 5.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 6.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 7.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 8.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.1
>>>>>> 0.
>>>>>> 9.
>>>>>> repeatrunner
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:5 j_size:3
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:5   current i:0
>>>>>> i_size:5   current i:1
>>>>>> i_size:5   current i:2
>>>>>> i_size:5   current i:3
>>>>>> i_size:5   current i:4
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastn:
>>>>>> /usr/bin/blastall -p blastn -d
>>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>> -e
>>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>> -I T
>>>>>> -o 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>>> #-------------------------------#
>>>>>> deleted:-1 hits
>>>>>> formating database...
>>>>>> #--------- command -------------#
>>>>>> Widget::formater:
>>>>>> /usr/bin/formatdb -p T -i
>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>>> #-------------------------------#
>>>>>> running  blast search.
>>>>>> #--------- command -------------#
>>>>>> Widget::blastx:
>>>>>> /usr/bin/blastall -p blastx -d
>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>> 1e-06
>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> 
>>>>>> 
>>>>>> .0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.bla
>>>>>> st
>>>>>> x
>>>>>> #-------------------------------#
>>>>>> deleted:0 hits
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>>> #-------------------------------#
>>>>>> running  est2genome search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::est2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.fas
>>>>>> ta
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>> --showcigar --percent 20 >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>>> #-------------------------------#
>>>>>> cleaning blastn...
>>>>>> cleaning tblastx...
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>>> #-------------------------------#
>>>>>> running  exonerate search.
>>>>>> #--------- command -------------#
>>>>>> Widget::exonerate::protein2genome:
>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fast
>>>>>> a
>>>>>> -t 
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>> --softmasktarget
>>>>>> --percent 20 --showcigar  >
>>>>>> 
>>>>>> 
>>>>>> /home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_dat
>>>>>> as
>>>>>> to
>>>>>> 
>>>>>> 
>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-500
>>>>>> -5
>>>>>> 00
>>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>>> #-------------------------------#
>>>>>> cleaning blastx...
>>>>>> Preparing evidence for hint based annotation
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:15 j_size:1
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:15   current i:0
>>>>>> i_size:15   current i:1
>>>>>> i_size:15   current i:2
>>>>>> i_size:15   current i:3
>>>>>> i_size:15   current i:4
>>>>>> i_size:15   current i:5
>>>>>> i_size:15   current i:6
>>>>>> i_size:15   current i:7
>>>>>> i_size:15   current i:8
>>>>>> i_size:15   current i:9
>>>>>> i_size:15   current i:10
>>>>>> i_size:15   current i:11
>>>>>> i_size:15   current i:12
>>>>>> i_size:15   current i:13
>>>>>> i_size:15   current i:14
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:0 j_size:0
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> ...processing 0 of 5
>>>>>> ...processing 1 of 5
>>>>>> ...processing 2 of 5
>>>>>> ...processing 3 of 5
>>>>>> Making transcripts
>>>>>> Processing transcripts into genes
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:3 j_size:1
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> i_size:3   current i:0
>>>>>> i_size:3   current i:1
>>>>>> i_size:3   current i:2
>>>>>> in cluster:shadow cluster...
>>>>>> i_size:0 j_size:0
>>>>>> sorting hits in shadow cluster...
>>>>>> ... finished.
>>>>>> now careful_clustering....
>>>>>> getting Pairs
>>>>>> doing single linkage clustering
>>>>>> ...processing 0 of 3
>>>>>> ...processing 1 of 3
>>>>>> Calculating annotation quality statistics
>>>>>> Choosing best annotations
>>>>>> 
>>>>>> 
>>>>>> Maker is now finished!!!
>>>>>> 
>>>>>> Segmentation fault
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> _______________________________________________
>>>>>> maker-devel mailing list
>>>>>> maker-devel at box290.bluehost.com
>>>>>> 
>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>> g
>>>>>> 
>>>>>> _______________________________________________
>>>>>> maker-devel mailing list
>>>>>> maker-devel at box290.bluehost.com
>>>>>> 
>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.or
>>>>>> g
>>>>> 
>>>>> 
>>>> 
>>> 
>>> 
>> 
> 
> 




From carsonhh at gmail.com  Tue Jun 19 23:50:03 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 19 Jun 2012 22:50:03 -0700
Subject: [maker-devel] maker 2.10 Segmentation fault
In-Reply-To: <6C911ABF-19AF-4EBB-A990-1ECE85ADD7E3@gmail.com>
Message-ID: <CC06B280.EAF2%carsonhh@gmail.com>

Perfect.  And good to know.

