From qwzhang0601 at gmail.com Tue Aug 1 08:32:44 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Tue, 1 Aug 2017 09:32:44 -0400 Subject: [maker-devel] Pseudogene identification In-Reply-To: References: Message-ID: Hi Carson: I took a look at the description about the pipe line of pseudogene identification. In my understanding it will use the annotated (predicted by Maker2) protein coding genes as input (i.e., query sequences), search in the intergenic spaces (so annotated genes will not be checked) and find the regions where show certain level of similarity to the annotated genes. If my understanding is correct, I think it is not what I want to do get. Based on the annotated coding genes from Maker2, we found some genes are under expansion in the new species. We want to check and make sure all the gene copies in the expanded gene family really function (to make sure they are not pseudogenes). Do you think the pseudogene identification pipe line of Maker2 can be helpful for my goal? Or do you have any suggestions on this? Many thanks Best Quanwei 2017-07-31 19:54 GMT-04:00 Carson Holt : > The MAKER-P fork was merged back into standard MAKER with version 2.29 > (roughly 3 years ago - a separate download no longer exists). This is > because MAKER-P?s functionality is almost entirely in accessory scripts and > written protocols. The ?/maker/bin/maker called by both MAKER2 and MAKER-P > is actually the same script. So no need to rerun, because if you are using > version 2.29 or later, you already ran it. > > Pseudogene calling is therefore handled by accessory scripts and protocols > you can find here ?> http://shiulab.plantbiology.msu.edu/wiki/ > index.php/Protocol:Pseudogene > > The other MAKER-P protocols can be found here ?> > http://www.yandell-lab.org/software/maker-p.html > > --Carson > > > > On Jul 31, 2017, at 5:02 PM, Quanwei Zhang wrote: > > Hello: > > We used Maker2 to annotate a new rodent genome. By using the annotated > genes we did gene family expansion analysis, and found several gene > families under expansion in the new rodent genome. But we want to check > whether some annotated genes are Pseudogenes, which lead to the expansion. > Do you have any suggestions on this? > > We found the Maker-P can annotate Pseudogene, but we are not sure whether > it is worth to repeat our annotation with Maker-P. Besides, we are not sure > whether the default parameters of Maker-P are good for a rodent species. > What's more, in my understanding the Maker-P will identify Pseudogenes in > the intergenic spaces (which I think the annotated coding genes will be not > be tested and checked). > > Do you have any suggestions to solve our problem? We do not want to > identify Pseudogene on the genome wide, but only want to check those genes > showing expansion (to make sure all those gene copies really function). > > Many thanks > > Best > Quanwei > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From nathan.ricks at gmail.com Tue Aug 1 16:51:25 2017 From: nathan.ricks at gmail.com (Nathan Ricks) Date: Tue, 1 Aug 2017 15:51:25 -0600 Subject: [maker-devel] Output of fasta_merge Message-ID: When I run the command fasta_merge it produces a number of different files: .all.maker.model_gff%3Amaker.proteins.fasta .all.maker.non_overlapping_ab_initio.proteins.fasta .all.maker.snap_masked.proteins.fasta .all.maker.proteins.fasta I was wondering what the difference between these files is Thank you for your time -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 1 16:58:36 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 1 Aug 2017 15:58:36 -0600 Subject: [maker-devel] Output of fasta_merge In-Reply-To: References: Message-ID: <3348C5BF-8342-4E2B-88BF-1AF4558D4169@gmail.com> From the list archives ?> https://groups.google.com/forum/#!searchin/maker-devel/output$20files%7Csort:relevance/maker-devel/43hN_LDQv6c/SWpyYejGiqcJ Also described in ?/maker/README under the "MAKER OUTPUT" section. ?Carson > On Aug 1, 2017, at 3:51 PM, Nathan Ricks wrote: > > When I run the command fasta_merge it produces a number of different files: > .all.maker.model_gff%3Amaker.proteins.fasta > .all.maker.non_overlapping_ab_initio.proteins.fasta > .all.maker.snap_masked.proteins.fasta > .all.maker.proteins.fasta > > I was wondering what the difference between these files is > Thank you for your time > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From nathan.ricks at gmail.com Wed Aug 2 16:33:35 2017 From: nathan.ricks at gmail.com (Nathan Ricks) Date: Wed, 2 Aug 2017 15:33:35 -0600 Subject: [maker-devel] (no subject) Message-ID: As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ -------------- next part -------------- An HTML attachment was scrubbed... URL: From cjfields at illinois.edu Thu Aug 3 10:14:06 2017 From: cjfields at illinois.edu (Fields, Christopher J) Date: Thu, 3 Aug 2017 15:14:06 +0000 Subject: [maker-devel] (no subject) In-Reply-To: References: Message-ID: If you have a fairly recent version of Bioperl (now at 1.7.1) this should not be an issue within bioperl (note this isn?t a bug per se, just that the default universal codon table has rare codons so we simply added a ?strict? alternative table). Also, based on that thread Carson also added a workaround in MAKER explicitly setting a ?strict? codon table that should be in 3.00. chris From: maker-devel on behalf of Nathan Ricks Date: Wednesday, August 2, 2017 at 9:54 PM To: "maker-devel at yandell-lab.org" Subject: [maker-devel] (no subject) As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Thu Aug 3 10:27:51 2017 From: carsonhh at gmail.com (Carson Holt) Date: Thu, 3 Aug 2017 09:27:51 -0600 Subject: [maker-devel] (no subject) In-Reply-To: References: Message-ID: <29E5FB26-0670-4EF1-A5E5-CB10EDC228BD@gmail.com> Correct. Current MAKER 2.31.9 AND 3.00 beta have the strict codon table workaround for BioPerl. MAKER?s default behavior is to use the same ORF given to it be the predictor and alter start codon if MAKER itself is able to add extra sequence that can extend the ORF during the UTR addition phase and find a start codon. But if you set alway_complete=1 in the options, it will walk upstream and downstream to find start/stop codons in the surrounding sequence even if it has to add sequence to the exons. Thanks, Carson > On Aug 3, 2017, at 9:14 AM, Fields, Christopher J wrote: > > If you have a fairly recent version of Bioperl (now at 1.7.1) this should not be an issue within bioperl (note this isn?t a bug per se, just that the default universal codon table has rare codons so we simply added a ?strict? alternative table). > > Also, based on that thread Carson also added a workaround in MAKER explicitly setting a ?strict? codon table that should be in 3.00. > > chris > > From: maker-devel > on behalf of Nathan Ricks > > Date: Wednesday, August 2, 2017 at 9:54 PM > To: "maker-devel at yandell-lab.org " > > Subject: [maker-devel] (no subject) > > As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? > I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 > > https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From jltan at mmu.edu.my Tue Aug 8 02:33:01 2017 From: jltan at mmu.edu.my (jltan at mmu.edu.my) Date: Tue, 8 Aug 2017 15:33:01 +0800 Subject: [maker-devel] Problem with MAKER installation Message-ID: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> Hi, I am installing MAKER to annotate a fungus genome. However, I experienced issue with "Argument "2.53_01" isn't numeric in numeric ge (>=) at /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . I aware that the issue arise because of the "_" in the "2.53_01" however I have no idea on how to solve it. Would you mind to give advice on this matter? Thank you. Best regards, Dr. Joon Liang Tan PhD, Bsc (Hons) Lecturer (Bioinformatics Programme) Faculty of Information Science and Technology (FIST) Multimedia University 75450 Melaka Malaysia Phone: +60 62524813 From patrick_michael.chiuco at upd.edu.ph Thu Aug 10 06:35:47 2017 From: patrick_michael.chiuco at upd.edu.ph (Patrick Michael Chiuco) Date: Thu, 10 Aug 2017 19:35:47 +0800 Subject: [maker-devel] split_fasta script In-Reply-To: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> References: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> Message-ID: <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> Hi! Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline [1] we're currently using. Thanks! Patrick Links: ------ [1] https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1426-6 -------------- next part -------------- An HTML attachment was scrubbed... URL: From zachary.pcohen at gmail.com Fri Aug 11 13:43:58 2017 From: zachary.pcohen at gmail.com (Zach Cohen) Date: Fri, 11 Aug 2017 18:43:58 +0000 Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Hello All, I'm receiving a RepeatMasker on some (not all) of my scaffolds. *Widget::RepeatMasker:* *cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2* *#-------------------------------#* *ERROR: RepeatMasker failed* *--> rank=NA, hostname=82853d8df2a5* *ERROR: Failed while doing repeat masking* *ERROR: Chunk failed at level:0, tier_type:1* FAILED CONTIG:scaffold2852_size18614 *ERROR: Chunk failed at level:2, tier_type:0* *FAILED CONTIG:scaffold2852_size18614* *examining contents of the fasta file and run log* I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! Best, Z -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Sat Aug 12 00:53:49 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 11 Aug 2017 23:53:49 -0600 Subject: [maker-devel] split_fasta script In-Reply-To: <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> References: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> Message-ID: <10D08630-4EA1-40EC-9939-0717E7F9BF25@gmail.com> split_fasta was deprecated quite a while ago (2010) and replaced by fasta_tool. I was able to find an old copy in the subversion repository, I can?t guarantee it will work as expected though with how much other libraries in maker have changed since then. ?Carson > On Aug 10, 2017, at 5:35 AM, Patrick Michael Chiuco wrote: > > > Hi! > > Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline we're currently using. Thanks! > > Patrick > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: split_fasta Type: application/octet-stream Size: 1405 bytes Desc: not available URL: -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Sat Aug 12 01:00:24 2017 From: carsonhh at gmail.com (Carson Holt) Date: Sat, 12 Aug 2017 00:00:24 -0600 Subject: [maker-devel] Problem with MAKER installation In-Reply-To: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> References: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> Message-ID: <71E16226-8E3D-4F68-9877-5D26B33B936D@gmail.com> You may need to reinstall your forks and forks::shared modules. If you use CPAN, you can use the ?force? option to do this. Also if forks is broken, other modules may be as well, so you may get another error in another module after the reinstall (then you will have to reinstall that module). This can possibly be caused by a processor version issue if this is a cluster with mixed architectures (old vs new Intel chips or AMD vs Intel), or it can be due to a system update breaking dynamically linked C libraries. ?Carson > On Aug 8, 2017, at 1:33 AM, jltan at mmu.edu.my wrote: > > Hi, > > I am installing MAKER to annotate a fungus genome. However, I experienced > issue with > "Argument "2.53_01" isn't numeric in numeric ge (>=) at > /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . > > I aware that the issue arise because of the "_" in the "2.53_01" however I > have no idea on how to solve it. > > Would you mind to give advice on this matter? > > Thank you. > > > > Best regards, > > Dr. Joon Liang Tan > PhD, Bsc (Hons) > Lecturer (Bioinformatics Programme) > Faculty of Information Science and Technology (FIST) > Multimedia University > 75450 Melaka > Malaysia > Phone: +60 62524813 > > > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org From carsonhh at gmail.com Mon Aug 14 12:30:33 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 14 Aug 2017 11:30:33 -0600 Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly In-Reply-To: References: Message-ID: If running under MPI, you can get messages from multiple processes (slightly out of order), in which case the more descript cause of the error may be further upstream in the STDERR log. If running without MPI, and the error you see is matched with the Widget::RepeatMasker command used, then you can simply copy it and run it outside of MAKER. If there are installation issues with your RepeatMasker copy then the cause will become more apparent. i.e. Run the command by itself ?> /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 ?Carson > On Aug 11, 2017, at 12:43 PM, Zach Cohen wrote: > > Hello All, > I'm receiving a RepeatMasker on some (not all) of my scaffolds. > Widget::RepeatMasker: > > cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 > > #-------------------------------# > > ERROR: RepeatMasker failed > > --> rank=NA, hostname=82853d8df2a5 > > ERROR: Failed while doing repeat masking > > ERROR: Chunk failed at level:0, tier_type:1 > > FAILED CONTIG:scaffold2852_size18614 > > ERROR: Chunk failed at level:2, tier_type:0 > > FAILED CONTIG:scaffold2852_size18614 > > examining contents of the fasta file and run log > > > > I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! > > Best, > > Z > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Mon Aug 14 13:59:16 2017 From: chzelin at gmail.com (zl c) Date: Mon, 14 Aug 2017 14:59:16 -0400 Subject: [maker-devel] maker MPI problem Message-ID: Hello, I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? CMD: export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so export OMPI_MCA_mpi_warn_on_fork=0 mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] Ph.D. NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: run05.mpi.o47346077 Type: application/octet-stream Size: 60802 bytes Desc: not available URL: From chzelin at gmail.com Mon Aug 14 14:11:01 2017 From: chzelin at gmail.com (zl c) Date: Mon, 14 Aug 2017 15:11:01 -0400 Subject: [maker-devel] maker problem large number of files Message-ID: Hello, Besides, Maker produces large number of temporary files. Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 14 14:18:22 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 14 Aug 2017 13:18:22 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: Message-ID: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> This is rather vague ?> ?crashed the computer cluster? Do you have a specific error? ?Carson > On Aug 14, 2017, at 12:59 PM, zl c wrote: > > Hello, > > > I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? > > > CMD: > > export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so > > export OMPI_MCA_mpi_warn_on_fork=0 > > mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta > > > Thanks, > > Zelin Chen > > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] Ph.D. > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From alyce.fowler at bayer.com Mon Aug 14 14:20:55 2017 From: alyce.fowler at bayer.com (Alyce Fowler) Date: Mon, 14 Aug 2017 19:20:55 +0000 Subject: [maker-devel] unsubscribe Message-ID: -----Original Message----- From: maker-devel [mailto:maker-devel-bounces at yandell-lab.org] On Behalf Of maker-devel-request at yandell-lab.org Sent: Monday, August 14, 2017 1:31 PM To: maker-devel at yandell-lab.org Subject: maker-devel Digest, Vol 111, Issue 3 Send maker-devel mailing list submissions to maker-devel at yandell-lab.org To subscribe or unsubscribe via the World Wide Web, visit http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org or, via email, send a message with subject or body 'help' to maker-devel-request at yandell-lab.org You can reach the person managing the list at maker-devel-owner at yandell-lab.org When replying, please edit your Subject line so it is more specific than "Re: Contents of maker-devel digest..." Today's Topics: 1. Problem with MAKER installation (jltan at mmu.edu.my) 2. split_fasta script (Patrick Michael Chiuco) 3. Inconsistent RepeatMasker error on draft assembly (Zach Cohen) 4. Re: split_fasta script (Carson Holt) 5. Re: Problem with MAKER installation (Carson Holt) 6. Re: Inconsistent RepeatMasker error on draft assembly (Carson Holt) ---------------------------------------------------------------------- Message: 1 Date: Tue, 8 Aug 2017 15:33:01 +0800 From: jltan at mmu.edu.my To: maker-devel at yandell-lab.org Subject: [maker-devel] Problem with MAKER installation Message-ID: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel at mlkstf.mmu.edu.my> Content-Type: text/plain;charset=iso-8859-1 Hi, I am installing MAKER to annotate a fungus genome. However, I experienced issue with "Argument "2.53_01" isn't numeric in numeric ge (>=) at /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . I aware that the issue arise because of the "_" in the "2.53_01" however I have no idea on how to solve it. Would you mind to give advice on this matter? Thank you. Best regards, Dr. Joon Liang Tan PhD, Bsc (Hons) Lecturer (Bioinformatics Programme) Faculty of Information Science and Technology (FIST) Multimedia University 75450 Melaka Malaysia Phone: +60 62524813 ------------------------------ Message: 2 Date: Thu, 10 Aug 2017 19:35:47 +0800 From: Patrick Michael Chiuco To: maker-devel at yandell-lab.org Subject: [maker-devel] split_fasta script Message-ID: <56824384580b99132afdba6167d0d0b0 at smicro00.upd.edu.ph> Content-Type: text/plain; charset="utf-8" Hi! Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline [1] we're currently using. Thanks! Patrick Links: ------ [1] https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1426-6 -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 3 Date: Fri, 11 Aug 2017 18:43:58 +0000 From: Zach Cohen To: maker-devel at yandell-lab.org Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Content-Type: text/plain; charset="utf-8" Hello All, I'm receiving a RepeatMasker on some (not all) of my scaffolds. *Widget::RepeatMasker:* *cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2* *#-------------------------------#* *ERROR: RepeatMasker failed* *--> rank=NA, hostname=82853d8df2a5* *ERROR: Failed while doing repeat masking* *ERROR: Chunk failed at level:0, tier_type:1* FAILED CONTIG:scaffold2852_size18614 *ERROR: Chunk failed at level:2, tier_type:0* *FAILED CONTIG:scaffold2852_size18614* *examining contents of the fasta file and run log* I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! Best, Z -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 4 Date: Fri, 11 Aug 2017 23:53:49 -0600 From: Carson Holt To: Patrick Michael Chiuco Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] split_fasta script Message-ID: <10D08630-4EA1-40EC-9939-0717E7F9BF25 at gmail.com> Content-Type: text/plain; charset="utf-8" split_fasta was deprecated quite a while ago (2010) and replaced by fasta_tool. I was able to find an old copy in the subversion repository, I can?t guarantee it will work as expected though with how much other libraries in maker have changed since then. ?Carson > On Aug 10, 2017, at 5:35 AM, Patrick Michael Chiuco wrote: > > > Hi! > > Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline we're currently using. Thanks! > > Patrick > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: split_fasta Type: application/octet-stream Size: 1405 bytes Desc: not available URL: -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 5 Date: Sat, 12 Aug 2017 00:00:24 -0600 From: Carson Holt To: jltan at mmu.edu.my Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] Problem with MAKER installation Message-ID: <71E16226-8E3D-4F68-9877-5D26B33B936D at gmail.com> Content-Type: text/plain; charset=utf-8 You may need to reinstall your forks and forks::shared modules. If you use CPAN, you can use the ?force? option to do this. Also if forks is broken, other modules may be as well, so you may get another error in another module after the reinstall (then you will have to reinstall that module). This can possibly be caused by a processor version issue if this is a cluster with mixed architectures (old vs new Intel chips or AMD vs Intel), or it can be due to a system update breaking dynamically linked C libraries. ?Carson > On Aug 8, 2017, at 1:33 AM, jltan at mmu.edu.my wrote: > > Hi, > > I am installing MAKER to annotate a fungus genome. However, I experienced > issue with > "Argument "2.53_01" isn't numeric in numeric ge (>=) at > /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . > > I aware that the issue arise because of the "_" in the "2.53_01" however I > have no idea on how to solve it. > > Would you mind to give advice on this matter? > > Thank you. > > > > Best regards, > > Dr. Joon Liang Tan > PhD, Bsc (Hons) > Lecturer (Bioinformatics Programme) > Faculty of Information Science and Technology (FIST) > Multimedia University > 75450 Melaka > Malaysia > Phone: +60 62524813 > > > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org ------------------------------ Message: 6 Date: Mon, 14 Aug 2017 11:30:33 -0600 From: Carson Holt To: Zach Cohen Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Content-Type: text/plain; charset="utf-8" If running under MPI, you can get messages from multiple processes (slightly out of order), in which case the more descript cause of the error may be further upstream in the STDERR log. If running without MPI, and the error you see is matched with the Widget::RepeatMasker command used, then you can simply copy it and run it outside of MAKER. If there are installation issues with your RepeatMasker copy then the cause will become more apparent. i.e. Run the command by itself ?