[maker-devel] quality_filter.pl script -question for Mike Campbell

Jason Gallant jgallant at msu.edu
Tue Nov 3 20:20:45 MST 2015


Hi Mike,

I’ve done a little digging on my own, and I think I have traced the issue…
it appears that the script is being thrown for the first time when it
encounters the line containing the first FASTA sequence header in the GFF
file.  For example:

Scaffold435 blastx match_part 102606 102851 201 - .
ID=Scaffold435:hsp:71210:3.10.1.2;Parent=Scaffold435:hit:24267:3.10.1.2;Target=gi|37594442|ref|NP_003431.2|
161 242;Gap=M82
Scaffold435 blastx match_part 102528 102851 173 - .
ID=Scaffold435:hsp:71211:3.10.1.2;Pare##FASTA
>Scaffold3579
GCAGTAGGCTGTGATACGTTTGCACCCGGGGACTAAGGGGAGATGTGTACAGGATGGGGA
GATGTGTACAGGATGGGGAGATGTGTACAGGATGGAGGGGTCCGTGCGAGAGCGTACCAC
GTGTCTCCCGTGCAGTGGTGCGGCGTGTACTTGATGCGATAAGCCACAGGGTCCTGCTTC
CCATCCTCCATGATCATTTTCATCCGCAGCGTGACCTCCCCCTCAGAAAAGACCCCCTTC
CTCATCCTCTCAAAGAGCACCAGAGATTCCTCAATCGGCCGATCCCTCCAAGGGGACAGG
GGAGGGCTGTGGCCCTTCAGCTCCTCCACACGCTGGTGACACACATAGGCGAGGCCCCTG
GATGCAGAACAGTGCAGACAGTGACATACCATTCACATGACACTGATCCGGTTAAGCCAC
ACGCGATACAATACAGTGTCATCATCAGGAAGAAGGGGAAACAGAGGCGTCAAAACGCCC
TATGAAGAGAGGAGTCTGCTTGCACTCACCGGCGAATAAGATCCACTGCGAGGTCGTACA
GCTTTTGGAAGTGGTCAGACGCGTGGGTCACTGCATAGGGCGTGTACCCTGTTTTACAGA

Perl complains when it encounters the line containing >Scaffold3579 and
pretty much every line thereafter.  Intriguingly, it would appear that the
preceding line appears to be truncated compared to those before it.  I can
trace this all the way back to the output of gff3_merge for several files.
Not sure what to do here (or if you can help!).

Best,
Jason




On Tue, Nov 3, 2015 at 4:06 PM Michael Campbell <
michael.s.campbell1 at gmail.com> wrote:

> Hi Jason,
>
> It could be a couple of things. If you have a cut down version of your
> gff3 that I can use to recreate the error I can debug it. The
> quality_filter.pl script is still a pretty young accessory script, so you
> may have something in your file that It wasn’t tested against.
>
> Thanks,
> Mike
>
>
>
> On Nov 3, 2015, at 2:48 PM, Jason Gallant <jgallant at msu.edu> wrote:
>
> Hi Mike (list copied for future reference),
>
> I found your very nice protocols paper on using Maker from 2014.  I’ve
> been following it to the letter as I’m wrapping up my annotation project.
>
> I’ve located your quality_filter.pl script and am using it on my GFF
> files to create maker standard and maker default data sets from my
> maker-max GFF file.  I’m noticing that perl complains a lot while this is
> running about “use of uninitialized value”.  This occurs on two separate
> passes as far as I can tell.  When generating the “maker standard” file, it
> occurs for many lines in my GFF file as:
>
> Use of uninitialized value $array[2] in pattern match (m//) at
> /mnt/home/jgallant/quality_filter.pl line 50, <GEN0> line Y.
>
> And then later it complains again with a similar message
>
> Use of uninitialized value $array[2] in string eq at /mnt/home/jgallant/
> quality_filter.pl line 92, <GEN1> line X.
> Use of uninitialized value $array[2] in string eq at /mnt/home/jgallant/
> quality_filter.pl line 96, <GEN1> line X.
> Use of uninitialized value $array[2] in string eq at /mnt/home/jgallant/
> quality_filter.pl line 100, <GEN1> line X
>
> Any insights as to what causes this?  I seem to get a fully formed GFF3
> file out the other side, but the command line fills with these messages and
> makes me nervous that something isn’t right.
>
> I’d appreciate any thoughts!
>
> Best,
> Jason Gallant
>
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20151104/aef75f37/attachment-0003.html>


More information about the maker-devel mailing list