Thanks,
Carson


On 12-06-19 10:48 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:

>Hey Carson, 
>
>	It seems like there is a bug in Proc-ProcessTable 0.45.  I solved the
>problem by downgraded Proc-ProcessTable from 0.45 to 0.44. I can run 2.25
>without any problems now.
>
>Cheers,
>Alvin
>
>On Jun 20, 2012, at 1:21 AM, Carson Holt wrote:
>
>> Those are wrapped in an END block so they only run when perl exits (I.e.
>> post completion or failure).  If 2.25 is failing it would likely be for
>> another reason.  Can you run 2.25 with the -debug flag set I.e. (maker
>> -debug).  Does it produce any output before failure?
>> 
>> Thanks,
>> Carson
>> 
>> 
>> 
>> 
>> 
>> On 12-06-19 10:15 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>> 
>>> Hey  Carson,
>>> 
>>> 	I am still using 2.10, because 2.25 get crashed at the beginning. I
>>> think it may be caused by these codes:
>>> 
>>> Proc::Signal::reap_children_by_name(15, 'maintain.pl'); #clean up
>>> maintainers
>>> Proc::Signal::reap_children_by_name(9, 'maintain.pl'); #clean up
>>> maintainers"
>>> 
>>> You have added them at the top of the scripts in the new version.
>>> 
>>> Alvin
>>> 
>>> On Jun 20, 2012, at 1:03 AM, Carson Holt wrote:
>>> 
>>>> Yes.  dpp_contig should produce 3 transcripts for 1 gene.  I meant
>>>>MAKER
>>>> version 2.25 (type maker -v to see the version you are using).  The
>>>> reap_children_by_name(9, 'maintain.pl') is basically a fallback if the
>>>> process fails to respond to signals upstream in the code.  The 2.25
>>>> version of MAKER does some extra things that should even further avoid
>>>> the
>>>> need for the call compared to MAKER 2.10.
>>>> 
>>>> Thanks,
>>>> Carson
>>>> 
>>>> 
>>>> 
>>>> 
>>>> 
>>>> 
>>>> On 12-06-19 8:57 PM, "Alvin Chen" <alvinchen2002 at gmail.com> wrote:
>>>> 
>>>>> Hey Carson and Gowthaman,
>>>>> 
>>>>> 	Thanks for your replies! You are right, Carson, the problem caused
>>>>>by
>>>>> "Proc::Signal::reap_children_by_name(9, 'maintain.pl');".
>>>>> dpp_contig_master_datastore_index.log shows that the job has
>>>>>finished.
>>>>> I
>>>>> have installed the newest version of forks and forks::shared. but the
>>>>> version is 0.34 not 2.25, is that correct? The bad news is that the
>>>>> program still crashed at last, but it won't hurt.  I have tried the
>>>>>dpp
>>>>> and hsap data in data folder, and I have got 6 genes for hsap and 3
>>>>> genes
>>>>> for dpp, is this number correct? I just want make sure everything
>>>>>works
>>>>> fine and I will begin to use it with my data. Thanks!
>>>>> 
>>>>> Best,
>>>>> Alvin
>>>>> 
>>>>> 
>>>>> On Jun 19, 2012, at 11:39 AM, Carson Holt wrote:
>>>>> 
>>>>>> The "Maker is now finished" message occurs before the Segmentation
>>>>>> fault
>>>>>> so it is finished.  The Segmentation fault is probably an issue with
>>>>>> your
>>>>>> system reaping the perl threads on completion.  You can try
>>>>>> reinstalling
>>>>>> the forks and forks::shared from CPAN.  Also make sure you are using
>>>>>> the
>>>>>> 2.25 version and no 2.10.  But your job is finished anyways, so it's
>>>>>> really not affecting the output.  MAKER puts the results for each
>>>>>> contig
>>>>>> in a separate folder because some downstream programs like Apollo
>>>>>>can
>>>>>> only
>>>>>> handle one contig at a time.  Use the
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file to see where each contigs output is stored.
>>>>>> 
>>>>>> 
>>>>>> If you want a merged output file for everything, use the merge_gff
>>>>>> script
>>>>>> in maker and give it the
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file and it will assemble a merged output file
>>>>>>for
>>>>>> you.
>>>>>> There are two type of output GFF3 which gives detailed annotation
>>>>>> information and fasta which just produces sequence for each
>>>>>> transcript.
>>>>>> Use fasta_merge to get a merged fasta file for all contigs (giving
>>>>>>it
>>>>>> the
>>>>>> same 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_ma
>>>>>>st
>>>>>> er
>>>>>> _d
>>>>>> atastore_index.log file).  The fiel you are interested will be the
>>>>>> maker.pteins.fasta and maker.transcripts.fasta file.
>>>>>> 
>>>>>> More information on MAKER's output here -->
>>>>>> http://gmod.org/wiki/MAKER_Tutorial#MAKER.27s_Output
>>>>>> 
>>>>>> Thanks,
>>>>>> Carson
>>>>>> 
>>>>>> 
>>>>>> On 12-06-18 2:16 PM, "Gowthaman Ramasamy"
>>>>>> <gowthaman.ramasamy at seattlebiomed.org> wrote:
>>>>>> 
>>>>>>> Hi Alvin,
>>>>>>> I am a relatively new user too. I too get "seg fault" even though,
>>>>>>> maker
>>>>>>> did finish making the gff file successfully.
>>>>>>> 
>>>>>>> GFFs are actually buried deep down. One possibility is that you
>>>>>>>were
>>>>>>> looking only in parent folders.
>>>>>>> If you have not done already,  you might want to check for gffs at:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re/*/*/*. ie, three levels down your data store.
>>>>>>> 
>>>>>>> what does "dpp_contig_master_datastore_index.log" says?
>>>>>>> Failed/Finsihed ?
>>>>>>> 
>>>>>>> Gowthaman
>>>>>>> ________________________________________