> /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 ?Carson > On Aug 11, 2017, at 12:43 PM, Zach Cohen wrote: > > Hello All, > I'm receiving a RepeatMasker on some (not all) of my scaffolds. > Widget::RepeatMasker: > > cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 > > #-------------------------------# > > ERROR: RepeatMasker failed > > --> rank=NA, hostname=82853d8df2a5 > > ERROR: Failed while doing repeat masking > > ERROR: Chunk failed at level:0, tier_type:1 > > FAILED CONTIG:scaffold2852_size18614 > > ERROR: Chunk failed at level:2, tier_type:0 > > FAILED CONTIG:scaffold2852_size18614 > > examining contents of the fasta file and run log > > > > I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! > > Best, > > Z > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Subject: Digest Footer _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org ------------------------------ End of maker-devel Digest, Vol 111, Issue 3 ******************************************* ________________________________________________________________________ The information contained in this e-mail is for the exclusive use of the intended recipient(s) and may be confidential, proprietary, and/or legally privileged. Inadvertent disclosure of this message does not constitute a waiver of any privilege. If you receive this message in error, please do not directly or indirectly use, print, copy, forward, or disclose any part of this message. Please also delete this e-mail and all copies and notify the sender. Thank you. ________________________________________________________________________ From cjfields at illinois.edu Mon Aug 14 20:23:07 2017 From: cjfields at illinois.edu (Fields, Christopher J) Date: Tue, 15 Aug 2017 01:23:07 +0000 Subject: [maker-devel] maker MPI problem In-Reply-To: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: Carson, It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. chris From: maker-devel on behalf of Carson Holt Date: Monday, August 14, 2017 at 2:18 PM To: zl c Cc: "maker-devel at yandell-lab.org" Subject: Re: [maker-devel] maker MPI problem This is rather vague ?> ?crashed the computer cluster? Do you have a specific error? ?Carson On Aug 14, 2017, at 12:59 PM, zl c > wrote: Hello, I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? CMD: export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so export OMPI_MCA_mpi_warn_on_fork=0 mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] Ph.D. NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 09:33:37 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 08:33:37 -0600 Subject: [maker-devel] Fwd: maker MPI problem References: Message-ID: <4D7D32B5-58F4-401D-83EC-A1B38E0DCF09@gmail.com> Just forwarding this to the list. --Carson > From: Carson Holt > Date: August 14, 2017 at 2:00:11 PM MDT > To: zl c > Subject: Re: [maker-devel] maker MPI problem > > Yes. You can delete them. > > Also I notice this library being mentioned in the segfault ?> libpthread.so > > MAKER doesn?t use pthreads, so I?m surprised it?s showing up in an error. You could try installing a separate version of perl without pthread support and running MAKER with that (pthreads is optional for perl). It may remove an OpenMPI/perl incompatibility happening on your system. > > ?Carson > > >> On Aug 14, 2017, at 1:50 PM, zl c wrote: >> >> Maker dies. >> >> I've set LD_PRELOAD before install. >> >> I'll try the option. >> >> Can I remove the .NFS files before rerunning? >> >> Thanks, >> Zelin >> >> >> >>> On Mon, Aug 14, 2017 at 3:35 PM, Carson Holt wrote: >>> Is the issue that your cluster dies or that MAKER dies? (i.e. I want to know if this is an issue with your cluster or just an issue running MAKER) >>> >>> I see in the file that you are getting segfaults which should not crash the cluster but would kill maker. They would indicate either an installation problem, or just a command configuration option. >>> >>> You may need to recompile while the LD_PRELOAD value is set (it must be set during MAKER install and whenever you run with OpenMPI). Or you may still have the native infiniband communication active (causes segfaults with system calls). >>> >>> You can try this (to do ip over infiiniband instead, worls only if ib0 exists or set it to eth0 if eth0 exists) ?> '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0' >>> >>> That would replace the '-mca btl ^openib' >>> >>> Also make sure you can run maker on a single node under MPI before trying to work across nodes, then try on two nodes for your first test. >>> >>> The NFSLock files are file locks that are not cleaned up on a hard failure. >>> >>> ?Carson >>> >>> >>> >>> >>> >>>> On Aug 14, 2017, at 1:22 PM, zl c wrote: >>>> >>>> It's in the attached file. >>>> >>>> Beside, I see there are lots of .NFS... files.like: >>>> .NFSLock..NFSLock.genomedb.NFSLock.share.tmp.2247.26272.7466.34069868502337 >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>>> On Mon, Aug 14, 2017 at 3:18 PM, Carson Holt wrote: >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> Do you have a specific error? >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>>> >>>>>> Hello, >>>>>> >>>>>> >>>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>>> >>>>>> >>>>>> CMD: >>>>>> >>>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>>> >>>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>>> >>>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>>> >>>>>> >>>>>> Thanks, >>>>>> >>>>>> Zelin Chen >>>>>> >>>>>> >>>>>> -------------------------------------------- >>>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>>> >>>>>> NIH/NHGRI >>>>>> Building 50, Room 5531 >>>>>> 50 SOUTH DR, MSC 8004 >>>>>> BETHESDA, MD 20892-8004 >>>>>> _______________________________________________ >>>>>> maker-devel mailing list >>>>>> maker-devel at box290.bluehost.com >>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>> >>>> >>>> >>> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 09:39:35 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 08:39:35 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? --Carson Sent from my iPhone > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > Configuring MAKER with MPI support > Installing MAKER... > Configuring MAKER with MPI support > Subroutine dl_load_flags redefined at (eval 125) line 8. > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J wrote: >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >> >> >> >> chris >> >> >> >> From: maker-devel on behalf of Carson Holt >> Date: Monday, August 14, 2017 at 2:18 PM >> To: zl c >> Cc: "maker-devel at yandell-lab.org" >> Subject: Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Mon Aug 14 14:21:21 2017 From: dandence at gmail.com (Daniel Ence) Date: Mon, 14 Aug 2017 15:21:21 -0400 Subject: [maker-devel] maker problem large number of files In-Reply-To: References: Message-ID: <12B2834F-CC76-45BA-981B-4712982C9482@gmail.com> Hi Zelin, The large number of temporary files is part of the normal behavior for maker. After MAKER has finished, the only output files you really need are the fasta files of the annotated protein and transcript sequences and the gff file. The full maker output facilitates rerunning in the case of failure or trying out different parameters, which is sometimes a good reason for keeping the full output. ~Daniel > On Aug 14, 2017, at 3:11 PM, zl c wrote: > > Hello, > > Besides, Maker produces large number of temporary files. > > Thanks, > Zelin Chen > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 09:27:21 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 10:27:21 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: When I installed by './Build install', I got following some messages: Configuring MAKER with MPI support Installing MAKER... Configuring MAKER with MPI support Subroutine dl_load_flags redefined at (eval 125) line 8. Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. I'm not sure whether it's correctly installed. Thanks, -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < cjfields at illinois.edu> wrote: > Carson, > > > > It was attached to the initial message (named ?run05.mpi.o47346077?). It > looks like a Perl issue with threads, though I don?t see why this would > crash a cluster. The fact there is a log file would suggest it just ended > the job. > > > > chris > > > > *From: *maker-devel on behalf of > Carson Holt > *Date: *Monday, August 14, 2017 at 2:18 PM > *To: *zl c > *Cc: *"maker-devel at yandell-lab.org" > *Subject: *Re: [maker-devel] maker MPI problem > > > > This is rather vague ?> ?crashed the computer cluster? > > > > Do you have a specific error? > > > > ?Carson > > > > > > > > On Aug 14, 2017, at 12:59 PM, zl c wrote: > > > > Hello, > > > > I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I > attached the log file. Could you help me to solve the problem? > > > > CMD: > > export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so > > export OMPI_MCA_mpi_warn_on_fork=0 > > mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g > genome.fasta > > > > Thanks, > > Zelin Chen > > > > -------------------------------------------- > > Zelin Chen [chzelin at gmail.com] Ph.D. > > > > NIH/NHGRI > > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 10:30:48 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 11:30:48 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: The other option doesn't work. I reinstall it with a perl without multiple threads. Now it's building the blast database. -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > You may need to delete the .../maker/perl directory before doing the > reinstall if not doing a brand new installation. Otherwise you can ignore > the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for > MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > > Configuring MAKER with MPI support > > Installing MAKER... > > Configuring MAKER with MPI support > > Subroutine dl_load_flags redefined at (eval 125) line 8. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at > (eval 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) > line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < > cjfields at illinois.edu> wrote: > >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It >> looks like a Perl issue with threads, though I don?t see why this would >> crash a cluster. The fact there is a log file would suggest it just ended >> the job. >> >> >> >> chris >> >> >> >> *From: *maker-devel on behalf of >> Carson Holt >> *Date: *Monday, August 14, 2017 at 2:18 PM >> *To: *zl c >> *Cc: *"maker-devel at yandell-lab.org" >> *Subject: *Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I >> attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >> genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 10:34:32 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 11:34:32 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: Here are some latest message: [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > You may need to delete the .../maker/perl directory before doing the > reinstall if not doing a brand new installation. Otherwise you can ignore > the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for > MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > > Configuring MAKER with MPI support > > Installing MAKER... > > Configuring MAKER with MPI support > > Subroutine dl_load_flags redefined at (eval 125) line 8. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at > (eval 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) > line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < > cjfields at illinois.edu> wrote: > >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It >> looks like a Perl issue with threads, though I don?t see why this would >> crash a cluster. The fact there is a log file would suggest it just ended >> the job. >> >> >> >> chris >> >> >> >> *From: *maker-devel on behalf of >> Carson Holt >> *Date: *Monday, August 14, 2017 at 2:18 PM >> *To: *zl c >> *Cc: *"maker-devel at yandell-lab.org" >> *Subject: *Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I >> attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >> genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 10:47:04 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 09:47:04 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Did it die or did you just get a warning? Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. #add if MPI not using all CPU given --oversubscribe --bind-to none #workaround for infinaband (use instead of --mca ^openib) --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 #add to stop certain other warnings --mca orte_base_help_aggregate 0 #stop fork warnings --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 ?Carson > On Aug 15, 2017, at 9:34 AM, zl c wrote: > > Here are some latest message: > > [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork > [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > > > On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: > You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c > wrote: > >> When I installed by './Build install', I got following some messages: >> Configuring MAKER with MPI support >> Installing MAKER... >> Configuring MAKER with MPI support >> Subroutine dl_load_flags redefined at (eval 125) line 8. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >> >> I'm not sure whether it's correctly installed. >> >> Thanks, >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >> >> >> >> chris >> >> >> >> From: maker-devel > on behalf of Carson Holt > >> Date: Monday, August 14, 2017 at 2:18 PM >> To: zl c > >> Cc: "maker-devel at yandell-lab.org " > >> Subject: Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com ] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 15:50:05 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 14:50:05 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Message-ID: <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? --Carson Sent from my iPhone > On Aug 15, 2017, at 2:47 PM, zl c wrote: > > Hi Carson, Christopher, Daniel, > > Thank you for your kind help. > > Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? > > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: >>>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>>> >>>>> When I installed by './Build install', I got following some messages: >>>>> Configuring MAKER with MPI support >>>>> Installing MAKER... >>>>> Configuring MAKER with MPI support >>>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>>> >>>>> I'm not sure whether it's correctly installed. >>>>> >>>>> Thanks, >>>>> >>>>> -------------------------------------------- >>>>> Zelin Chen [chzelin at gmail.com] >>>>> >>>>> NIH/NHGRI >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J wrote: >>>>>> Carson, >>>>>> >>>>>> >>>>>> >>>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>>>> >>>>>> >>>>>> >>>>>> chris >>>>>> >>>>>> >>>>>> >>>>>> From: maker-devel on behalf of Carson Holt >>>>>> Date: Monday, August 14, 2017 at 2:18 PM >>>>>> To: zl c >>>>>> Cc: "maker-devel at yandell-lab.org" >>>>>> Subject: Re: [maker-devel] maker MPI problem >>>>>> >>>>>> >>>>>> >>>>>> This is rather vague ?> ?crashed the computer cluster? >>>>>> >>>>>> >>>>>> >>>>>> Do you have a specific error? >>>>>> >>>>>> >>>>>> >>>>>> ?Carson >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>>> >>>>>> >>>>>> >>>>>> Hello, >>>>>> >>>>>> >>>>>> >>>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>>> >>>>>> >>>>>> >>>>>> CMD: >>>>>> >>>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>>> >>>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>>> >>>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>>> >>>>>> >>>>>> >>>>>> Thanks, >>>>>> >>>>>> Zelin Chen >>>>>> >>>>>> >>>>>> >>>>>> -------------------------------------------- >>>>>> >>>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>>> >>>>>> >>>>>> >>>>>> NIH/NHGRI >>>>>> >>>>>> Building 50, Room 5531 >>>>>> 50 SOUTH DR, MSC 8004 >>>>>> BETHESDA, MD 20892-8004 >>>>>> >>>>>> _______________________________________________ >>>>>> maker-devel mailing list >>>>>> maker-devel at box290.bluehost.com >>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>> >>>>>> >>>>>> >>>>> >>> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 15:47:14 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 16:47:14 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Message-ID: Hi Carson, Christopher, Daniel, Thank you for your kind help. Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? Zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: > Did it die or did you just get a warning? > > Here is a list of flags to add that suppress warnings and other issues > with OpenMPI. You can add them all or one at a time depending on issues you > get. > > #add if MPI not using all CPU given > --oversubscribe --bind-to none > > #workaround for infinaband (use instead of --mca ^openib) > --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 > > #add to stop certain other warnings > --mca orte_base_help_aggregate 0 > > #stop fork warnings > --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 > > ?Carson > > > > On Aug 15, 2017, at 9:34 AM, zl c wrote: > > Here are some latest message: > > [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt > / opal_init:warn-fork > [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see > all help / error messages > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > > On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > >> You may need to delete the .../maker/perl directory before doing the >> reinstall if not doing a brand new installation. Otherwise you can ignore >> the subroutine redefined warnings during compile. >> >> Have you been able to test the alternate flags on the command line for >> MPI? How about an alternate perl without threads? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 8:27 AM, zl c wrote: >> >> When I installed by './Build install', I got following some messages: >> Configuring MAKER with MPI support >> Installing MAKER... >> Configuring MAKER with MPI support >> Subroutine dl_load_flags redefined at (eval 125) line 8. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) >> line 9. >> >> I'm not sure whether it's correctly installed. >> >> Thanks, >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >> cjfields at illinois.edu> wrote: >> >>> Carson, >>> >>> >>> >>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>> It looks like a Perl issue with threads, though I don?t see why this would >>> crash a cluster. The fact there is a log file would suggest it just ended >>> the job. >>> >>> >>> >>> chris >>> >>> >>> >>> *From: *maker-devel on behalf of >>> Carson Holt >>> *Date: *Monday, August 14, 2017 at 2:18 PM >>> *To: *zl c >>> *Cc: *"maker-devel at yandell-lab.org" >>> *Subject: *Re: [maker-devel] maker MPI problem >>> >>> >>> >>> This is rather vague ?