[maker-devel] quality_filter.pl script -question for Mike Campbell

[Carson Holt]

If you have a truncated result, then you should look for truncation in one of the pre-merged files (usually indicates a broken file lock if you started multiple instances of MAKER simultaneously). Also make sure your /tmp or whatever your system default TMPDIR is has not become full.  gff3_merge uses that directory to store temporary files.

—Carson


> On Nov 3, 2015, at 8:20 PM, Jason Gallant <jgallant at msu.edu> wrote:
> 
> Hi Mike,
> 
> I’ve done a little digging on my own, and I think I have traced the issue… it appears that the script is being thrown for the first time when it encounters the line containing the first FASTA sequence header in the GFF file.  For example:
> 
> Scaffold435	blastx	match_part	102606	102851	201	-	.	ID=Scaffold435:hsp:71210:3.10.1.2;Parent=Scaffold435:hit:24267:3.10.1.2;Target=gi|37594442|ref|NP_003431.2| 161 242;Gap=M82
> Scaffold435	blastx	match_part	102528	102851	173	-	.	ID=Scaffold435:hsp:71211:3.10.1.2;Pare##FASTA
> >Scaffold3579
> GCAGTAGGCTGTGATACGTTTGCACCCGGGGACTAAGGGGAGATGTGTACAGGATGGGGA
> GATGTGTACAGGATGGGGAGATGTGTACAGGATGGAGGGGTCCGTGCGAGAGCGTACCAC
> GTGTCTCCCGTGCAGTGGTGCGGCGTGTACTTGATGCGATAAGCCACAGGGTCCTGCTTC
> CCATCCTCCATGATCATTTTCATCCGCAGCGTGACCTCCCCCTCAGAAAAGACCCCCTTC
> CTCATCCTCTCAAAGAGCACCAGAGATTCCTCAATCGGCCGATCCCTCCAAGGGGACAGG
> GGAGGGCTGTGGCCCTTCAGCTCCTCCACACGCTGGTGACACACATAGGCGAGGCCCCTG
> GATGCAGAACAGTGCAGACAGTGACATACCATTCACATGACACTGATCCGGTTAAGCCAC
> ACGCGATACAATACAGTGTCATCATCAGGAAGAAGGGGAAACAGAGGCGTCAAAACGCCC
> TATGAAGAGAGGAGTCTGCTTGCACTCACCGGCGAATAAGATCCACTGCGAGGTCGTACA
> GCTTTTGGAAGTGGTCAGACGCGTGGGTCACTGCATAGGGCGTGTACCCTGTTTTACAGA
> 
> Perl complains when it encounters the line containing >Scaffold3579 and pretty much every line thereafter.  Intriguingly, it would appear that the preceding line appears to be truncated compared to those before it.  I can trace this all the way back to the output of gff3_merge for several files.  Not sure what to do here (or if you can help!).
> 
> Best,
> Jason
> 
> 
> 
> 
> On Tue, Nov 3, 2015 at 4:06 PM Michael Campbell <michael.s.campbell1 at gmail.com <mailto:michael.s.campbell1 at gmail.com>> wrote:
> Hi Jason,
> 
> It could be a couple of things. If you have a cut down version of your gff3 that I can use to recreate the error I can debug it. The quality_filter.pl <http://quality_filter.pl/> script is still a pretty young accessory script, so you may have something in your file that It wasn’t tested against.
> 
> Thanks,
> Mike
> 
>  
> 
> 
>> On Nov 3, 2015, at 2:48 PM, Jason Gallant <jgallant at msu.edu <mailto:jgallant at msu.edu>> wrote:
>> 
> 
>> Hi Mike (list copied for future reference),
>> 
>> I found your very nice protocols paper on using Maker from 2014.  I’ve been following it to the letter as I’m wrapping up my annotation project.
>> 
>> I’ve located your quality_filter.pl <http://quality_filter.pl/> script and am using it on my GFF files to create maker standard and maker default data sets from my maker-max GFF file.  I’m noticing that perl complains a lot while this is running about “use of uninitialized value”.  This occurs on two separate passes as far as I can tell.  When generating the “maker standard” file, it occurs for many lines in my GFF file as:
>> 
>> Use of uninitialized value $array[2] in pattern match (m//) at /mnt/home/jgallant/quality_filter.pl <http://quality_filter.pl/> line 50, <GEN0> line Y.
>> 
>> And then later it complains again with a similar message
>> 
>> Use of uninitialized value $array[2] in string eq at /mnt/home/jgallant/quality_filter.pl <http://quality_filter.pl/> line 92, <GEN1> line X.
>> Use of uninitialized value $array[2] in string eq at /mnt/home/jgallant/quality_filter.pl <http://quality_filter.pl/> line 96, <GEN1> line X.
>> Use of uninitialized value $array[2] in string eq at /mnt/home/jgallant/quality_filter.pl <http://quality_filter.pl/> line 100, <GEN1> line X
>> 
>> Any insights as to what causes this?  I seem to get a fully formed GFF3 file out the other side, but the command line fills with these messages and makes me nervous that something isn’t right.
>> 
>> I’d appreciate any thoughts!
>> 
>> Best,
>> Jason Gallant
> 
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com <mailto:maker-devel at box290.bluehost.com>
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org <http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org>
> 
> _______________________________________________
> maker-devel mailing list
> maker-devel at box290.bluehost.com
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20151104/df760e7a/attachment-0003.html>