>>>>>>> From: maker-devel-bounces at yandell-lab.org
>>>>>>> [maker-devel-bounces at yandell-lab.org] On Behalf Of Alvin Chen
>>>>>>> [alvinchen2002 at gmail.com]
>>>>>>> Sent: Friday, June 15, 2012 12:41 PM
>>>>>>> To: maker-devel at yandell-lab.org
>>>>>>> Subject: [maker-devel] maker 2.10 Segmentation fault
>>>>>>> 
>>>>>>> Hi,
>>>>>>> 
>>>>>>>     This is my first time to use maker. I have installed everything
>>>>>>> that required by maker, and use the data in "data" folder to test
>>>>>>> this
>>>>>>> program. But I got a "Segmentation fault" message after "Maker is
>>>>>>>now
>>>>>>> finished!!!". And I can't find gff file anywhere. Does anyone have
>>>>>>>a
>>>>>>> clue
>>>>>>> of this?
>>>>>>> 
>>>>>>> Thanks,
>>>>>>> Alvin
>>>>>>> 
>>>>>>> Here is the output of the program:
>>>>>>> 
>>>>>>> [yc136 at mmrl-n01 data]$ maker maker_opts.ctl maker_bopts.ctl
>>>>>>> maker_exe.ctl
>>>>>>> WARNING: blast_type is set to 'wublast' but executables cannot be
>>>>>>> located
>>>>>>> The blast_type 'ncbi' will be used instead.
>>>>>>> 
>>>>>>> A data structure will be created for you at:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re
>>>>>>> 
>>>>>>> To access files for individual sequences use the datastore index:
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_m
>>>>>>>as
>>>>>>> te
>>>>>>> r_
>>>>>>> datastore_index.log
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> --Next Contig--
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>#-------------------------------------------------------------------
>>>>>>>--
>>>>>>> Now starting the contig!!
>>>>>>> SeqID: contig-dpp-500-500
>>>>>>> Length: 32156
>>>>>>> 
>>>>>>> 
>>>>>>>#-------------------------------------------------------------------
>>>>>>>--
>>>>>>> 
>>>>>>> 
>>>>>>> running  repeat masker.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::RepeatMasker:
>>>>>>> /home/mmrl/yc136/bin/RepeatMasker/RepeatMasker
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .0.all.rb -species all -dir
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500 -pa 1
>>>>>>> #-------------------------------#
>>>>>>> processing output:
>>>>>>> cycle 1
>>>>>>> cycle 2
>>>>>>> cycle 3
>>>>>>> cycle 4
>>>>>>> cycle 5
>>>>>>> cycle 6
>>>>>>> cycle 7
>>>>>>> cycle 8
>>>>>>> cycle 9
>>>>>>> cycle 10
>>>>>>> Generating output...
>>>>>>> masking
>>>>>>> done
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.0 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 0.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.1 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 1.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.2 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 2.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.3 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 3.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.4 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 4.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.5 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 5.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.6 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 6.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.7 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 7.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.8 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 8.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/te_proteins%2Efasta.mpi.10.9 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi
>>>>>>>.1
>>>>>>> 0.
>>>>>>> 9.
>>>>>>> repeatrunner
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:5 j_size:3
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:5   current i:0
>>>>>>> i_size:5   current i:1
>>>>>>> i_size:5   current i:2
>>>>>>> i_size:5   current i:3
>>>>>>> i_size:5   current i:4
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p F -i /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastn:
>>>>>>> /usr/bin/blastall -p blastn -d
>>>>>>> /tmp/maker_MsJuiW/dpp_est%2Efasta.mpi.1.0
>>>>>>> -i /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000
>>>>>>> -e
>>>>>>> 1e-10 -E 3 -W 15 -r 1 -q -3 -G 3 -z 1000 -Y 500000000 -a 1 -U -F T
>>>>>>> -I T
>>>>>>> -o 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .0.dpp_est%2Efasta.blastn.temp_dir/dpp_est%2Efasta.mpi.1.0.blastn
>>>>>>> #-------------------------------#
>>>>>>> deleted:-1 hits
>>>>>>> formating database...
>>>>>>> #--------- command -------------#
>>>>>>> Widget::formater:
>>>>>>> /usr/bin/formatdb -p T -i
>>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0
>>>>>>> #-------------------------------#
>>>>>>> running  blast search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::blastx:
>>>>>>> /usr/bin/blastall -p blastx -d
>>>>>>> /tmp/maker_MsJuiW/dpp_protein%2Efasta.mpi.1.0 -i
>>>>>>> /tmp/maker_MsJuiW/rank0/contig-dpp-500-500.0 -b 100000 -v 100000 -e
>>>>>>> 1e-06
>>>>>>> -z 300 -Y 500000000 -a 1 -U -F T -I T -o
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>.0.dpp_protein%2Efasta.blastx.temp_dir/dpp_protein%2Efasta.mpi.1.0.b