> ?crashed the computer cluster? >>> >>> >>> >>> Do you have a specific error? >>> >>> >>> >>> ?Carson >>> >>> >>> >>> >>> >>> >>> >>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>> >>> >>> >>> Hello, >>> >>> >>> >>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. >>> I attached the log file. Could you help me to solve the problem? >>> >>> >>> >>> CMD: >>> >>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>> >>> export OMPI_MCA_mpi_warn_on_fork=0 >>> >>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>> genome.fasta >>> >>> >>> >>> Thanks, >>> >>> Zelin Chen >>> >>> >>> >>> -------------------------------------------- >>> >>> Zelin Chen [chzelin at gmail.com] Ph.D. >>> >>> >>> >>> NIH/NHGRI >>> >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> _______________________________________________ >>> maker-devel mailing list >>> maker-devel at box290.bluehost.com >>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >>> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 16:13:04 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 15:13:04 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: Some notes: First, the mpiexec command still needs the --mca parameters (either '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0?). Otherwise if you have infiniband on the nodes it will try and use OpenFabrics compatible libraries which will kill code doing system calls (like MAKER does). Second, try using a higher count than 2 in your batch. One process is always sacrificed by maker to act only for message management among processes, so with -n 2, you have one process working and one managing data. So only one contig will run at a time. If you set it to a higher number the issue will go away. The message manger process starts to get saturated at ~200 CPUs, so anything above that processor count becomes less beneficial to the job. Thanks, Carson > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt > wrote: > What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 2:47 PM, zl c > wrote: > >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt > wrote: >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >>> On Aug 15, 2017, at 9:34 AM, zl c > wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com ] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: >>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>> >>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>> >>> --Carson >>> >>> Sent from my iPhone >>> >>> On Aug 15, 2017, at 8:27 AM, zl c > wrote: >>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com ] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >>>> Carson, >>>> >>>> >>>> >>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>> >>>> >>>> >>>> chris >>>> >>>> >>>> >>>> From: maker-devel > on behalf of Carson Holt > >>>> Date: Monday, August 14, 2017 at 2:18 PM >>>> To: zl c > >>>> Cc: "maker-devel at yandell-lab.org " > >>>> Subject: Re: [maker-devel] maker MPI problem >>>> >>>> >>>> >>>> This is rather vague ?> ?crashed the computer cluster? >>>> >>>> >>>> >>>> Do you have a specific error? >>>> >>>> >>>> >>>> ?Carson >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >>>> >>>> >>>> >>>> Hello, >>>> >>>> >>>> >>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>> >>>> >>>> >>>> CMD: >>>> >>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>> >>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>> >>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>> >>>> >>>> >>>> Thanks, >>>> >>>> Zelin Chen >>>> >>>> >>>> >>>> -------------------------------------------- >>>> >>>> Zelin Chen [chzelin at gmail.com ] Ph.D. >>>> >>>> >>>> >>>> NIH/NHGRI >>>> >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>>> >>> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 16:05:18 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 17:05:18 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: I submit a job: sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh CMD in run06.maker.mpi.sh mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta Another question: How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. Thanks, zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > What is your command line? Are you running interactively or as a submitted > batch? If it's a batch job what options did you give it? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 2:47 PM, zl c wrote: > > Hi Carson, Christopher, Daniel, > > Thank you for your kind help. > > Now it works without any other options on one nodes and 4 CPUs. I set the > number of task to 2, but there's only one contigs in running. Should it be > two contigs running at the same time? > > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: > >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues >> with OpenMPI. You can add them all or one at a time depending on issues you >> get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >> On Aug 15, 2017, at 9:34 AM, zl c wrote: >> >> Here are some latest message: >> >> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt >> / opal_init:warn-fork >> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >> all help / error messages >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> >> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: >> >>> You may need to delete the .../maker/perl directory before doing the >>> reinstall if not doing a brand new installation. Otherwise you can ignore >>> the subroutine redefined warnings during compile. >>> >>> Have you been able to test the alternate flags on the command line for >>> MPI? How about an alternate perl without threads? >>> >>> --Carson >>> >>> Sent from my iPhone >>> >>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>> >>> When I installed by './Build install', I got following some messages: >>> Configuring MAKER with MPI support >>> Installing MAKER... >>> Configuring MAKER with MPI support >>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) >>> line 9. >>> >>> I'm not sure whether it's correctly installed. >>> >>> Thanks, >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> NIH/NHGRI >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>> cjfields at illinois.edu> wrote: >>> >>>> Carson, >>>> >>>> >>>> >>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>> It looks like a Perl issue with threads, though I don?t see why this would >>>> crash a cluster. The fact there is a log file would suggest it just ended >>>> the job. >>>> >>>> >>>> >>>> chris >>>> >>>> >>>> >>>> *From: *maker-devel on behalf of >>>> Carson Holt >>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>> *To: *zl c >>>> *Cc: *"maker-devel at yandell-lab.org" >>>> *Subject: *Re: [maker-devel] maker MPI problem >>>> >>>> >>>> >>>> This is rather vague ?> ?crashed the computer cluster? >>>> >>>> >>>> >>>> Do you have a specific error? >>>> >>>> >>>> >>>> ?Carson >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>> >>>> >>>> >>>> Hello, >>>> >>>> >>>> >>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. >>>> I attached the log file. Could you help me to solve the problem? >>>> >>>> >>>> >>>> CMD: >>>> >>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>> >>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>> >>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>> genome.fasta >>>> >>>> >>>> >>>> Thanks, >>>> >>>> Zelin Chen >>>> >>>> >>>> >>>> -------------------------------------------- >>>> >>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>> >>>> >>>> >>>> NIH/NHGRI >>>> >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>>> >>> >>> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 16:17:20 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 17:17:20 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: This is a test run, so I use only 2 tasks. I'll try more tasks and your options. Thanks, Zelin On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either > '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include > ib0?). Otherwise if you have infiniband on the nodes it will try and use > OpenFabrics compatible libraries which will kill code doing system calls > (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is > always sacrificed by maker to act only for message management among > processes, so with -n 2, you have one process working and one managing > data. So only one contig will run at a time. If you set it to a higher > number the issue will go away. The message manger process starts to get > saturated at ~200 CPUs, so anything above that processor count becomes less > beneficial to the job. > > Thanks, > Carson > > > > > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 > --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A > run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and > large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > >> What is your command line? Are you running interactively or as a >> submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c wrote: >> >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set >> the number of task to 2, but there's only one contigs in running. Should it >> be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues >>> with OpenMPI. You can add them all or one at a time depending on issues you >>> get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message >>> help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >>> all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt >>> wrote: >>> >>>> You may need to delete the .../maker/perl directory before doing the >>>> reinstall if not doing a brand new installation. Otherwise you can ignore >>>> the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for >>>> MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval >>>> 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>>> cjfields at illinois.edu> wrote: >>>> >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>>> It looks like a Perl issue with threads, though I don?t see why this would >>>>> crash a cluster. The fact there is a log file would suggest it just ended >>>>> the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> *From: *maker-devel on behalf >>>>> of Carson Holt >>>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>>> *To: *zl c >>>>> *Cc: *"maker-devel at yandell-lab.org" >>>>> *Subject: *Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer >>>>> cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>>> genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yand >>>>> ell-lab.org >>>>> >>>>> >>>>> >>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 16 15:00:44 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 16 Aug 2017 16:00:44 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> Message-ID: Dear Carson and Daniel: Thank you for your explanation about the details of repeat masking. But we still have some concerns, would you please give us some suggestions? Thanks (1) We are doing genome annotation for a new rodent species, we wonder whether we should use repeat library for "Mammalia" or "rodent"? Which is more proper, if we did not construct a species-specific repeat library for the new genome? #-----Repeat Masking (leave values blank to skip repeat masking) model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker repeat_protein=/gs/gsfs0/hpc01/apps/MAKER/2.31.9/data/te_proteins.fasta #provide a fasta file of transposable element proteins for RepeatRunner (2) With some concerns as discussed above emails, we did not train a species-specific repeat library. Since we have finished the annotation only using the repeat library from repeatMasker and Maker2, we wonder whether it is worth for us to firstly train a species-specific repeat library and then do the genome annotation again? Will it (i.e., trainning a species-specific repeat library) significantly affect the gene annotation and downstream analysis (e.g., gene family expansion analysis, positive selection)? (3) We identified some gene families under contraction, but we want to confirm those gene families really lost copies in our new genome. Do you think it is worth to do the genome annotation without repeat masking, so there will not be genes missing from annotation due to repeat mask? Many thanks. Best Quanwei 2017-07-31 13:02 GMT-04:00 Carson Holt : > Please note that the unmask option Dan is talking about is a feature to > run both masked and unmasked raw predictions in the first round of > prediction (it does not affect alignemnt of the second round of > predictiopn). It tends to increase the false positive rate but can be a > quick test when you believe you are missing a gene because of overmasking > from a user created library and protein/EST evidence is overly sparse (so > the gene cannot be recovered through evidence alignment and the second > round of unmasked prediction). > > ?Carson > > On Jul 31, 2017, at 10:53 AM, Daniel Ence wrote: > > Hi Quanwei, Running maker on the unmasked genome will probably give you > more genes, but won?t be helpful in the end. Maker soft-masks repeats, > which prevents blast alignments from being seeded in the masked regions, > but still allows them to extend into those regions. This solves the problem > missing exons mentioned in the text you sent. There?s an option in the > control file to run the ab-inition programs on the unmasked sequence > (?unmask?) which is set to false (0) by default. > > Hope this helps, > Daniel Ence > > > On Jul 31, 2017, at 12:42 PM, Quanwei Zhang wrote: > > Hello: > > We are using the Maker2 pipeline to annotating a new genome. We just read > something about the repeat masking from repeatMasker's documents. It > suggests to leave low complexity region unmasked and to do gene annotation > using both masked and unmasked genome. I wonder what your opinion and > suggestions on this? Many thanks > > > The paragraph below is from http://www.binfo.ncku.edu.tw/ > RM/webrepeatmaskerhelp.html > Use in association with gene prediction programs > > Predicting genes from a masked sequence faces several problems. First, > one should not mask low complexity regions, e.g. to avoid masking > trinucleotide repeats in coding regions. But even with only interspersed > repeats masked, gene prediction programs may fail to identify exons > correctly. As mentioned above, sometimes tail ends of coding regions may > have originated from transposable elements. Even if no coding regions have > been masked, splice sites may be compromised; e.g. the polypyrimidine > region that is part of the acceptor splice site may be contained within a > repeat. > > Thus, I generally recommend to run a gene prediction program on unmasked > DNA (as well) and compare the predicted genes and exons with the > RepeatMasker output. Some gene prediction program allow you to force > certain exons out of the predictions (e.g. often the old ORFs of LINE1 > elements and endogenous retroviruses are included in genes). Work is also > in progress at several sites to incorporate RepeatMasker into gene > prediction programs, in which cases matches to repeats are weighted in > along with the other parameters used. > > Best > > Quanwei > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Thu Aug 17 08:39:29 2017 From: chzelin at gmail.com (zl c) Date: Thu, 17 Aug 2017 09:39:29 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: I use '--mca btl ^openib' and it runs on multiple nodes. It works and I see some sequences is done for the test run. Then I make another run using the large nr database and use local space on the computer cluster, which fails. Submit CMD: sbatch --gres=lscratch:100 --time=168:00:00 --partition=multinode --constraint=x2680 --mem-per-cpu=64g --ntasks=8 --ntasks-per-core=1 --job-name run05.mpi -o log.mpi.00/run05.mpi.o%A run05.mpi.sh Error message: #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_BLLXNq/rna%2Efasta.mpi.10.21 -query /lscratch/47455932/maker_BLLXNq/50/tig00017383_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_ canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/ goldfish.arrow.renamed_datastore/5A/65/tig00017383_ arrow//theVoid.tig00017383_arrow/0/tig00017383_arrow.0. rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.21.tblastx #-------------------------------# Thread 1 terminated abnormally: can't open /lscratch/47455932/mpiavG_z: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. --> rank=37, hostname=cn4120 FATAL: Thread terminated, causing all processes to fail --> rank=37, hostname=cn4120 ------------------------------------------------------- Primary job terminated normally, but 1 process returned a non-zero exit code.. Per user-direction, the job has been aborted. ------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received running blast search. #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_Zsg_Gg/rna%2Efasta.mpi.10.8 -query /lscratch/47455932/maker_Zsg_Gg/62/tig00001111_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_ canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/ goldfish.arrow.renamed_datastore/B8/A5/tig00001111_ arrow//theVoid.tig00001111_arrow/0/tig00001111_arrow.0. rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.8.tblastx #-------------------------------# Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached -------------------------------------------------------------------------- An MPI communication peer process has unexpectedly disconnected. This usually indicates a failure in the peer process (e.g., a crash or otherwise exiting without calling MPI_FINALIZE first). Although this local MPI process will likely now behave unpredictably (it may even hang or crash), the root cause of this problem is the failure of the peer -- that is what you need to investigate. For example, there may be a core file that you can examine. More generally: such peer hangups are frequently caused by application bugs or other external events. Local host: cn4130 Local PID: 18831 Peer host: cn3683 -------------------------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received formating database... #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype prot -in /lscratch/47455932/maker_rNzO3X/27/blastprep/protein2%2Efasta.mpi.10.25 #-------------------------------# SIGTERM received SIGTERM received SIGTERM received SIGTERM received ... SIGTERM received SIGTERM received SIGTERM received Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached ... [cn3683:36010] 59 more processes have sent help message help-mpi-btl-tcp.txt / peer hung up [cn3683:36010] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages -------------------------------------------------------------------------- mpiexec detected that one or more processes exited with non-zero status, thus causing the job to be terminated. The first process to do so was: Process name: [[352,1],37] Exit code: 255 -------------------------------------------------------------------------- I rebuild the mpi_blast and rerun it again, also get the error: #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_k6a7Hy/32/blastprep/rna%2Efasta.mpi.10.3 #-------------------------------# Thread 1 terminated abnormally: can't open /lscratch/47559740/mpiS84Ju: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. --> rank=27, hostname=cn4115 FATAL: Thread terminated, causing all processes to fail --> rank=27, hostname=cn4115 deleted:276 hits doing tblastx of alt-ESTs formating database... #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_nCKTgE/2/blastprep/rna%2Efasta.mpi.10.11 #-------------------------------# running blast search. #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47559740/maker_0kWZTA/rna%2Efasta.mpi.10.20 -query /lscratch/47559740/maker_0kWZTA/35/tig00027947_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/86/7F/tig00027947_arrow//theVoid.tig00027947_arrow/0/tig00027947_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.20.tblastx #-------------------------------# ------------------------------------------------------- Primary job terminated normally, but 1 process returned a non-zero exit code.. Per user-direction, the job has been aborted. ------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Thanks, Zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either > '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include > ib0?). Otherwise if you have infiniband on the nodes it will try and use > OpenFabrics compatible libraries which will kill code doing system calls > (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is > always sacrificed by maker to act only for message management among > processes, so with -n 2, you have one process working and one managing > data. So only one contig will run at a time. If you set it to a higher > number the issue will go away. The message manger process starts to get > saturated at ~200 CPUs, so anything above that processor count becomes less > beneficial to the job. > > Thanks, > Carson > > > > > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 > --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A > run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and > large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > >> What is your command line? Are you running interactively or as a >> submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c wrote: >> >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set >> the number of task to 2, but there's only one contigs in running. Should it >> be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues >>> with OpenMPI. You can add them all or one at a time depending on issues you >>> get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message >>> help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >>> all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt >>> wrote: >>> >>>> You may need to delete the .../maker/perl directory before doing the >>>> reinstall if not doing a brand new installation. Otherwise you can ignore >>>> the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for >>>> MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval >>>> 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>>> cjfields at illinois.edu> wrote: >>>> >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>>> It looks like a Perl issue with threads, though I don?t see why this would >>>>> crash a cluster. The fact there is a log file would suggest it just ended >>>>> the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> *From: *maker-devel on behalf >>>>> of Carson Holt >>>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>>> *To: *zl c >>>>> *Cc: *"maker-devel at yandell-lab.org" >>>>> *Subject: *Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer >>>>> cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>>> genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yand >>>>> ell-lab.org >>>>> >>>>> >>>>> >>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Thu Aug 17 10:36:20 2017 From: carsonhh at gmail.com (Carson Holt) Date: Thu, 17 Aug 2017 09:36:20 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: This is the causal error ?