[maker-devel] Alternative start codons
Carson Holt
carsonhh at gmail.com
Tue Mar 19 13:33:46 MDT 2013
It could be changed. I imagine that this is a protein2genome or
est2genome gene, as MAKER won't try and determine by itself the start and
end if it comes from a gene predictor.
--Carson
On 13-03-19 3:04 PM, "Fields, Christopher J" <cjfields at illinois.edu> wrote:
>We had a user notice that MAKER is not observing alternative start codons
>for bacterial genomes. For instance, this predicted transcript:
>
>>Xf_Mul_000007-RA transcript Name:"Protein of unknown function" offset:79
>>AED:0.42 eAED:1.00 QI:79|-1|0|1|-1|1|1|20|24
>GTGGGATACAGGCCGCTGATCGCTGATGGCGCGTACCTGAAACTGCTGCTGGACTACTAC
>GTTACAGTGCAGCCTTTGCATGCCGATTGGAAAGATCTATATATCATCGCTTGCGCTATT
>ACAGCGGCTAAAAAGAGTCTTCAATTTGGCGTAATTCAGTCATTGGCGGGGTAG
>
>Yields this protein sequence.
>
>>Xf_Mul_000007-RA protein AED:0.42 eAED:1.00 QI:79|-1|0|1|-1|1|1|20|24
>MPIGKIYISSLALLQRLKRVFNLA
>
>I'm pretty sure I know what is going on, namely that MAKER is treating
>the 5' end as UTR and looking for the first ATG (there is one in the
>sequence above). Is there any way to change this behavior, though? For
>instance, allow alternative start codons like GTG/TTG?
>
>chris
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
More information about the maker-devel
mailing list