>>>>>>>la
>>>>>>> st
>>>>>>> x
>>>>>>> #-------------------------------#
>>>>>>> deleted:0 hits
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-5.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26586-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26586-31847.dpp-mRNA-5.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-4.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .23089-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .23089-31847.dpp-mRNA-4.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-3.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .22854-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .22854-31847.dpp-mRNA-3.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-2.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .20908-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .20908-31847.dpp-mRNA-2.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  est2genome search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::est2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate  -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-mRNA-1.f
>>>>>>>as
>>>>>>> ta
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26901-31847.fasta -Q dna -T dna --model est2genome  --minintron 20
>>>>>>> --showcigar --percent 20 >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26901-31847.dpp-mRNA-1.est_exonerate
>>>>>>> #-------------------------------#
>>>>>>> cleaning blastn...
>>>>>>> cleaning tblastx...
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-5.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-5.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-4.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-4.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-3.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-3.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-2.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-2.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> running  exonerate search.
>>>>>>> #--------- command -------------#
>>>>>>> Widget::exonerate::protein2genome:
>>>>>>> /home/mmrl/yc136/bin/exonerate-2.2.0-x86_64/bin/exonerate -q
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/dpp-CDS-1.fa
>>>>>>>st
>>>>>>> a
>>>>>>> -t 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.fasta -Q protein -T dna -m protein2genome
>>>>>>> --softmasktarget
>>>>>>> --percent 20 --showcigar  >
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>/home/mmrl/yc136/bin/maker/data/dpp_contig.maker.output/dpp_contig_d
>>>>>>>at
>>>>>>> as
>>>>>>> to
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>>re/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/contig-dpp-5
>>>>>>>00
>>>>>>> -5
>>>>>>> 00
>>>>>>> .26918-30804.dpp-CDS-1.p_exonerate
>>>>>>> #-------------------------------#
>>>>>>> cleaning blastx...
>>>>>>> Preparing evidence for hint based annotation
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:15 j_size:1
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:15   current i:0
>>>>>>> i_size:15   current i:1
>>>>>>> i_size:15   current i:2
>>>>>>> i_size:15   current i:3
>>>>>>> i_size:15   current i:4
>>>>>>> i_size:15   current i:5
>>>>>>> i_size:15   current i:6
>>>>>>> i_size:15   current i:7
>>>>>>> i_size:15   current i:8
>>>>>>> i_size:15   current i:9
>>>>>>> i_size:15   current i:10
>>>>>>> i_size:15   current i:11
>>>>>>> i_size:15   current i:12
>>>>>>> i_size:15   current i:13
>>>>>>> i_size:15   current i:14
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:0 j_size:0
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> ...processing 0 of 5
>>>>>>> ...processing 1 of 5
>>>>>>> ...processing 2 of 5
>>>>>>> ...processing 3 of 5
>>>>>>> Making transcripts
>>>>>>> Processing transcripts into genes
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:3 j_size:1
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> i_size:3   current i:0
>>>>>>> i_size:3   current i:1
>>>>>>> i_size:3   current i:2
>>>>>>> in cluster:shadow cluster...
>>>>>>> i_size:0 j_size:0
>>>>>>> sorting hits in shadow cluster...
>>>>>>> ... finished.
>>>>>>> now careful_clustering....
>>>>>>> getting Pairs
>>>>>>> doing single linkage clustering
>>>>>>> ...processing 0 of 3
>>>>>>> ...processing 1 of 3
>>>>>>> Calculating annotation quality statistics
>>>>>>> Choosing best annotations
>>>>>>> 
>>>>>>> 
>>>>>>> Maker is now finished!!!
>>>>>>> 
>>>>>>> Segmentation fault
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> 
>>>>>>> _______________________________________________
>>>>>>> maker-devel mailing list
>>>>>>> maker-devel at box290.bluehost.com
>>>>>>> 
>>>>>>> 
>>>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.
>>>>>>>or
>>>>>>> g
>>>>>>> 
>>>>>>> _______________________________________________
>>>>>>> maker-devel mailing list
>>>>>>> maker-devel at box290.bluehost.com
>>>>>>> 
>>>>>>> 
>>>>>>>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.
>>>>>>>or
>>>>>>> g
>>>>>> 
>>>>>> 
>>>>> 
>>>> 
>>>> 
>>> 
>> 
>> 
>