> can't open /lscratch/47455932/mpiavG_z It kills one process and causes everything else to die in an ugly way. There are several possible causes: 1. /lscratch/47455932/ is not actually locally mounted. It may be a virtual directory created at run time that exists on the network but not as a true locally mounted disk. If this is the case, there can be a slight IO delay under heavy IO load (common on NFS) that can cause directories and files to appear to not exist. This is one of the reasons TMP= must be sent to a true locally mounted disk. The IO load MAKER can produce can swamp network mounted disks creating strange errors. 2. /lscratch/47455932/ may only exist on the head node and not other nodes for the job. True local temporary storage is not available across nodes. It is only available on the node it is attached to. So if you are creating the location as part of your job, it may only exist on the head node and not the other nodes. Usually this value is set to /tmp because each machine should have it?s own independent /tmp location. 3. /lscratch/47455932/ exists on all nodes, but is full on one of them. ?Carson ?Carson > On Aug 17, 2017, at 7:39 AM, zl c wrote: > > I use '--mca btl ^openib' and it runs on multiple nodes. It works and I see some sequences is done for the test run. > > Then I make another run using the large nr database and use local space on the computer cluster, which fails. > Submit CMD: > sbatch --gres=lscratch:100 --time=168:00:00 --partition=multinode --constraint=x2680 --mem-per-cpu=64g --ntasks=8 --ntasks-per-core=1 --job-name run05.mpi -o log.mpi.00/run05.mpi.o%A run05.mpi.sh > Error message: > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_BLLXNq/rna%2Efasta.mpi.10.21 -query /lscratch/47455932/maker_BLLXNq/50/tig00017383_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/5A/65/tig00017383_arrow//theVoid.tig00017383_arrow/0/tig00017383_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.21.tblastx > #-------------------------------# > Thread 1 terminated abnormally: can't open /lscratch/47455932/mpiavG_z: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. > --> rank=37, hostname=cn4120 > FATAL: Thread terminated, causing all processes to fail > --> rank=37, hostname=cn4120 > ------------------------------------------------------- > Primary job terminated normally, but 1 process returned > a non-zero exit code.. Per user-direction, the job has been aborted. > ------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > running blast search. > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_Zsg_Gg/rna%2Efasta.mpi.10.8 -query /lscratch/47455932/maker_Zsg_Gg/62/tig00001111_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/B8/A5/tig00001111_arrow//theVoid.tig00001111_arrow/0/tig00001111_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.8.tblastx > #-------------------------------# > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > -------------------------------------------------------------------------- > An MPI communication peer process has unexpectedly disconnected. This > usually indicates a failure in the peer process (e.g., a crash or > otherwise exiting without calling MPI_FINALIZE first). > > Although this local MPI process will likely now behave unpredictably > (it may even hang or crash), the root cause of this problem is the > failure of the peer -- that is what you need to investigate. For > example, there may be a core file that you can examine. More > generally: such peer hangups are frequently caused by application bugs > or other external events. > > Local host: cn4130 > Local PID: 18831 > Peer host: cn3683 > -------------------------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > formating database... > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype prot -in /lscratch/47455932/maker_rNzO3X/27/blastprep/protein2%2Efasta.mpi.10.25 > #-------------------------------# > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > ... > SIGTERM received > SIGTERM received > SIGTERM received > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > > ... > [cn3683:36010] 59 more processes have sent help message help-mpi-btl-tcp.txt / peer hung up > [cn3683:36010] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages > -------------------------------------------------------------------------- > mpiexec detected that one or more processes exited with non-zero status, thus causing > the job to be terminated. The first process to do so was: > > Process name: [[352,1],37] > Exit code: 255 > -------------------------------------------------------------------------- > > > I rebuild the mpi_blast and rerun it again, also get the error: > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_k6a7Hy/32/blastprep/rna%2Efasta.mpi.10.3 > #-------------------------------# > Thread 1 terminated abnormally: can't open /lscratch/47559740/mpiS84Ju: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. > --> rank=27, hostname=cn4115 > FATAL: Thread terminated, causing all processes to fail > --> rank=27, hostname=cn4115 > deleted:276 hits > doing tblastx of alt-ESTs > formating database... > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_nCKTgE/2/blastprep/rna%2Efasta.mpi.10.11 > #-------------------------------# > running blast search. > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47559740/maker_0kWZTA/rna%2Efasta.mpi.10.20 -query /lscratch/47559740/maker_0kWZTA/35/tig00027947_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/86/7F/tig00027947_arrow//theVoid.tig00027947_arrow/0/tig00027947_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.20.tblastx > #-------------------------------# > ------------------------------------------------------- > Primary job terminated normally, but 1 process returned > a non-zero exit code.. Per user-direction, the job has been aborted. > ------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > > Thanks, > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt > wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0?). Otherwise if you have infiniband on the nodes it will try and use OpenFabrics compatible libraries which will kill code doing system calls (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is always sacrificed by maker to act only for message management among processes, so with -n 2, you have one process working and one managing data. So only one contig will run at a time. If you set it to a higher number the issue will go away. The message manger process starts to get saturated at ~200 CPUs, so anything above that processor count becomes less beneficial to the job. > > Thanks, > Carson > > > > >> On Aug 15, 2017, at 3:05 PM, zl c > wrote: >> >> I submit a job: >> sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh >> >> CMD in run06.maker.mpi.sh >> mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta >> >> Another question: >> How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. >> >> Thanks, >> zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> >> On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt > wrote: >> What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c > wrote: >> >>> Hi Carson, Christopher, Daniel, >>> >>> Thank you for your kind help. >>> >>> Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? >>> >>> Zelin >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com ] >>> >>> >>> NIH/NHGRI >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt > wrote: >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>>> On Aug 15, 2017, at 9:34 AM, zl c > wrote: >>>> >>>> Here are some latest message: >>>> >>>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com ] >>>> >>>> >>>> >>>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: >>>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c > wrote: >>>> >>>>> When I installed by './Build install', I got following some messages: >>>>> Configuring MAKER with MPI support >>>>> Installing MAKER... >>>>> Configuring MAKER with MPI support >>>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>>> >>>>> I'm not sure whether it's correctly installed. >>>>> >>>>> Thanks, >>>>> >>>>> -------------------------------------------- >>>>> Zelin Chen [chzelin at gmail.com ] >>>>> >>>>> NIH/NHGRI >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> From: maker-devel > on behalf of Carson Holt > >>>>> Date: Monday, August 14, 2017 at 2:18 PM >>>>> To: zl c > >>>>> Cc: "maker-devel at yandell-lab.org " > >>>>> Subject: Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com ] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>> >>>>> >>>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From yplee614 at 163.com Fri Aug 18 05:46:08 2017 From: yplee614 at 163.com (yplee) Date: Fri, 18 Aug 2017 18:46:08 +0800 Subject: [maker-devel] basis of gene removed in maker re-annotation Message-ID: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> Dear maker author, I am yongping li, a student from huazhong agriculture university, china. We used MAKER to re-annotation our genome annotation. There is some gene were removal in MAKER output when i input out previous annotation gff file, so what was the basis for gene removal? would you please provide us the details of gene remove? The reviews ask question when i submit my re-annotation paper to journal. Best regards Yours Sincerely From carsonhh at gmail.com Fri Aug 18 10:35:48 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 18 Aug 2017 09:35:48 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> Message-ID: <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Hi Quanwei, > (1) We are doing genome annotation for a new rodent species, we wonder whether we should use repeat library for "Mammalia" or "rodent"? Which is more proper, if we did not construct a species-specific repeat library for the new genome? Over masking can occur, but you should really only worry about it if there is a specific gene you are looking for or gene family and you don?t care about false positive gene models. On a genome wide level you will find that undermasking is almost always the greater danger. So I?d recommend using Mammalia. Also you should always build a species specific library when working with repeat rich organisms like mammals. > (2) With some concerns as discussed above emails, we did not train a species-specific repeat library. Since we have finished the annotation only using the repeat library from repeatMasker and Maker2, we wonder whether it is worth for us to firstly train a species-specific repeat library and then do the genome annotation again? Will it (i.e., trainning a species-specific repeat library) significantly affect the gene annotation and downstream analysis (e.g., gene family expansion analysis, positive selection)? It might be ok. Both Mammalia and rodent are already rich in related species repeats in RepBase. But you still may have a lot of false positives because of missed repeats. Repeats and transposable elements tend to create false regions of high evidence homology (make it look like you are getting evidence for a gene in the region, but when you look at the underlying sequence you realize it is a spurious alignment). > (3) We identified some gene families under contraction, but we want to confirm those gene families really lost copies in our new genome. Do you think it is worth to do the genome annotation without repeat masking, so there will not be genes missing from annotation due to repeat mask? Without repeat masking you will get a lot of false alignments. If you find anything without repeat masking you will need to do heavy manual review of the alignment and perhaps even domain identification to further weed out the many false positives you are sure to get. ?Carson From carsonhh at gmail.com Fri Aug 18 10:37:38 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 18 Aug 2017 09:37:38 -0600 Subject: [maker-devel] basis of gene removed in maker re-annotation In-Reply-To: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> References: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> Message-ID: Genes are removed if they have no evidence support or are overlapped by another gene that has better evidence support (the AED score measures evidence support). If you pass in old gene models in GFF3 format (model_gff), they will always be kept, even without evidence support but can be replaced by better supported overlapping models. ?Carson > On Aug 18, 2017, at 4:46 AM, yplee wrote: > > Dear maker author, > > I am yongping li, a student from huazhong agriculture university, china. We used MAKER to re-annotation our genome annotation. There is some gene were removal in MAKER output when i input out previous annotation gff file, so what was the basis for gene removal? > > would you please provide us the details of gene remove? The reviews ask question when i submit my re-annotation paper to journal. > > > > Best regards > > > Yours Sincerely > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org From qwzhang0601 at gmail.com Mon Aug 21 11:51:34 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Mon, 21 Aug 2017 12:51:34 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: Dear Carson: I am trying to build a species specific repeat library for our new rodent species, following " http://weatherby.genetics.utah.edu/MAKER/wiki/index.php/Repeat_Library_Construction--Basic". But there are somethings not clear to us, would you please explain? Thanks (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder"*. *Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). In the file "maker_opts.ctl" #-----Repeat Masking (leave values blank to skip repeat masking) model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker Many thanks Best Quanwei 2017-08-18 11:35 GMT-04:00 Carson Holt : > Hi Quanwei, > > > (1) We are doing genome annotation for a new rodent species, we wonder > whether we should use repeat library for "Mammalia" or "rodent"? Which is > more proper, if we did not construct a species-specific repeat library for > the new genome? > > Over masking can occur, but you should really only worry about it if there > is a specific gene you are looking for or gene family and you don?t care > about false positive gene models. On a genome wide level you will find that > undermasking is almost always the greater danger. So I?d recommend using > Mammalia. Also you should always build a species specific library when > working with repeat rich organisms like mammals. > > > > (2) With some concerns as discussed above emails, we did not train a > species-specific repeat library. Since we have finished the annotation only > using the repeat library from repeatMasker and Maker2, we wonder whether it > is worth for us to firstly train a species-specific repeat library and > then do the genome annotation again? Will it (i.e., trainning a > species-specific repeat library) significantly affect the gene annotation > and downstream analysis (e.g., gene family expansion analysis, positive > selection)? > > It might be ok. Both Mammalia and rodent are already rich in related > species repeats in RepBase. But you still may have a lot of false positives > because of missed repeats. Repeats and transposable elements tend to create > false regions of high evidence homology (make it look like you are getting > evidence for a gene in the region, but when you look at the underlying > sequence you realize it is a spurious alignment). > > > > (3) We identified some gene families under contraction, but we want to > confirm those gene families really lost copies in our new genome. Do you > think it is worth to do the genome annotation without repeat masking, so > there will not be genes missing from annotation due to repeat mask? > > Without repeat masking you will get a lot of false alignments. If you find > anything without repeat masking you will need to do heavy manual review of > the alignment and perhaps even domain identification to further weed out > the many false positives you are sure to get. > > ?Carson -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 22 11:15:59 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 22 Aug 2017 10:15:59 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> Message-ID: The est2genome option takes an alignment and then just identifies the longest ORF in that alignment and turns it into a model (these models are good enough to rain with). The reason est2genoime is not recommended for the annotation step are several. 1. They are likely to be partial in many cases or include a number of merged assemblies depending on the organism. 2. They will likely only represent a fraction of the genes so relying only on est2genome models will result in low sensitivity since not everything is expected to be expressed or assembled. 3. Ab initio predictors that receive the intron/exon hints from a transcript evidence alignment should still replicate the structure of correctly assembled transcripts anyways, but they can still call genes in other regions without transcript evidence to improve sensitivity or improve structure for models with only partial transcript evidence alignment (i.e. they can complete the incomplete models). 