From scott at scottcain.net  Fri Jun 22 08:55:56 2012
From: scott at scottcain.net (Scott Cain)
Date: Fri, 22 Jun 2012 10:55:56 -0400
Subject: [maker-devel] Applications open for GMOD Summer School 2012
Message-ID: <CA+JTaoz5z=hMqqpvRogmuTHdOrGBnqNHy510dxH0y68v0u1HNA@mail.gmail.com>

Applications are now being accepted for the 2012 GMOD Summer School
course, a five-day hands-on school aimed at teaching new GMOD
administrators how to install, configure and integrate popular GMOD
Components. The course will be held August 25-29 at the US National
Evolutionary Synthesis Center (NESCent) in Durham, North Carolina.

 https://docs.google.com/a/scottcain.net/spreadsheet/embeddedform?formkey=dG5hNGFiQ3UwYTV2LUZxZW04Qm1yZXc6MQ

These components will be covered at the school:

   Apollo or WebApollo - genome annotation editor
   Chado - biological database schema
   Galaxy - workflow system
   GBrowse - genome viewer
   GBrowse_syn - synteny viewer
   GFF3 - genome annotation file format and tools
   InterMine - biological data mining system
   JBrowse - next generation genome browser
   MAKER - genome annotation pipeline
   Tripal - web front end to Chado databases


The deadline for applying is the end of July 9, 2012. Admission is
competitive and is based on the strength of the application,
especially the statement of interest. The 2011 school had over 70
applicants for the 25 slots. Any application received after deadline
will be automatically placed on the waiting list.

The course requires some knowledge of Linux as a prerequisite. The
registration fee will be $300 (only $60 per day). There will be a
limited number of scholarships available.

Thanks,

Scott Cain

-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
Ontario Institute for Cancer Research



From sajeet at gmail.com  Mon Jun 25 18:41:01 2012
From: sajeet at gmail.com (Sajeet Haridas)
Date: Mon, 25 Jun 2012 17:41:01 -0700
Subject: [maker-devel] ERROR: Chunk failed at level 20
Message-ID: <000001cd5334$5c955df0$15c019d0$@com>

Hello,

I am running Maker 2.10 on two versions (using two assembly programs) of a
fungal genome (~33Mbp). While one completes successfully, the other does
not. One of the scaffolds (out of 65) throws the following error.

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Calling translate without a seq argument!
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
STACK: Bio::Tools::CodonTable::translate
/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
STACK: PhatHit_utils::_adjust
/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
STACK: PhatHit_utils::adjust_start_stop
/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
STACK: maker::auto_annotator::load_transcript_struct
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
STACK: maker::auto_annotator::group_transcripts
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
STACK: maker::auto_annotator::annotate_genes
/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
STACK: Process::MpiChunk::_go
/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
STACK: Process::MpiChunk::run
/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
STACK: Process::MpiTiers::run_all
/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
STACK: /opt/maker_2.10/bin/maker:276
-----------------------------------------------------------

FATAL ERROR
ERROR: Failed while clustering transcripts into genes for annotations!!

ERROR: Chunk failed at level 20
!!


Any help appreciated.

Thank you,

Sajeet




From carsonhh at gmail.com  Tue Jun 26 08:07:09 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Tue, 26 Jun 2012 10:07:09 -0400
Subject: [maker-devel] ERROR: Chunk failed at level 20
In-Reply-To: <000001cd5334$5c955df0$15c019d0$@com>
Message-ID: <CC0F3A2F.ED74%carsonhh@gmail.com>

Have you tried the most current version, 2.25?

Thanks,
Carson


On 12-06-25 8:41 PM, "Sajeet Haridas" <sajeet at gmail.com> wrote:

>Hello,
>
>I am running Maker 2.10 on two versions (using two assembly programs) of a
>fungal genome (~33Mbp). While one completes successfully, the other does
>not. One of the scaffolds (out of 65) throws the following error.
>
>------------- EXCEPTION: Bio::Root::Exception -------------
>MSG: Calling translate without a seq argument!
>STACK: Error::throw
>STACK: Bio::Root::Root::throw
>/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
>STACK: Bio::Tools::CodonTable::translate
>/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
>STACK: PhatHit_utils::_adjust
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
>STACK: PhatHit_utils::adjust_start_stop
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
>STACK: maker::auto_annotator::load_transcript_struct
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
>STACK: maker::auto_annotator::group_transcripts
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
>STACK: maker::auto_annotator::annotate_genes
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
>STACK: Process::MpiChunk::_go
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
>STACK: Process::MpiChunk::run
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
>STACK: Process::MpiTiers::run_all
>/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
>STACK: /opt/maker_2.10/bin/maker:276
>-----------------------------------------------------------
>
>FATAL ERROR
>ERROR: Failed while clustering transcripts into genes for annotations!!
>
>ERROR: Chunk failed at level 20
>!!
>
>
>Any help appreciated.
>
>Thank you,
>
>Sajeet
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From sajeet at gmail.com  Tue Jun 26 11:45:05 2012
From: sajeet at gmail.com (Sajeet Haridas)
Date: Tue, 26 Jun 2012 10:45:05 -0700
Subject: [maker-devel] ERROR: Chunk failed at level 20
In-Reply-To: <CC0F3A2F.ED74%carsonhh@gmail.com>
References: <000001cd5334$5c955df0$15c019d0$@com>
	<CC0F3A2F.ED74%carsonhh@gmail.com>
Message-ID: <000601cd53c3$6bed89f0$43c89dd0$@com>

Thank you.
It seems to work with 2.25.

Sajeet

-----Original Message-----
From: Carson Holt [mailto:carsonhh at gmail.com] 
Sent: June-26-12 7:07 AM
To: Sajeet Haridas; maker-devel at yandell-lab.org
Subject: Re: [maker-devel] ERROR: Chunk failed at level 20

Have you tried the most current version, 2.25?

Thanks,
Carson


On 12-06-25 8:41 PM, "Sajeet Haridas" <sajeet at gmail.com> wrote:

>Hello,
>
>I am running Maker 2.10 on two versions (using two assembly programs) 
>of a fungal genome (~33Mbp). While one completes successfully, the 
>other does not. One of the scaffolds (out of 65) throws the following
error.
>
>------------- EXCEPTION: Bio::Root::Exception -------------
>MSG: Calling translate without a seq argument!
>STACK: Error::throw
>STACK: Bio::Root::Root::throw
>/usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
>STACK: Bio::Tools::CodonTable::translate
>/usr/local/share/perl/5.10.1/Bio/Tools/CodonTable.pm:409
>STACK: PhatHit_utils::_adjust
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:880
>STACK: PhatHit_utils::adjust_start_stop
>/opt/maker_2.10/bin/../lib/PhatHit_utils.pm:776
>STACK: maker::auto_annotator::load_transcript_struct
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:1808
>STACK: maker::auto_annotator::group_transcripts
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:2163
>STACK: maker::auto_annotator::annotate_genes
>/opt/maker_2.10/bin/../lib/maker/auto_annotator.pm:877
>STACK: Process::MpiChunk::_go
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:2159
>STACK: Process::MpiChunk::run
>/opt/maker_2.10/bin/../lib/Process/MpiChunk.pm:257
>STACK: Process::MpiTiers::run_all
>/opt/maker_2.10/bin/../lib/Process/MpiTiers.pm:193
>STACK: /opt/maker_2.10/bin/maker:276
>-----------------------------------------------------------
>
>FATAL ERROR
>ERROR: Failed while clustering transcripts into genes for annotations!!
>
>ERROR: Chunk failed at level 20
>!!
>
>
>Any help appreciated.
>
>Thank you,
>
>Sajeet
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org






From ranjani at uga.edu  Wed Jun 27 07:49:02 2012
From: ranjani at uga.edu (Sivaranjani Namasivayam)
Date: Wed, 27 Jun 2012 13:49:02 +0000
Subject: [maker-devel] Re-annotation
Message-ID: <A21F03FBB429334EB4D450CC75E8CBF3487DC468@CH1PRD0210MB384.namprd02.prod.outlook.com>

Hi,

I have a quick question about re-annotation. Under the re-annotation section, the provided maker's gff file from a previous run and set est_pass, altest_pass, protein_pass, rm_pass to 1.
I also provided some EST evidence (to the tag est) under the EST evidence section, but I don't see these ESTs being mapped to the genome (no blastn or est2genome) in the output gff files.
Is this expected?

Thanks,
Ranjani
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120627/f10008ce/attachment-0003.html>

From carsonhh at gmail.com  Wed Jun 27 09:43:14 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 27 Jun 2012 11:43:14 -0400
Subject: [maker-devel] Re-annotation
In-Reply-To: <A21F03FBB429334EB4D450CC75E8CBF3487DC468@CH1PRD0210MB384.namprd02.prod.outlook.com>
Message-ID: <CC10A193.EDB9%carsonhh@gmail.com>

If the new ESTs don't map within the threshold parameters set in the
maker_bopt.ctl file, then you would not expect new results.  Don't be
surprised if the new results are just hard to identify within the context of
the ESTs already being passed back through.  If you want to test the new
ESTs, then set est_pass to 0 during your next run and see if there are still
no ESTs.

Thanks,
Carson



From:  Sivaranjani Namasivayam <ranjani at uga.edu>
Date:  Wednesday, 27 June, 2012 9:49 AM
To:  "maker-devel at yandell-lab.org" <maker-devel at yandell-lab.org>
Subject:  [maker-devel] Re-annotation

Hi,

I have a quick question about re-annotation. Under the re-annotation
section, the provided maker's gff file from a previous run and set est_pass,
altest_pass, protein_pass, rm_pass to 1.
I also provided some EST evidence (to the tag est) under the EST evidence
section, but I don't see these ESTs being mapped to the genome (no blastn or
est2genome) in the output gff files.
Is this expected?