4. If their are assembly error?s (you can expect a lot of these in a draft assembly), ab initio predictors can work around the errors to create an intron/exon structure with reasonable similar ORF that will be similar to the true ORF if not exactly correct, where alignment based methods cannot and will just produce a truncated ORF. 5. est2genome models will always have great AED scores (falsely good scores) since they are their own evidence and match themselves exactly, so spurious alignments and partial alignments always score very high even when they are bad models. By turning est2genome off, you allows the HMM scoring mechanism to act as an additional filter on those models. If you have really really good transcript evidence, it is possible for est2genome to work very well. But the likelihood of having evidence that perfect is low. So for those reasons we recommend using it only as an intermediate step. ?Carson > On Aug 19, 2017, at 10:38 AM, Tim Fallon wrote: > > Hi Carson, > > Just a follow up to this, for posterity. I was able to do what I wanted by using just the est2genome=1, and turning off protein2genome. The input to the est2genome is a Trinity de novo transcriptome assembly with strand specific libraries + assembly and jaccard clip. The results seem quite reliable, and I?m not getting the problem where tandem similar genes were getting fused anymore (the original problem with this inquiry). I expect this is due to there being enough nucleotide differences in the est2genome alignment of two similar and tandem transcripts to effectively distinguish them. > > In any event, it wasn?t clear to me that est2genome=1 alone would produce ORF/CDS predictions (for the genes), and I?ve done a lot of reading around the Maker documentation and papers. Might be worth considering making the documentation more clear in this respect in the future. I know that est2genome & protein2genome were originally intended more as an intermediate step for ab-initio gene predictor training, but in my opinion with the quality and cost-effectivness of transcript discovery RNA-Seq, it seems reasonable to ditch the ab-initio gene prediction and go entirely with a ?est2genome=1? like approach. It might be worthwhile to document what your thought process would be for reliable ab-initio free gene annotation w/ Maker. I?ll mention I haven?t looked into the PASA pipeline for this, which is the only other major publicly available gene structure annotation pipeline known to me, as the parallelization in Maker has been working quite well for me. > > Are the heuristics for this ORF prediction in est2genome=1 documented anywhere? E.g., does it only pick the longest ORF per transcript? Or if there are multiple ?good? ORFs (>200 amino acids) per transcript, will it try and split those into different genes? I ask as my current task is trying to merge the previously mentioned de novo transcriptome derived gene models from est2genome with est2genome gene models of a reference guided transcriptome assembly. Although the reference guided transcript assembly captures more genes that the Trinity assembly (by tblastn), the transcripts are notably artifactually chimeric, sometimes containing 4-5 CDSs, so the heuristics for the Maker est2genome could be pretty influential. > > All the best, > -Tim > >> On Jul 13, 2017, at 1:05 PM, Carson Holt > wrote: >> >> est2genome and protein2genome take BLAST hits, polish them with exonerate around splice sites and then turn the alignment directly into a gene model. So if the alignment is partial because the EST or mRNA-seq do not cross the entire transcript or the protein homology does not cross the entire CDS, then the resulting model will be partial. It can be end to end, but partial tends to be more common than not unless you are using a protein evidence library with limited divergence. >> >> ?Carson >> >> >> >>> On Jul 10, 2017, at 2:00 PM, Tim Fallon > wrote: >>> >>> Hi Carson, >>> >>> So far what I've noticed with just est2genome, and protein2genome, using only de novo assembled transcripts with transdecoder predicted peptides (both mapped in maker with blast evalue limit = 1e-50), the gene models (for the genes where I have enough information about the "correct" gene structure), have been full length. Is this unexpected? >>> >>> Will try Apollo. Though I'd like to avoid manual curation. Perhaps it is worth talking to the Augustus developers to see why Augustus was making the exon error in my key gene that led me to ditching it altogether. >>> >>> Agree there are varying qualities of draft assemblies. In our case, we did 100X Illumina hybrid assembly w/ 50X PacBio. The local structure so far seems to be pretty good. >>> >>> Good to know that the human and mouse assemblies even have gene errors, makes me feel better about how much time I've put in trying to get my genome annotation perfect :) >>> >>> All the best, >>> -Tim >>> >>> On Jul 10, 2017, at 3:20 PM, Carson Holt > wrote: >>> >>>> est2genome and protein2genome will almost always be partial. Also the error rate on draft assemblies is much higher than most people realize. Beyond issues already mentioned in the previous e-mail, there is also the issue that organisms are diploid, but the assembly is haploid, so variation gets squashed which also breaks ORFs (there are several examples of this in both the mature human and mouse genome assemblies). For many draft assemblies, you can expect ORF affecting errors in as much as 10-15% of your annotations. >>>> >>>> Try opening the cases with issues and manually editing them in Apollo. Possible sources of sequence guiding the annotation may become more apparent (look at mismatches in the mRNA-seq alignments relative to the assembly for example). And if not, and the region is just too complex for the predictor, then you can force the model with Apollo. >>>> >>>> ?Carson >>>> >>>> >>>>> On Jul 6, 2017, at 6:45 AM, Tim Fallon > wrote: >>>>> >>>>> Hi Carson, >>>>> >>>>> This region is definitely entirely correct at the genomic nucleotide level, no missassemblies. Would you have any strong reservations about ditching the ab-initio prediction and sticking entirely with the est2genome predictions and protein2genome predictions? Right now this is what I?m thinking, as troubleshooting the ab-initio training seems like it could be a long road. >>>>> >>>>> All the best, >>>>> -Tim >>>>> >>>>>> On Jun 26, 2017, at 6:00 PM, Carson Holt > wrote: >>>>>> >>>>>> Augustus uses an HMM with scoring bonuses for evidence match. If a difference in the assembly breaks the ORF anywhere in the transcript relative to the evidence or removes high scoring transcript start/stop sequences, then Augustus will add/skip exons or trim/extend transcripts to capture what scoring bonuses it can as best it can. So wherever you see Augustus behaving weirdly, you likely have something off in the assembly (small stretch of NN?s or single basepair duplications/deletions that affect the ORF and scoring model). So what Augustus produces is the best fit gene model to hop around assembly anomalies while still producing a canonical model. >>>>>> >>>>>> In areas like the ones I describe above, EVM refuses to produce any model. So you can experiment with the EVM options in MAKER3, but what you may find is that problem regions tend to get no models with EVM. I believe using the pred_gff trick I mentioned previously may be the easiest work around. Also make sure to prefilter mRNA-seq evidence to avoid transcript joining (trinity has a jaccard_clip option which can help). Because if you are getting transcript joining in proteins, you are almost certain to get it in transcript evidence as well. >>>>>> >>>>>> ?Carson >>>>>> >>>>>>> On Jun 22, 2017, at 10:59 PM, Tim Fallon > wrote: >>>>>>> >>>>>>> Hi Carson, >>>>>>> >>>>>>> Thanks for the response! After sending my initial email, I did notice this particular issue was warned about in the Cambell et al. 2014 Maker protocols paper. Perhaps future versions of the pipeline might have a workaround or warning for this presumably common issue. At least in my case, the genome I?m annotating has large introns, and also tandem gene clusters of homologous genes, so I?ve been unable to solve this issue entirely by changing existing parameters (e.g. split_hit), though perhaps exonerate / protein2genome direct gene annotation does handle it correctly. >>>>>>> >>>>>>> Regarding the protein2genome only being a intermediate stage, as I?ve been working towards a final annotation, I?ve actually been mostly relying on the protein2genome direct gene annotation, as although I have a trained Augustus that is presumably getting the hints from the evidence, my main target genes have been producing subtly wrong gene-models (Augustus produced splice sit off by a handful of nucleotides, leading to unintended & unsupported amino acids in the protein). I also trained SNAP, but those predictions were worse than the Augustus predictions. >>>>>>> >>>>>>> Do you have any tips for using the Evidence Modeler integration of the Maker 3.0.0 beta? That seems to be the best way to have the final gene models rely more on extrinsic evidence over my mildly incorrect ab-initio predictions. Or perhaps PASA is more appropriate for gene-models that would strictly adhere to extrinsic de novo assembled transcript / predicted ORF evidence? >>>>>>> >>>>>>> All the best, >>>>>>> -Tim >>>>>>> >>>>>>>> On Jun 23, 2017, at 12:27 AM, Carson Holt > wrote: >>>>>>>> >>>>>>>> The protein_match features are the direct BLASTX results. Because of how BLAST works, if you have neighboring paralogs, it can place HSPs in both. So the final hit ends up being to large. The protein2genome feature is then the result of exonerate polishing these blast alignments (this will usually remove false merging and bad exon order). The protein2genome=1 option on the other hand just tell maker that you want to try and convert the exonerate hits directly into gene models (only do this for training and not final annotation). One way to drop the BLASTX results may be to filter the GFF3 results to keep only protein2genome features, pass those into protein_gff, and then turn off protein= for the next run. This forces the blastx results to be dropped. You may want to set blast_depth parameters to something like 10 in maker_bopts.ctl before doing this to trim per locus evidence depth to 10 if you are using too much input data. >>>>>>>> >>>>>>>> ?Carson >>>>>>>> >>>>>>>> >>>>>>>> >>>>>>>>> On Jun 13, 2017, at 11:35 AM, Tim Fallon > wrote: >>>>>>>>> >>>>>>>>> Hi there, >>>>>>>>> >>>>>>>>> I am aligning reference proteins to an insect genome through Maker, in preparation for using the gene models from the protein alignments as evidence to train SNAP (alongside de-novo assembled RNA-Seq). I also plan on passing the protein alignments to a future Maker run as hints for SNAP / Augustus. >>>>>>>>> >>>>>>>>> I?ve noticed that the maker blastx "protein_match? feature, which I presume is a result of Maker trying to make the blastx HSPs contiguous to format as a reference for exonerate (this Maker run did have protein2genome turned on), tends to fuse tandem genes from the same gene family. See attached image. >>>>>>>>> >>>>>>>>> The red regions highlight two de novo assembled transcripts which I aligned manually, from two genes that are homologous. The top track is the blastx ?match_part? features, the bottom track is the blastx ?protein_match? features. You can see that the protein_match fuses the two genes, using ~1000 bp in an intervening region, that doesn?t have blastx HSP support in the blastx ?match_part? track. The trick seems to be that a single reference protein, has blastx matches on both the left and right gene. >>>>>>>>> >>>>>>>>> Cleary this isn?t a good gene model to train SNAP with, but would this misannotation screw up the hints passed to pretrained SNAP / Augustus? >>>>>>>>> >>>>>>>>> Is there anyway to prevent this protein_match fusing of adjacent similar genes from happening? For species that are closer, I?ve set the ?eval_blastx? to be a lot higher (1e-50), and in that case the genes don?t get fused (but, with that level of stringent search, it is more like an orthology search, rather than just annotating general protein similarity). I do have (rare) introns ~1000 bp, so I wouldn?t want to change the Maker ?split_hit? parameter to be too low. >>>>>>>>> >>>>>>>>> All the best, >>>>>>>>> -Tim >>>>>>>>> >>>>>>>>> Timothy R. Fallon >>>>>>>>> PhD candidate >>>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>>> Department of Biology >>>>>>>>> MIT >>>>>>>>> >>>>>>>>> tfallon at mit.edu >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>> _______________________________________________ >>>>>>>>> maker-devel mailing list >>>>>>>>> maker-devel at box290.bluehost.com >>>>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>>>> >>>>>>> >>>>>>> Timothy R. Fallon >>>>>>> PhD candidate >>>>>>> Laboratory of Jing-Ke Weng >>>>>>> Department of Biology >>>>>>> MIT >>>>>>> >>>>>>> tfallon at mit.edu >>>>>> >>>>> >>>>> Timothy R. Fallon >>>>> PhD candidate >>>>> Laboratory of Jing-Ke Weng >>>>> Department of Biology >>>>> MIT >>>>> >>>>> tfallon at mit.edu >>>> >> > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From tfallon at mit.edu Tue Aug 22 11:38:47 2017 From: tfallon at mit.edu (Tim Fallon) Date: Tue, 22 Aug 2017 12:38:47 -0400 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> Message-ID: <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) All the best, -Tim > On Aug 22, 2017, at 12:15 PM, Carson Holt wrote: > > The est2genome option takes an alignment and then just identifies the longest ORF in that alignment and turns it into a model (these models are good enough to rain with). The reason est2genoime is not recommended for the annotation step are several. > > 1. They are likely to be partial in many cases or include a number of merged assemblies depending on the organism. > 2. They will likely only represent a fraction of the genes so relying only on est2genome models will result in low sensitivity since not everything is expected to be expressed or assembled. > 3. Ab initio predictors that receive the intron/exon hints from a transcript evidence alignment should still replicate the structure of correctly assembled transcripts anyways, but they can still call genes in other regions without transcript evidence to improve sensitivity or improve structure for models with only partial transcript evidence alignment (i.e. they can complete the incomplete models). > 4. If their are assembly error?s (you can expect a lot of these in a draft assembly), ab initio predictors can work around the errors to create an intron/exon structure with reasonable similar ORF that will be similar to the true ORF if not exactly correct, where alignment based methods cannot and will just produce a truncated ORF. > 5. est2genome models will always have great AED scores (falsely good scores) since they are their own evidence and match themselves exactly, so spurious alignments and partial alignments always score very high even when they are bad models. By turning est2genome off, you allows the HMM scoring mechanism to act as an additional filter on those models. > > If you have really really good transcript evidence, it is possible for est2genome to work very well. But the likelihood of having evidence that perfect is low. So for those reasons we recommend using it only as an intermediate step. > > ?Carson > > > >> On Aug 19, 2017, at 10:38 AM, Tim Fallon > wrote: >> >> Hi Carson, >> >> Just a follow up to this, for posterity. I was able to do what I wanted by using just the est2genome=1, and turning off protein2genome. The input to the est2genome is a Trinity de novo transcriptome assembly with strand specific libraries + assembly and jaccard clip. The results seem quite reliable, and I?m not getting the problem where tandem similar genes were getting fused anymore (the original problem with this inquiry). I expect this is due to there being enough nucleotide differences in the est2genome alignment of two similar and tandem transcripts to effectively distinguish them. >> >> In any event, it wasn?t clear to me that est2genome=1 alone would produce ORF/CDS predictions (for the genes), and I?ve done a lot of reading around the Maker documentation and papers. Might be worth considering making the documentation more clear in this respect in the future. I know that est2genome & protein2genome were originally intended more as an intermediate step for ab-initio gene predictor training, but in my opinion with the quality and cost-effectivness of transcript discovery RNA-Seq, it seems reasonable to ditch the ab-initio gene prediction and go entirely with a ?est2genome=1? like approach. It might be worthwhile to document what your thought process would be for reliable ab-initio free gene annotation w/ Maker. I?ll mention I haven?t looked into the PASA pipeline for this, which is the only other major publicly available gene structure annotation pipeline known to me, as the parallelization in Maker has been working quite well for me. >> >> Are the heuristics for this ORF prediction in est2genome=1 documented anywhere? E.g., does it only pick the longest ORF per transcript? Or if there are multiple ?good? ORFs (>200 amino acids) per transcript, will it try and split those into different genes? I ask as my current task is trying to merge the previously mentioned de novo transcriptome derived gene models from est2genome with est2genome gene models of a reference guided transcriptome assembly. Although the reference guided transcript assembly captures more genes that the Trinity assembly (by tblastn), the transcripts are notably artifactually chimeric, sometimes containing 4-5 CDSs, so the heuristics for the Maker est2genome could be pretty influential. >> >> All the best, >> -Tim >> >>> On Jul 13, 2017, at 1:05 PM, Carson Holt > wrote: >>> >>> est2genome and protein2genome take BLAST hits, polish them with exonerate around splice sites and then turn the alignment directly into a gene model. So if the alignment is partial because the EST or mRNA-seq do not cross the entire transcript or the protein homology does not cross the entire CDS, then the resulting model will be partial. It can be end to end, but partial tends to be more common than not unless you are using a protein evidence library with limited divergence. >>> >>> ?Carson >>> >>> >>> >>>> On Jul 10, 2017, at 2:00 PM, Tim Fallon > wrote: >>>> >>>> Hi Carson, >>>> >>>> So far what I've noticed with just est2genome, and protein2genome, using only de novo assembled transcripts with transdecoder predicted peptides (both mapped in maker with blast evalue limit = 1e-50), the gene models (for the genes where I have enough information about the "correct" gene structure), have been full length. Is this unexpected? >>>> >>>> Will try Apollo. Though I'd like to avoid manual curation. Perhaps it is worth talking to the Augustus developers to see why Augustus was making the exon error in my key gene that led me to ditching it altogether. >>>> >>>> Agree there are varying qualities of draft assemblies. In our case, we did 100X Illumina hybrid assembly w/ 50X PacBio. The local structure so far seems to be pretty good. >>>> >>>> Good to know that the human and mouse assemblies even have gene errors, makes me feel better about how much time I've put in trying to get my genome annotation perfect :) >>>> >>>> All the best, >>>> -Tim >>>> >>>> On Jul 10, 2017, at 3:20 PM, Carson Holt > wrote: >>>> >>>>> est2genome and protein2genome will almost always be partial. Also the error rate on draft assemblies is much higher than most people realize. Beyond issues already mentioned in the previous e-mail, there is also the issue that organisms are diploid, but the assembly is haploid, so variation gets squashed which also breaks ORFs (there are several examples of this in both the mature human and mouse genome assemblies). For many draft assemblies, you can expect ORF affecting errors in as much as 10-15% of your annotations. >>>>> >>>>> Try opening the cases with issues and manually editing them in Apollo. Possible sources of sequence guiding the annotation may become more apparent (look at mismatches in the mRNA-seq alignments relative to the assembly for example). And if not, and the region is just too complex for the predictor, then you can force the model with Apollo. >>>>> >>>>> ?Carson >>>>> >>>>> >>>>>> On Jul 6, 2017, at 6:45 AM, Tim Fallon > wrote: >>>>>> >>>>>> Hi Carson, >>>>>> >>>>>> This region is definitely entirely correct at the genomic nucleotide level, no missassemblies. Would you have any strong reservations about ditching the ab-initio prediction and sticking entirely with the est2genome predictions and protein2genome predictions? Right now this is what I?m thinking, as troubleshooting the ab-initio training seems like it could be a long road. >>>>>> >>>>>> All the best, >>>>>> -Tim >>>>>> >>>>>>> On Jun 26, 2017, at 6:00 PM, Carson Holt > wrote: >>>>>>> >>>>>>> Augustus uses an HMM with scoring bonuses for evidence match. If a difference in the assembly breaks the ORF anywhere in the transcript relative to the evidence or removes high scoring transcript start/stop sequences, then Augustus will add/skip exons or trim/extend transcripts to capture what scoring bonuses it can as best it can. So wherever you see Augustus behaving weirdly, you likely have something off in the assembly (small stretch of NN?s or single basepair duplications/deletions that affect the ORF and scoring model). So what Augustus produces is the best fit gene model to hop around assembly anomalies while still producing a canonical model. >>>>>>> >>>>>>> In areas like the ones I describe above, EVM refuses to produce any model. So you can experiment with the EVM options in MAKER3, but what you may find is that problem regions tend to get no models with EVM. I believe using the pred_gff trick I mentioned previously may be the easiest work around. Also make sure to prefilter mRNA-seq evidence to avoid transcript joining (trinity has a jaccard_clip option which can help). Because if you are getting transcript joining in proteins, you are almost certain to get it in transcript evidence as well. >>>>>>> >>>>>>> ?Carson >>>>>>> >>>>>>>> On Jun 22, 2017, at 10:59 PM, Tim Fallon > wrote: >>>>>>>> >>>>>>>> Hi Carson, >>>>>>>> >>>>>>>> Thanks for the response! After sending my initial email, I did notice this particular issue was warned about in the Cambell et al. 2014 Maker protocols paper. Perhaps future versions of the pipeline might have a workaround or warning for this presumably common issue. At least in my case, the genome I?m annotating has large introns, and also tandem gene clusters of homologous genes, so I?ve been unable to solve this issue entirely by changing existing parameters (e.g. split_hit), though perhaps exonerate / protein2genome direct gene annotation does handle it correctly. >>>>>>>> >>>>>>>> Regarding the