Thanks,
Ranjani
_______________________________________________ maker-devel mailing list
maker-devel at box290.bluehost.com
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120627/4afce4ea/attachment-0003.html>

From lei.liu.conze at slu.se  Wed Jun 27 08:26:35 2012
From: lei.liu.conze at slu.se (Lei Conze Liu)
Date: Wed, 27 Jun 2012 16:26:35 +0200
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
Message-ID: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>

Hi,

I just downloaded the recent version of maker-2.10.tgz but I can not
find the folder "bin" where contains the MAKER executables. Am I missing
something? It would be great if somebody can help me with that.

Greetings,

Lei

From carsonhh at gmail.com  Wed Jun 27 09:51:08 2012
From: carsonhh at gmail.com (Carson Holt)
Date: Wed, 27 Jun 2012 11:51:08 -0400
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
Message-ID: <CC10A299.EDC3%carsonhh@gmail.com>

You need to go to the maker/src/ directory and run 'perl Build.PL'.  Then
run './Build install'.

Note that if you are by any chance are using the CPAN module 'local::lib'
on your system which redefines certain Perl installation parameters
affecting CPAN and Module::Build that those changes will cause MAKER (as
well as many other things in Perl) to install to a non-standard location
(in ~/perl5/bin usually) and if that is the case you should use maker
version 2.25 instead of 2.10 to get the install to complete correctly.

Thanks,
Carson





On 12-06-27 10:26 AM, "Lei Conze Liu" <lei.liu.conze at slu.se> wrote:

>Hi,
>
>I just downloaded the recent version of maker-2.10.tgz but I can not
>find the folder "bin" where contains the MAKER executables. Am I missing
>something? It would be great if somebody can help me with that.
>
>Greetings,
>
>Lei
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org





From lei.liu.conze at slu.se  Wed Jun 27 14:33:04 2012
From: lei.liu.conze at slu.se (Lei Conze Liu)
Date: Wed, 27 Jun 2012 22:33:04 +0200
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
References: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
Message-ID: <11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>

Dear all,

Thank you very much for the quick reply. I appreciate it very much.
I have indeed gone to the maker/src directory and have run 'perl Build.PL' and './Build install', but still misses the 'bin' folder.
As Carson have kindly pointed out that I might run into this kind of problem if I am using CPAN module 'local::lib' which I think I might be. So tomorrow I will try to install the 2.25 version and let you know how it goes.

Many thanks!

Greetings from Sweden

Lei


On 27 Jun 2012, at 16:26, Lei Conze Liu wrote:

Hi,

I just downloaded the recent version of maker-2.10.tgz but I can not
find the folder "bin" where contains the MAKER executables. Am I missing
something? It would be great if somebody can help me with that.

Greetings,

Lei
_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20120627/44c08a8c/attachment-0003.html>

From cjfields at illinois.edu  Wed Jun 27 14:41:25 2012
From: cjfields at illinois.edu (Fields, Christopher J)
Date: Wed, 27 Jun 2012 20:41:25 +0000
Subject: [maker-devel] Folder "bin" is missing in maker-2.10.tgz
In-Reply-To: <11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>
References: <F8654B7AE398594CA1303A03ED8BEF3F64FC7BCF8F@exmbx1.ad.slu.se>
	<11A867C4-4B4C-46EB-9067-5505267C9BA7@slu.se>
Message-ID: <CC9C6F22-A8A4-4AE3-83BE-E0B5D20AD736@illinois.edu>

I got v2.25 working with local::lib myself.  I plan on using that along with a loadable module (via http://modules.sourceforge.net/) to make launching maker as easy as possible (and also allow us to keep separate contained versions on the cluster w/o having to bend over backwards with env settings).

chris

On Jun 27, 2012, at 3:33 PM, Lei Conze Liu wrote:

> Dear all,
> 
> Thank you very much for the quick reply. I appreciate it very much. 
> I have indeed gone to the maker/src directory and have run 'perl Build.PL' and './Build install', but still misses the 'bin' folder.
> As Carson have kindly pointed out that I might run into this kind of problem if I am using CPAN module 'local::lib' which I think I might be. So tomorrow I will try to install the 2.25 version and let you know how it goes. 
> 
> Many thanks!
> 
> Greetings from Sweden
> 
> Lei
> 
> 
> On 27 Jun 2012, at 16:26, Lei Conze Liu wrote:
> 
>> Hi,
>> 
>> I just downloaded the recent version of maker-2.10.tgz but I can not
>> find the folder "bin" where contains the MAKER executables. Am I missing
>> something? It would be great if somebody can help me with that.
>> 
>> Greetings,
>> 
>> Lei
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
> 
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org




From markus.ankenbrand at stud-mail.uni-wuerzburg.de  Thu Jun 28 08:03:20 2012
From: markus.ankenbrand at stud-mail.uni-wuerzburg.de (Markus Ankenbrand)
Date: Thu, 28 Jun 2012 16:03:20 +0200
Subject: [maker-devel] maker-2.24 fails while preparing evidence clusters
Message-ID: <4FEC6428.3010108@stud-mail.uni-wuerzburg.de>

Hi all,

I'm using maker-2.24 to annotate contigs of a procaryotic organism. I'm
only using coding sequences of a reference species as "altest". Without
any obvious reason annotation fails for some contigs. It seems to have
nothing to do with the contig length. I also tried to run maker with
different reference ESTs and GeneMark. Depending on the setup different
contigs fail.

In case of failure, the log is:
...
cleaning clusters....
total clusters:3 now processing 0
   ...processing 0 of 3
   ...processing 1 of 3
total clusters:3 now processing 0
total clusters:3 now processing 0
   ...processing 0 of 2
Can't call method "start" on an undefined valueERROR: Failed while
preparing evidence clusters for annotations
ERROR: Chunk failed at level:0, tier_type:3
FAILED CONTIG:contig1

ERROR: Chunk failed at level:7, tier_type:0
FAILED CONTIG:contig1

--Next Contig--
...

If someone has any idea how to solve this problem, help would be very
much apriciated.

Greetings,
Markus



From fourie.joubert at up.ac.za  Thu Jun 28 09:11:31 2012
From: fourie.joubert at up.ac.za (Fourie Joubert)
Date: Thu, 28 Jun 2012 17:11:31 +0200
Subject: [maker-devel] Advice for optimizing augustus training on fungal
	genome?
Message-ID: <4FEC7423.3050001@up.ac.za>

Hi Everyone

Apologies if this is not the relevant list to mail to.

I am looking for advice in training augustus for a novel fungal genome.

I generated a gene set using CEGMA (below), and have subsequently been 
following the instructions at 
http://www.molecularevolution.org/molevolfiles/exercises/augustus/scipio.html 
and at 
http://www.molecularevolution.org/molevolfiles/exercises/augustus/training.html.

My training set is 339 genes and the test set is 100 genes.

My initial output is below.

It does not improve much with optimize_augustus.

When using the training paramters to predict genes in the genome, I seem 
to only find around 2,000 of the known ~16,000 genes. When I use the 
training data from a distantly related fungus (Neurospora), I get 
roughly the correct number of genes.

I am obviously doing something wrong here... (commands below).

I would really appreciate any advice on where to start looking for 
improvement.

Kindest regards!

Fourie





Augustus commands (Editedmyspecies_parameters.cfg  and setstopCodonExcludedFromCDS  to true.):

>  etraining --species=myspecies genes.gb.train

>  augustus --species=myspecies genes.gb.test | tee firsttest.out

>  grep -A 22 Evaluation firsttest.out

>  optimize_augustus.pl --species=myspecies genes.gb.train

>  etraining --species=myspecies genes.gb.train

>  augustus --species=myspecies genes.gb.test | tee secondtest.out

>  grep -A 22 Evaluation secondtest.out



CEGMA output:

#      Statistics of the completeness of the genome based on 248 CEGs      #

               #Prots  %Completeness  -  #Total  Average  %Ortho

   Complete      240       96.77      -   278     1.16     11.67

    Group 1       64       96.97      -    72     1.12      7.81
    Group 2       54       96.43      -    66     1.22     18.52
    Group 3       58       95.08      -    70     1.21     13.79
    Group 4       64       98.46      -    70     1.09      7.81

    Partial      245       98.79      -   290     1.18     13.88

    Group 1       65       98.48      -    73     1.12      7.69
    Group 2       56      100.00      -    70     1.25     21.43
    Group 3       59       96.72      -    75     1.27     18.64
    Group 4       65      100.00      -    72     1.11      9.23




Augustus output:

*******      Evaluation of gene prediction     *******

---------------------------------------------\

                  | sensitivity | specificity |

---------------------------------------------|

nucleotide level |       0.933 |       0.772 |

---------------------------------------------/

----------------------------------------------------------------------------------------------------------\

            |  #pred |  #anno |      |    FP = false pos. |    FN = false neg. |             |             |

            | total/ | total/ |   TP |--------------------|--------------------| sensitivity | specificity |

            | unique | unique |      | part | ovlp | wrng | part | ovlp | wrng |             |             |

----------------------------------------------------------------------------------------------------------|

            |        |        |      |                229 |                 85 |             |             |

exon level |    475 |    331 |  246 | ------------------ | ------------------ |       0.743 |       0.518 |

            |    475 |    331 |      |   59 |    9 |  161 |   56 |    2 |   27 |             |             |

----------------------------------------------------------------------------------------------------------/

----------------------------------------------------------------------------\

transcript | #pred | #anno |   TP |   FP |   FN | sensitivity | specificity |

----------------------------------------------------------------------------|

gene level |   158 |   100 |   45 |  113 |   55 |        0.45 |       0.285 |

----------------------------------------------------------------------------/




-- 
--------------
Prof Fourie Joubert
Bioinformatics and Computational Biology Unit
Department of Biochemistry
University of Pretoria
fourie.joubert at up.ac.za
http://www.bi.up.ac.za
Tel. +27-12-420-5825
Fax. +27-12-420-5800

-------------------------------------------------------------------------
This message and attachments are subject to a disclaimer. Please refer
to www.it.up.ac.za/documentation/governance/disclaimer/ for full details.