protein2genome only being a intermediate stage, as I?ve been working towards a final annotation, I?ve actually been mostly relying on the protein2genome direct gene annotation, as although I have a trained Augustus that is presumably getting the hints from the evidence, my main target genes have been producing subtly wrong gene-models (Augustus produced splice sit off by a handful of nucleotides, leading to unintended & unsupported amino acids in the protein). I also trained SNAP, but those predictions were worse than the Augustus predictions. >>>>>>>> >>>>>>>> Do you have any tips for using the Evidence Modeler integration of the Maker 3.0.0 beta? That seems to be the best way to have the final gene models rely more on extrinsic evidence over my mildly incorrect ab-initio predictions. Or perhaps PASA is more appropriate for gene-models that would strictly adhere to extrinsic de novo assembled transcript / predicted ORF evidence? >>>>>>>> >>>>>>>> All the best, >>>>>>>> -Tim >>>>>>>> >>>>>>>>> On Jun 23, 2017, at 12:27 AM, Carson Holt > wrote: >>>>>>>>> >>>>>>>>> The protein_match features are the direct BLASTX results. Because of how BLAST works, if you have neighboring paralogs, it can place HSPs in both. So the final hit ends up being to large. The protein2genome feature is then the result of exonerate polishing these blast alignments (this will usually remove false merging and bad exon order). The protein2genome=1 option on the other hand just tell maker that you want to try and convert the exonerate hits directly into gene models (only do this for training and not final annotation). One way to drop the BLASTX results may be to filter the GFF3 results to keep only protein2genome features, pass those into protein_gff, and then turn off protein= for the next run. This forces the blastx results to be dropped. You may want to set blast_depth parameters to something like 10 in maker_bopts.ctl before doing this to trim per locus evidence depth to 10 if you are using too much input data. >>>>>>>>> >>>>>>>>> ?Carson >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>>> On Jun 13, 2017, at 11:35 AM, Tim Fallon > wrote: >>>>>>>>>> >>>>>>>>>> Hi there, >>>>>>>>>> >>>>>>>>>> I am aligning reference proteins to an insect genome through Maker, in preparation for using the gene models from the protein alignments as evidence to train SNAP (alongside de-novo assembled RNA-Seq). I also plan on passing the protein alignments to a future Maker run as hints for SNAP / Augustus. >>>>>>>>>> >>>>>>>>>> I?ve noticed that the maker blastx "protein_match? feature, which I presume is a result of Maker trying to make the blastx HSPs contiguous to format as a reference for exonerate (this Maker run did have protein2genome turned on), tends to fuse tandem genes from the same gene family. See attached image. >>>>>>>>>> >>>>>>>>>> The red regions highlight two de novo assembled transcripts which I aligned manually, from two genes that are homologous. The top track is the blastx ?match_part? features, the bottom track is the blastx ?protein_match? features. You can see that the protein_match fuses the two genes, using ~1000 bp in an intervening region, that doesn?t have blastx HSP support in the blastx ?match_part? track. The trick seems to be that a single reference protein, has blastx matches on both the left and right gene. >>>>>>>>>> >>>>>>>>>> Cleary this isn?t a good gene model to train SNAP with, but would this misannotation screw up the hints passed to pretrained SNAP / Augustus? >>>>>>>>>> >>>>>>>>>> Is there anyway to prevent this protein_match fusing of adjacent similar genes from happening? For species that are closer, I?ve set the ?eval_blastx? to be a lot higher (1e-50), and in that case the genes don?t get fused (but, with that level of stringent search, it is more like an orthology search, rather than just annotating general protein similarity). I do have (rare) introns ~1000 bp, so I wouldn?t want to change the Maker ?split_hit? parameter to be too low. >>>>>>>>>> >>>>>>>>>> All the best, >>>>>>>>>> -Tim >>>>>>>>>> >>>>>>>>>> Timothy R. Fallon >>>>>>>>>> PhD candidate >>>>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>>>> Department of Biology >>>>>>>>>> MIT >>>>>>>>>> >>>>>>>>>> tfallon at mit.edu >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> _______________________________________________ >>>>>>>>>> maker-devel mailing list >>>>>>>>>> maker-devel at box290.bluehost.com >>>>>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>>>>> >>>>>>>> >>>>>>>> Timothy R. Fallon >>>>>>>> PhD candidate >>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>> Department of Biology >>>>>>>> MIT >>>>>>>> >>>>>>>> tfallon at mit.edu >>>>>>> >>>>>> >>>>>> Timothy R. Fallon >>>>>> PhD candidate >>>>>> Laboratory of Jing-Ke Weng >>>>>> Department of Biology >>>>>> MIT >>>>>> >>>>>> tfallon at mit.edu >>>>> >>> >> >> >> > Timothy R. Fallon PhD candidate Laboratory of Jing-Ke Weng Department of Biology MIT tfallon at mit.edu -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: smime.p7s Type: application/pkcs7-signature Size: 1853 bytes Desc: not available URL: From isabel.marcelino.im at gmail.com Wed Aug 23 11:29:57 2017 From: isabel.marcelino.im at gmail.com (Isabel Marcelino) Date: Wed, 23 Aug 2017 12:29:57 -0400 Subject: [maker-devel] Fwd: Errors with Blast engine and Fasta index In-Reply-To: References: Message-ID: ---------- Forwarded message ---------- From: Isabel Marcelino Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker-devel at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/ Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/ Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI Garanti sans virus. www.avast.com <#DAB4FAD8-2DD7-40BB-A1B8-4E2AA1F9FDF2> -------------- next part -------------- An HTML attachment was scrubbed... URL: From willett4 at email.unc.edu Wed Aug 23 11:26:05 2017 From: willett4 at email.unc.edu (Willett, Christopher S) Date: Wed, 23 Aug 2017 16:26:05 +0000 Subject: [maker-devel] question about FASTA warnings Message-ID: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Hello- I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. Thanks for your help, Best, Chris Willett here is a portion of the run log with some examples of the warnings: ------------------------------------------------------------ # LSBATCH: User input maker ------------------------------------------------------------ Successfully completed. Resource usage summary: CPU time : 59.63 sec. Total Requested Memory : 0.50 GB Delta Memory : - Max Processes : 7 Max Threads : 8 Run time : 47 sec. Turnaround time : 55 sec. The output (if any) follows: STATUS: Parsing control files... STATUS: Processing and indexing input FASTA files... STATUS: Setting up database for any GFF3 input... A data structure will be created for you at: /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore To access files for individual sequences use the datastore index: /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log STATUS: Now running MAKER... examining contents of the fasta file and run log --Next Contig-- #--------------------------------------------------------------------- Now starting the contig!! SeqID: contig-dpp-500-500 Length: 32156 #--------------------------------------------------------------------- setting up GFF3 output and fasta chunks doing repeat masking running repeat masker. #--------- command -------------# Widget::RepeatMasker: cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 #-------------------------------# doing blastx repeats formating database... #--------- command -------------# Widget::formater: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 #-------------------------------# Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. running blast search. #--------- command -------------# Widget::blastx: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner #-------------------------------# deleted:0 hits doing blastx repeats formating database... #--------- command -------------# Widget::formater: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 #-------------------------------# Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) (continues on as above but title lengths are different) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Research Associate Professor Department of Biology CB#3280 Coker Hall University of North Carolina, Chapel Hill Chapel Hill, NC, 27599-3280 Office: 2252 Genome Science Building phone: 919-843-8663 fax: 919-962-1625 http://labs.bio.unc.edu/Willett/ -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Wed Aug 23 11:57:59 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Wed, 23 Aug 2017 16:57:59 +0000 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: References: Message-ID: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? ~Daniel On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: ---------- Forwarded message ---------- From: Isabel Marcelino > Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker-devel at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI [https://ipmcdn.avast.com/images/icons/icon-envelope-tick-round-orange-animated-no-repeat-v1.gif] Garanti sans virus. www.avast.com _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Wed Aug 23 11:47:40 2017 From: dandence at gmail.com (Daniel Ence) Date: Wed, 23 Aug 2017 12:47:40 -0400 Subject: [maker-devel] question about FASTA warnings In-Reply-To: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> References: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Message-ID: Hi Chris, I haven?t seen that warning either in my usage of MAKER. My guess is that the version of Repeatmasker installed on your cluster has this warning and expects a certain format in the fasta headers. This could be checked by looking at the TE protein file that maker is using. Do you have access to that? In any case it probably isn?t an issue that needs to be fixed if the output otherwise looks good. ~Daniel > On Aug 23, 2017, at 12:26 PM, Willett, Christopher S wrote: > > Hello- > > I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. > > Thanks for your help, > > Best, > > Chris Willett > > here is a portion of the run log with some examples of the warnings: > > ------------------------------------------------------------ > # LSBATCH: User input > maker > ------------------------------------------------------------ > > Successfully completed. > > Resource usage summary: > > CPU time : 59.63 sec. > Total Requested Memory : 0.50 GB > Delta Memory : - > Max Processes : 7 > Max Threads : 8 > Run time : 47 sec. > Turnaround time : 55 sec. > > The output (if any) follows: > > STATUS: Parsing control files... > STATUS: Processing and indexing input FASTA files... > STATUS: Setting up database for any GFF3 input... > A data structure will be created for you at: > /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore > > To access files for individual sequences use the datastore index: > /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log > > STATUS: Now running MAKER... > examining contents of the fasta file and run log > > > > --Next Contig-- > > #--------------------------------------------------------------------- > Now starting the contig!! > SeqID: contig-dpp-500-500 > Length: 32156 > #--------------------------------------------------------------------- > > > setting up GFF3 output and fasta chunks > doing repeat masking > running repeat masker. > #--------- command -------------# > Widget::RepeatMasker: > cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 > #-------------------------------# > doing blastx repeats > formating database... > #--------- command -------------# > Widget::formater: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 > #-------------------------------# > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > running blast search. > #--------- command -------------# > Widget::blastx: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner > #-------------------------------# > deleted:0 hits > doing blastx repeats > formating database... > #--------- command -------------# > Widget::formater: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 > #-------------------------------# > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) > > (continues on as above but title lengths are different) > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > Research Associate Professor > Department of Biology > CB#3280 Coker Hall > University of North Carolina, Chapel Hill > Chapel Hill, NC, 27599-3280 > > Office: 2252 Genome Science Building > phone: > 919-843-8663 > fax: > 919-962-1625 > > http://labs.bio.unc.edu/Willett/ > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From isabel.marcelino.im at gmail.com Wed Aug 23 12:38:06 2017 From: isabel.marcelino.im at gmail.com (Isabel Marcelino) Date: Wed, 23 Aug 2017 10:38:06 -0700 (PDT) Subject: [maker-devel] Fwd: Errors with Blast engine and Fasta index In-Reply-To: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Message-ID: <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> Hi Daniel, Thank you for your feedback. In fact, my fasta entry is not empty (please see below). I even tried to reprocess the genome fasta file that I already processed using MAKER and it doesn't work either... Isabel (PS: I do not manage to "reply" your message but only "forward" it. I was wondering if there are any settings I should change? I participate in other google groups and I can "reply" to messages. Thanks for the help) (>NODE_1_length_465927_cov_94.9908 ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....) On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote: > > Hi Isabel, The warning is referring to an empty entry in one of the fasta > files (?Warning: Sequence contains no data?). This is probably in the > genome fasta file that you are trying to annotate. Can you check the fasta > entry ?NODE_1_length_465927_cov_94.9908?? > > ~Daniel > > > > On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: > > > ---------- Forwarded message ---------- > From: Isabel Marcelino > > Date: 23 August 2017 at 11:37 > Subject: Errors with Blast engine and Fasta index > To: maker... at googlegroups.com > > > Hello, > > I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) > running smoothly a few weeks ago and I could perform a de novo annotation > of one of my genome. In the meantime, I worked on other topics and, > yesterday, when I tried to annotate another genome, MAKER was not working. > The following message was appearing: > > BLAST engine error: Warning: Sequence contains no data > deleted:0 hits > stop here: NODE_1_length_465927_cov_94.9908 > ERROR: Fasta index error > at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 1095. > Process::MpiChunk::__ANON__() called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm > line 415 > eval {...} called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm > line 407 > Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 4224 > Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', > 'HASH(0x4cca458)', 3, 0) called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 341 > Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) > called at ../../bin/maker line 1614 > main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 > --> rank=2, hostname=SRV-WGS > ERROR: Failed while preparing masked sequence > ERROR: Chunk failed at level:3, tier_type:0 > FAILED CONTIG:NODE_1_length_465927_cov_94.9908 > > I tried to solve the problem (re-install Repeatmasker and blast, check > location of the several executables, check tmp folder, re-install MAKER, > etc) but still, I am not able to solve the problem. > Could you please help me out with this? Thank you so much. > > Cheers, > Isabel > > ************************************************* > Isabel MARCELINO, PhD > Unit? Environnement Sant? > Institut Pasteur de Guadeloupe > Morne Jolivi?re - B.P. 484 > 97183 LES ABYMES Cedex > Guadeloupe, FWI > > > > > Garanti > sans virus. www.avast.com > > _______________________________________________ > maker-devel mailing list > maker... at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 13:00:26 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:00:26 -0600 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Message-ID: It can also be that your temporary directory became full at one point or you set TMP= to a location that is not a local disk (i.e. set it to a network mounted storage location). The fasta index is based off of BerkleyDB which has issues if run of of network storage. In any case just restart, and it will probably get past the error on the retry. ?Carson > On Aug 23, 2017, at 10:57 AM, Ence,daniel wrote: > > Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? > > ~Daniel > > > >> On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: >> >> >> ---------- Forwarded message ---------- >> From: Isabel Marcelino > >> Date: 23 August 2017 at 11:37 >> Subject: Errors with Blast engine and Fasta index >> To: maker-devel at googlegroups.com >> >> >> Hello, >> >> I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. >> The following message was appearing: >> >> BLAST engine error: Warning: Sequence contains no data >> deleted:0 hits >> stop here: NODE_1_length_465927_cov_94.9908 >> ERROR: Fasta index error >> at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. >> Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 >> eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 >> Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 >> Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 >> Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 >> main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 >> --> rank=2, hostname=SRV-WGS >> ERROR: Failed while preparing masked sequence >> ERROR: Chunk failed at level:3, tier_type:0 >> FAILED CONTIG:NODE_1_length_465927_cov_94.9908 >> >> I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. >> Could you please help me out with this? Thank you so much. >> >> Cheers, >> Isabel >> >> ************************************************* >> Isabel MARCELINO, PhD >> Unit? Environnement Sant? >> Institut Pasteur de Guadeloupe >> Morne Jolivi?re - B.P. 484 >> 97183 LES ABYMES Cedex >> Guadeloupe, FWI >> >> >> >> Garanti sans virus. www.avast.com _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 12:57:30 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 11:57:30 -0600 Subject: [maker-devel] question about FASTA warnings In-Reply-To: References: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Message-ID: <725B8728-A7F7-4F60-80C7-D842240D67F9@gmail.com> They are warnings from makeblastdb. It depends on what version of BLAST you have installed. Either upgrade or downgrade to get them to go away. They are just warnings and not errors though, so you can safely ignore them. They are just really annoying. ?Carson > On Aug 23, 2017, at 10:47 AM, Daniel Ence wrote: > > Hi Chris, I haven?t seen that warning either in my usage of MAKER. My guess is that the version of Repeatmasker installed on your cluster has this warning and expects a certain format in the fasta headers. This could be checked by looking at the TE protein file that maker is using. Do you have access to that? > > In any case it probably isn?t an issue that needs to be fixed if the output otherwise looks good. > > ~Daniel > > > >> On Aug 23, 2017, at 12:26 PM, Willett, Christopher S > wrote: >> >> Hello- >> >> I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. >> >> Thanks for your help, >> >> Best, >> >> Chris Willett >> >> here is a portion of the run log with some examples of the warnings: >> >> ------------------------------------------------------------ >> # LSBATCH: User input >> maker >> ------------------------------------------------------------ >> >> Successfully completed. >> >> Resource usage summary: >> >> CPU time : 59.63 sec. >> Total Requested Memory : 0.50 GB >> Delta Memory : - >> Max Processes : 7 >> Max Threads : 8 >> Run time : 47 sec. >> Turnaround time : 55 sec. >> >> The output (if any) follows: >> >> STATUS: Parsing control files... >> STATUS: Processing and indexing input FASTA files... >> STATUS: Setting up database for any GFF3 input... >> A data structure will be created for you at: >> /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore >> >> To access files for individual sequences use the datastore index: >> /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log >> >> STATUS: Now running MAKER... >> examining contents of the fasta file and run log >> >> >> >> --Next Contig-- >> >> #--------------------------------------------------------------------- >> Now starting the contig!! >> SeqID: contig-dpp-500-500 >> Length: 32156 >> #--------------------------------------------------------------------- >> >> >> setting up GFF3 output and fasta chunks >> doing repeat masking >> running repeat masker. >> #--------- command -------------# >> Widget::RepeatMasker: >> cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 >> #-------------------------------# >> doing blastx repeats >> formating database... >> #--------- command -------------# >> Widget::formater: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 >> #-------------------------------# >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> running blast search. >> #--------- command -------------# >> Widget::blastx: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner >> #-------------------------------# >> deleted:0 hits >> doing blastx repeats >> formating database... >> #--------- command -------------# >> Widget::formater: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 >> #-------------------------------# >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) >> >> (continues on as above but title lengths are different) >> >> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ >> Research Associate Professor >> Department of Biology >> CB#3280 Coker Hall >> University of North Carolina, Chapel Hill >> Chapel Hill, NC, 27599-3280 >> >> Office: 2252 Genome Science Building >> phone: >> 919-843-8663 >> fax: >> 919-962-1625 >> >> http://labs.bio.unc.edu/Willett/ >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 13:10:44 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:10:44 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: > (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". > I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? Try Swiss-Prot. That is a well curated cross species set. > (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). > > In the file "maker_opts.ctl" > #-----Repeat Masking (leave values blank to skip repeat masking) > model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker > rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker Yes. Supply both. ?Carson -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Wed Aug 23 13:20:51 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Wed, 23 Aug 2017 18:20:51 +0000 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> Message-ID: Hi Isabel, if the issue isn?t with the fasta file itself, then I would look into the things that Carson suggested: out of memory issues on the disk where the TMP directory is located, etc. ~Daniel On Aug 23, 2017, at 1:38 PM, Isabel Marcelino > wrote: Hi Daniel, Thank you for your feedback. In fact, my fasta entry is not empty (please see below). I even tried to reprocess the genome fasta file that I already processed using MAKER and it doesn't work either... Isabel (PS: I do not manage to "reply" your message but only "forward" it. I was wondering if there are any settings I should change? I participate in other google groups and I can "reply" to messages. Thanks for the help) (>NODE_1_length_465927_cov_94.9908 ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....) On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote: Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? ~Daniel On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: ---------- Forwarded message ---------- From: Isabel Marcelino > Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker... at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI [https://lh6.googleusercontent.com/proxy/JjzEPM_1UQiAcgcIii9zH3waHJfrDmD6mwOpzjvKSWAzeFyvEmJKxjsfyB4-JKbN4o_rmMG0O6UuV95TfuAG3NaBCtKzucfHCUODobStNrGqQJzTwuEOKfxUSFySxNn_igewCYnfXbgJP-gAq2cupOvC=w5000-h5000] Garanti sans virus. www.avast.com _______________________________________________ maker-devel mailing list maker... at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 13:21:44 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:21:44 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> Message-ID: <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> > Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? We don?t have an externally editable wiki, but the mailing list is archived on google groups and is searchable. > As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). Related to this, I just got off of a conference call where we were looking at Augustus behavior, and a student did an experiment where they introduced early stop codons into 100 genes, then let Augustus predict again. 80% of the time Augustus altered splicing patterns to try and jump over the stop codon, 11% of the time it would truncate the transcript, and 9% of the time it would refuse to call anything. So when you see splicing errors, it is usually because something is affecting the ORF somewhere, so it alters splicing to extend the ORF to get the maximum scoring bonus by capturing downstream parts of features en hints > A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) MAKER only annotates tRNA?s and whatever snoscan annotates. It does not annotated any other non-coding features. ?Carson From carsonhh at gmail.com Wed Aug 23 13:25:24 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:25:24 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> Message-ID: Sorry 19,000 genes and not 100 genes in the Augustus test. ?Carson > On Aug 23, 2017, at 12:21 PM, Carson Holt wrote: > >> Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? > > We don?t have an externally editable wiki, but the mailing list is archived on google groups and is searchable. > > >> As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). > > Related to this, I just got off of a conference call where we were looking at Augustus behavior, and a student did an experiment where they introduced early stop codons into 100 genes, then let Augustus predict again. 80% of the time Augustus altered splicing patterns to try and jump over the stop codon, 11% of the time it would truncate the transcript, and 9% of the time it would refuse to call anything. So when you see splicing errors, it is usually because something is affecting the ORF somewhere, so it alters splicing to extend the ORF to get the maximum scoring bonus by capturing downstream parts of features en hints > > >> A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) > > MAKER only annotates tRNA?s and whatever snoscan annotates. It does not annotated any other non-coding features. > > ?Carson From eennadi at gmail.com Sun Aug 27 09:16:03 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Sun, 27 Aug 2017 15:16:03 +0100 Subject: [maker-devel] Maker not installing Message-ID: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 08:00:11 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 13:00:11 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: Message-ID: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 08:57:22 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 13:57:22 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Message-ID: <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? Thanks, Daniel Ence On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9 ============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 09:07:14 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 14:07:14 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Message-ID: <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: Hi Daniel The reply is emmannamekasMBP:maker emmannaemeka$ MAKER -ctl -bash: MAKER: command not found Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? Thanks, Daniel Ence On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9 ============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 08:24:58 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 14:24:58 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Message-ID: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: > Hi Emmanuel, In order for anyone to help you, you need post to the mailing > list the command and output (including errors) of the step that didn?t > work. > > Thanks, > Daniel Ence > > > On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: > > Hello all, > > I downloaded Maker and tried to install it. I succeeded in installing all > prerequisites however running maker ./build install, it showed that maker > installed. > > However trying to run maker it wouldn't run. > > Please how do I install maker to run on local computer? > > Thanks > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 09:00:04 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 15:00:04 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Message-ID: Hi Daniel The reply is emmannamekasMBP:maker emmannaemeka$ MAKER -ctl -bash: MAKER: command not found Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel wrote: > Hi, It looks like MAKER installed ok. What is the command that you used to > try to run MAKER? Can you show the result of running ?MAKER -ctl?? > > Thanks, > Daniel Ence > > > On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi wrote: > > Hi Ence, > Thanks for your reply, > > This is the step and error received > > emmannamekasMBP:src emmannaemeka$ ./build install > Installing MAKER... > Building MAKER > Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) > > The build status is > ============================================================================= > STATUS MAKER v2.31.9============================================================================== > PERL Dependencies: VERIFIED > External Programs: VERIFIED > External C Libraries: VERIFIED > MPI SUPPORT: DISABLED > MWAS Web Interface: DISABLED > MAKER PACKAGE: CONFIGURATION OK > > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: > >> Hi Emmanuel, In order for anyone to help you, you need post to the >> mailing list the command and output (including errors) of the step that >> didn?t work. >> >> Thanks, >> Daniel Ence >> >> >> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: >> >> Hello all, >> >> I downloaded Maker and tried to install it. I succeeded in installing all >> prerequisites however running maker ./build install, it showed that maker >> installed. >> >> However trying to run maker it wouldn't run. >> >> Please how do I install maker to run on local computer? >> >> Thanks >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/ >> profile/Emmanuel_Nnadi/publications >> >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 28 10:49:32 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 28 Aug 2017 09:49:32 -0600 Subject: [maker-devel] Maker not installing In-Reply-To: <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: After install the executables will be in the ?/maker/bin directory. Example (if you did the install in your home directory) ?> ~/maker/bin/maker You need to add the ?/maker/bin directory to your PATH for it to be found just by typing ?maker' Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html ?Carson > On Aug 28, 2017, at 8:07 AM, Ence,daniel wrote: > > Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? > > > >> On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: >> >> Hi Daniel >> The reply is >> emmannamekasMBP:maker emmannaemeka$ MAKER -ctl >> -bash: MAKER: command not found >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >> On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: >> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >> >> Thanks, >> Daniel Ence >> >> >>> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: >>> >>> Hi Ence, >>> Thanks for your reply, >>> >>> This is the step and error received >>> emmannamekasMBP:src emmannaemeka$ ./build install >>> Installing MAKER... >>> Building MAKER >>> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >>> >>> The build status is >>> >>> ============================================================================= >>> STATUS MAKER v2.31.9 >>> ============================================================================== >>> PERL Dependencies: VERIFIED >>> External Programs: VERIFIED >>> External C Libraries: VERIFIED >>> MPI SUPPORT: DISABLED >>> MWAS Web Interface: DISABLED >>> MAKER PACKAGE: CONFIGURATION OK >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: >>> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. >>> >>> Thanks, >>> Daniel Ence >>> >>> >>>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: >>>> >>>> Hello all, >>>> >>>> I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. >>>> >>>> However trying to run maker it wouldn't run. >>>> >>>> Please how do I install maker to run on local computer? >>>> >>>> Thanks >>>> >>>> Nnadi Nnaemeka Emmanuel >>>> Department of Microbiology, >>>> Faculty of Natural and Applied Science, >>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>> >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >> >> > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 12:32:40 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 18:32:40 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: Thanks I tried to export PATH running echo $PATH in the maker directory this returned /usr/bin:/bin:/usr/sbin:/sbin:/opt/X11/bin:/Users/emmannaemeka/Desktop/Gpm/maker/bin/maker 1. Does it mean that PATH has been exported? secondly, I tried to run the command maker -h, which maker, maker -CTL nothing returned. 2. how do i start up maker? 3. Do I need to be in maker directory to start maker? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 4:49 PM, Carson Holt wrote: > After install the executables will be in the ?/maker/bin directory. > Example (if you did the install in your home directory) ?> ~/maker/bin/maker > > You need to add the ?/maker/bin directory to your PATH for it to be found > just by typing ?maker' > > Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html > > ?Carson > > > On Aug 28, 2017, at 8:07 AM, Ence,daniel wrote: > > Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the > result of ?which maker?? > > > > On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi wrote: > > Hi Daniel > The reply is > emmannamekasMBP:maker emmannaemeka$ MAKER -ctl > -bash: MAKER: command not found > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel wrote: > >> Hi, It looks like MAKER installed ok. What is the command that you used >> to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >> >> Thanks, >> Daniel Ence >> >> >> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi wrote: >> >> Hi Ence, >> Thanks for your reply, >> >> This is the step and error received >> >> emmannamekasMBP:src emmannaemeka$ ./build install >> Installing MAKER... >> Building MAKER >> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >> >> The build status is >> ============================================================================= >> STATUS MAKER v2.31.9============================================================================== >> PERL Dependencies: VERIFIED >> External Programs: VERIFIED >> External C Libraries: VERIFIED >> MPI SUPPORT: DISABLED >> MWAS Web Interface: DISABLED >> MAKER PACKAGE: CONFIGURATION OK >> >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/ >> profile/Emmanuel_Nnadi/publications >> >> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: >> >>> Hi Emmanuel, In order for anyone to help you, you need post to the >>> mailing list the command and output (including errors) of the step that >>> didn?t work. >>> >>> Thanks, >>> Daniel Ence >>> >>> >>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: >>> >>> Hello all, >>> >>> I downloaded Maker and tried to install it. I succeeded in installing >>> all prerequisites however running maker ./build install, it showed that >>> maker installed. >>> >>> However trying to run maker it wouldn't run. >>> >>> Please how do I install maker to run on local computer? >>> >>> Thanks >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/ >>> profile/Emmanuel_Nnadi/publications >>> >>> >>> _______________________________________________ >>> maker-devel mailing list >>> maker-devel at box290.bluehost.com >>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >>> >> >> > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 28 12:36:51 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 28 Aug 2017 11:36:51 -0600 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: <8EAFE412-9EF7-4DB7-85A3-632BAC3372FD@gmail.com> Path needs to be a list of directories to search (you specified an executable location). So not this ?> /Users/emmannaemeka/Desktop/Gpm/maker/bin/maker Instead it needs to be this ?> /Users/emmannaemeka/Desktop/Gpm/maker/bin ?Carson > On Aug 28, 2017, at 11:32 AM, Emmanuel Nnadi > wrote: > > Thanks > > I tried to export PATH > > running > echo $PATH in the maker directory this returned > > /usr/bin:/bin:/usr/sbin:/sbin:/opt/X11/bin:/Users/emmannaemeka/Desktop/Gpm/maker/bin/maker > > 1. Does it mean that PATH has been exported? > > > secondly, > > I tried to run > the command maker -h, which maker, maker -CTL > > nothing returned. > > 2. how do i start up maker? > 3. Do I need to be in maker directory to start maker? > > Thanks > > > > > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications > On Mon, Aug 28, 2017 at 4:49 PM, Carson Holt > wrote: > After install the executables will be in the ?/maker/bin directory. Example (if you did the install in your home directory) ?> ~/maker/bin/maker > > You need to add the ?/maker/bin directory to your PATH for it to be found just by typing ?maker' > > Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html > > ?Carson > > >> On Aug 28, 2017, at 8:07 AM, Ence,daniel > wrote: >> >> Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? >> >> >> >>> On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: >>> >>> Hi Daniel >>> The reply is >>> emmannamekasMBP:maker emmannaemeka$ MAKER -ctl >>> -bash: MAKER: command not found >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>> On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: >>> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >>> >>> Thanks, >>> Daniel Ence >>> >>> >>>> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: >>>> >>>> Hi Ence, >>>> Thanks for your reply, >>>> >>>> This is the step and error received >>>> emmannamekasMBP:src emmannaemeka$ ./build install >>>> Installing MAKER... >>>> Building MAKER >>>> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >>>> >>>> The build status is >>>> >>>> ============================================================================= >>>> STATUS MAKER v2.31.9 >>>> ============================================================================== >>>> PERL Dependencies: VERIFIED >>>> External Programs: VERIFIED >>>> External C Libraries: VERIFIED >>>> MPI SUPPORT: DISABLED >>>> MWAS Web Interface: DISABLED >>>> MAKER PACKAGE: CONFIGURATION OK >>>> >>>> Nnadi Nnaemeka Emmanuel >>>> Department of Microbiology, >>>> Faculty of Natural and Applied Science, >>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: >>>> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. >>>> >>>> Thanks, >>>> Daniel Ence >>>> >>>> >>>>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: >>>>> >>>>> Hello all, >>>>> >>>>> I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. >>>>> >>>>> However trying to run maker it wouldn't run. >>>>> >>>>> Please how do I install maker to run on local computer? >>>>> >>>>> Thanks >>>>> >>>>> Nnadi Nnaemeka Emmanuel >>>>> Department of Microbiology, >>>>> Faculty of Natural and Applied Science, >>>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>>> >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>> >>> >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 30 09:01:02 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 30 Aug 2017 10:01:02 -0400 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: Dear Carson: Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? Thanks Best Quanwei 2017-08-23 14:10 GMT-04:00 Carson Holt : > > (1) For the predicted unknown (unclassified) repeat sequences (those in > Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were > searched against a transposase database (derived from RepeatMaske > r) and sequences matching transposase were > considered as transposons belonging to the relevant superfamily". > I wonder how to do this search. Annotate the "unknown" repeat sequences > using the Repeatmaker? Then what to do, if for an "unknown" repeat > sequence, only part of the sequence match the known repeat elements. > > > You can use RepBase match I guess, but I would not be overly worried about > classification. MAKER won?t use any classification info you give it. > > > (2) To exclude gene fragments, I need map the predicted repeat sequences > against a protein database, and then run the package "ProExcluder"*. * > Right? I wonder how to get such protein database. Since I am working on > a new rodent species, can I use all the rodent proteins from Uniprot (both > Swiss-Prot and TrEMBL)? > > > Try Swiss-Prot. That is a well curated cross species set. > > > (3) After I generate the species specific repeat library, do I still need > to select a model organism for RepBase masking (as shown below). > > In the file "maker_opts.ctl" > #-----Repeat Masking (leave values blank to skip repeat masking) > model_org=Mammalia #select a model organism for RepBase masking in > RepeatMasker > rmlib=myRepeat.fa #provide an organism specific repeat library in fasta > format for RepeatMasker > > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 30 09:21:15 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 30 Aug 2017 10:21:15 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> Message-ID: Dear Daniel: Thank you! I am running it on an unmasked genome. Just want to make sure it is the correct way. Have a nice day! Best Quanwei 2017-08-30 10:19 GMT-04:00 Daniel Ence : > Hi Quanwei, > > I think you should run it on an unmasked genome. I don?t think that > redundancy between repeat libraries will be an issue. > > Thanks, > Daniel > > > > On Aug 30, 2017, at 10:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the > species specific repeat library. I wonder whether I need to remove the > masked the regions by existing repeatMasker library, before I run > repeatModeler? I think there may be some redundancy if I run repeatModeler > directly on the genome and then use both existing repeatMasker library and > the repeatModeler library to mask the genome. Does it matter, if there is > such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt : > >> >> (1) For the predicted unknown (unclassified) repeat sequences (those in >> Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were >> searched against a transposase database (derived from RepeatMaske >> r) and sequences matching transposase were >> considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences >> using the Repeatmaker? Then what to do, if for an "unknown" repeat >> sequence, only part of the sequence match the known repeat elements. >> >> >> You can use RepBase match I guess, but I would not be overly worried >> about classification. MAKER won?t use any classification info you give it. >> >> >> (2) To exclude gene fragments, I need map the predicted repeat sequences >> against a protein database, and then run the package "ProExcluder"*. * >> Right? I wonder how to get such protein database. Since I am working on >> a new rodent species, can I use all the rodent proteins from Uniprot (both >> Swiss-Prot and TrEMBL)? >> >> >> Try Swiss-Prot. That is a well curated cross species set. >> >> >> (3) After I generate the species specific repeat library, do I still need >> to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in >> RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta >> format for RepeatMasker >> >> >> Yes. Supply both. >> >> >> ?Carson >> > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From lcampbell at ebi.ac.uk Wed Aug 30 04:41:48 2017 From: lcampbell at ebi.ac.uk (Lahcen Campbell) Date: Wed, 30 Aug 2017 10:41:48 +0100 Subject: [maker-devel] Processing contig output - MPI job fail Message-ID: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> Hello folks, Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) /............/ /clustering transcripts into genes for annotations// //Processing transcripts into genes// //adding statistics to annotations// //Calculating annotation quality statistics// //choosing best annotation set// //Choosing best annotations// //processing chunk output// //processing contig output/ However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. *_The following error output was captured_*/*_:_* / Calculating annotation quality statistics choosing best annotation set Choosing best annotations processing chunk output processing contig output [proxy:0:0 at loom7.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:0 at loom7.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:0 at loom7.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:4 at loom6.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [mpiexec at loom7.ebi.ac.uk] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting [mpiexec at loom7.ebi.ac.uk] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. Any hints or insight on this would be greatly appreciated. Thank you in advance, Lahcen EBI-Hinxton, UK. -------------- next part -------------- An HTML attachment was scrubbed... URL: From lahcencampbell at gmail.com Wed Aug 30 04:44:03 2017 From: lahcencampbell at gmail.com (lahcen campbell) Date: Wed, 30 Aug 2017 10:44:03 +0100 Subject: [maker-devel] Processing contig output - MPI job fail Message-ID: *REPOSTED UNDER CORRECTED SUBSCRIBED MEMBER EMAIL ACCOUNT.* Hello folks, Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) *............* *clustering transcripts into genes for annotations* *Processing transcripts into genes* *adding statistics to annotations* *Calculating annotation quality statistics* *choosing best annotation set* *Choosing best annotations* *processing chunk output* *processing contig output* However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. *The following error output was captured* *: * Calculating annotation quality statistics choosing best annotation set Choosing best annotations processing chunk output processing contig output [proxy:0:0 at loom7.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:0 at loom7.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:0 at loom7.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:4 at loom6.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [mpiexec at loom7.ebi.ac.uk] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting [mpiexec at loom7.ebi.ac.uk] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. Any hints or insight on this would be greatly appreciated. Thank you in advance, Lahcen EBI-Hinxton, UK. -- ========================================== > Dr. Lahcen Campbell < > Contact: lahcencampbell at gmail.com < > https://www.ebi.ac.uk/about/people/lahcen-campbell < ========================================== -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Wed Aug 30 09:19:13 2017 From: dandence at gmail.com (Daniel Ence) Date: Wed, 30 Aug 2017 10:19:13 -0400 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> Hi Quanwei, I think you should run it on an unmasked genome. I don?t think that redundancy between repeat libraries will be an issue. Thanks, Daniel > On Aug 30, 2017, at 10:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt >: > >> (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. > > You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > > >> (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? > > Try Swiss-Prot. That is a well curated cross species set. > > >> (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 30 09:53:48 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 30 Aug 2017 08:53:48 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: You don?t need to worry about redundancy. ?Carson > On Aug 30, 2017, at 8:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt >: > >> (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. > > You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > > >> (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? > > Try Swiss-Prot. That is a well curated cross species set. > > >> (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 30 09:55:02 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 30 Aug 2017 08:55:02 -0600 Subject: [maker-devel] Processing contig output - MPI job fail In-Reply-To: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> References: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> Message-ID: MAKER will start up where it left off as long as the settings are identical between runs. ?Carson > On Aug 30, 2017, at 3:41 AM, Lahcen Campbell wrote: > > Hello folks, > Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. > I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) > ............ > > clustering transcripts into genes for annotations > Processing transcripts into genes > adding statistics to annotations > Calculating annotation quality statistics > choosing best annotation set > Choosing best annotations > processing chunk output > processing contig output > > However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. > The following error output was captured: > > Calculating annotation quality statistics > choosing best annotation set > Choosing best annotations > processing chunk output > processing contig output > > [proxy:0:0 at loom7.ebi.ac.uk ] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:0 at loom7.ebi.ac.uk ] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:0 at loom7.ebi.ac.uk ] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:4 at loom6.ebi.ac.uk ] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:4 at loom6.ebi.ac.uk ] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:4 at loom6.ebi.ac.uk ] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [mpiexec at loom7.ebi.ac.uk ] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting > [mpiexec at loom7.ebi.ac.uk ] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion > [mpiexec at loom7.ebi.ac.uk ] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion > [mpiexec at loom7.ebi.ac.uk ] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion > > Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. > > Any hints or insight on this would be greatly appreciated. > > Thank you in advance, > > Lahcen > > EBI-Hinxton, UK. > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Tue Aug 1 07:32:44 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Tue, 1 Aug 2017 09:32:44 -0400 Subject: [maker-devel] Pseudogene identification In-Reply-To: References: Message-ID: Hi Carson: I took a look at the description about the pipe line of pseudogene identification. In my understanding it will use the annotated (predicted by Maker2) protein coding genes as input (i.e., query sequences), search in the intergenic spaces (so annotated genes will not be checked) and find the regions where show certain level of similarity to the annotated genes. If my understanding is correct, I think it is not what I want to do get. Based on the annotated coding genes from Maker2, we found some genes are under expansion in the new species. We want to check and make sure all the gene copies in the expanded gene family really function (to make sure they are not pseudogenes). Do you think the pseudogene identification pipe line of Maker2 can be helpful for my goal? Or do you have any suggestions on this? Many thanks Best Quanwei 2017-07-31 19:54 GMT-04:00 Carson Holt : > The MAKER-P fork was merged back into standard MAKER with version 2.29 > (roughly 3 years ago - a separate download no longer exists). This is > because MAKER-P?s functionality is almost entirely in accessory scripts and > written protocols. The ?/maker/bin/maker called by both MAKER2 and MAKER-P > is actually the same script. So no need to rerun, because if you are using > version 2.29 or later, you already ran it. > > Pseudogene calling is therefore handled by accessory scripts and protocols > you can find here ?> http://shiulab.plantbiology.msu.edu/wiki/ > index.php/Protocol:Pseudogene > > The other MAKER-P protocols can be found here ?> > http://www.yandell-lab.org/software/maker-p.html > > --Carson > > > > On Jul 31, 2017, at 5:02 PM, Quanwei Zhang wrote: > > Hello: > > We used Maker2 to annotate a new rodent genome. By using the annotated > genes we did gene family expansion analysis, and found several gene > families under expansion in the new rodent genome. But we want to check > whether some annotated genes are Pseudogenes, which lead to the expansion. > Do you have any suggestions on this? > > We found the Maker-P can annotate Pseudogene, but we are not sure whether > it is worth to repeat our annotation with Maker-P. Besides, we are not sure > whether the default parameters of Maker-P are good for a rodent species. > What's more, in my understanding the Maker-P will identify Pseudogenes in > the intergenic spaces (which I think the annotated coding genes will be not > be tested and checked). > > Do you have any suggestions to solve our problem? We do not want to > identify Pseudogene on the genome wide, but only want to check those genes > showing expansion (to make sure all those gene copies really function). > > Many thanks > > Best > Quanwei > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From nathan.ricks at gmail.com Tue Aug 1 15:51:25 2017 From: nathan.ricks at gmail.com (Nathan Ricks) Date: Tue, 1 Aug 2017 15:51:25 -0600 Subject: [maker-devel] Output of fasta_merge Message-ID: When I run the command fasta_merge it produces a number of different files: .all.maker.model_gff%3Amaker.proteins.fasta .all.maker.non_overlapping_ab_initio.proteins.fasta .all.maker.snap_masked.proteins.fasta .all.maker.proteins.fasta I was wondering what the difference between these files is Thank you for your time -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 1 15:58:36 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 1 Aug 2017 15:58:36 -0600 Subject: [maker-devel] Output of fasta_merge In-Reply-To: References: Message-ID: <3348C5BF-8342-4E2B-88BF-1AF4558D4169@gmail.com> From the list archives ?> https://groups.google.com/forum/#!searchin/maker-devel/output$20files%7Csort:relevance/maker-devel/43hN_LDQv6c/SWpyYejGiqcJ Also described in ?/maker/README under the "MAKER OUTPUT" section. ?Carson > On Aug 1, 2017, at 3:51 PM, Nathan Ricks wrote: > > When I run the command fasta_merge it produces a number of different files: > .all.maker.model_gff%3Amaker.proteins.fasta > .all.maker.non_overlapping_ab_initio.proteins.fasta > .all.maker.snap_masked.proteins.fasta > .all.maker.proteins.fasta > > I was wondering what the difference between these files is > Thank you for your time > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From nathan.ricks at gmail.com Wed Aug 2 15:33:35 2017 From: nathan.ricks at gmail.com (Nathan Ricks) Date: Wed, 2 Aug 2017 15:33:35 -0600 Subject: [maker-devel] (no subject) Message-ID: As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ -------------- next part -------------- An HTML attachment was scrubbed... URL: From cjfields at illinois.edu Thu Aug 3 09:14:06 2017 From: cjfields at illinois.edu (Fields, Christopher J) Date: Thu, 3 Aug 2017 15:14:06 +0000 Subject: [maker-devel] (no subject) In-Reply-To: References: Message-ID: If you have a fairly recent version of Bioperl (now at 1.7.1) this should not be an issue within bioperl (note this isn?t a bug per se, just that the default universal codon table has rare codons so we simply added a ?strict? alternative table). Also, based on that thread Carson also added a workaround in MAKER explicitly setting a ?strict? codon table that should be in 3.00. chris From: maker-devel on behalf of Nathan Ricks Date: Wednesday, August 2, 2017 at 9:54 PM To: "maker-devel at yandell-lab.org" Subject: [maker-devel] (no subject) As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Thu Aug 3 09:27:51 2017 From: carsonhh at gmail.com (Carson Holt) Date: Thu, 3 Aug 2017 09:27:51 -0600 Subject: [maker-devel] (no subject) In-Reply-To: References: Message-ID: <29E5FB26-0670-4EF1-A5E5-CB10EDC228BD@gmail.com> Correct. Current MAKER 2.31.9 AND 3.00 beta have the strict codon table workaround for BioPerl. MAKER?s default behavior is to use the same ORF given to it be the predictor and alter start codon if MAKER itself is able to add extra sequence that can extend the ORF during the UTR addition phase and find a start codon. But if you set alway_complete=1 in the options, it will walk upstream and downstream to find start/stop codons in the surrounding sequence even if it has to add sequence to the exons. Thanks, Carson > On Aug 3, 2017, at 9:14 AM, Fields, Christopher J wrote: > > If you have a fairly recent version of Bioperl (now at 1.7.1) this should not be an issue within bioperl (note this isn?t a bug per se, just that the default universal codon table has rare codons so we simply added a ?strict? alternative table). > > Also, based on that thread Carson also added a workaround in MAKER explicitly setting a ?strict? codon table that should be in 3.00. > > chris > > From: maker-devel > on behalf of Nathan Ricks > > Date: Wednesday, August 2, 2017 at 9:54 PM > To: "maker-devel at yandell-lab.org " > > Subject: [maker-devel] (no subject) > > As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? > I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 > > https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From jltan at mmu.edu.my Tue Aug 8 01:33:01 2017 From: jltan at mmu.edu.my (jltan at mmu.edu.my) Date: Tue, 8 Aug 2017 15:33:01 +0800 Subject: [maker-devel] Problem with MAKER installation Message-ID: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> Hi, I am installing MAKER to annotate a fungus genome. However, I experienced issue with "Argument "2.53_01" isn't numeric in numeric ge (>=) at /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . I aware that the issue arise because of the "_" in the "2.53_01" however I have no idea on how to solve it. Would you mind to give advice on this matter? Thank you. Best regards, Dr. Joon Liang Tan PhD, Bsc (Hons) Lecturer (Bioinformatics Programme) Faculty of Information Science and Technology (FIST) Multimedia University 75450 Melaka Malaysia Phone: +60 62524813 From patrick_michael.chiuco at upd.edu.ph Thu Aug 10 05:35:47 2017 From: patrick_michael.chiuco at upd.edu.ph (Patrick Michael Chiuco) Date: Thu, 10 Aug 2017 19:35:47 +0800 Subject: [maker-devel] split_fasta script In-Reply-To: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> References: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> Message-ID: <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> Hi! Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline [1] we're currently using. Thanks! Patrick Links: ------ [1] https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1426-6 -------------- next part -------------- An HTML attachment was scrubbed... URL: From zachary.pcohen at gmail.com Fri Aug 11 12:43:58 2017 From: zachary.pcohen at gmail.com (Zach Cohen) Date: Fri, 11 Aug 2017 18:43:58 +0000 Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Hello All, I'm receiving a RepeatMasker on some (not all) of my scaffolds. *Widget::RepeatMasker:* *cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2* *#-------------------------------#* *ERROR: RepeatMasker failed* *--> rank=NA, hostname=82853d8df2a5* *ERROR: Failed while doing repeat masking* *ERROR: Chunk failed at level:0, tier_type:1* FAILED CONTIG:scaffold2852_size18614 *ERROR: Chunk failed at level:2, tier_type:0* *FAILED CONTIG:scaffold2852_size18614* *examining contents of the fasta file and run log* I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! Best, Z -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Fri Aug 11 23:53:49 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 11 Aug 2017 23:53:49 -0600 Subject: [maker-devel] split_fasta script In-Reply-To: <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> References: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> Message-ID: <10D08630-4EA1-40EC-9939-0717E7F9BF25@gmail.com> split_fasta was deprecated quite a while ago (2010) and replaced by fasta_tool. I was able to find an old copy in the subversion repository, I can?t guarantee it will work as expected though with how much other libraries in maker have changed since then. ?Carson > On Aug 10, 2017, at 5:35 AM, Patrick Michael Chiuco wrote: > > > Hi! > > Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline we're currently using. Thanks! > > Patrick > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: split_fasta Type: application/octet-stream Size: 1405 bytes Desc: not available URL: -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Sat Aug 12 00:00:24 2017 From: carsonhh at gmail.com (Carson Holt) Date: Sat, 12 Aug 2017 00:00:24 -0600 Subject: [maker-devel] Problem with MAKER installation In-Reply-To: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> References: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> Message-ID: <71E16226-8E3D-4F68-9877-5D26B33B936D@gmail.com> You may need to reinstall your forks and forks::shared modules. If you use CPAN, you can use the ?force? option to do this. Also if forks is broken, other modules may be as well, so you may get another error in another module after the reinstall (then you will have to reinstall that module). This can possibly be caused by a processor version issue if this is a cluster with mixed architectures (old vs new Intel chips or AMD vs Intel), or it can be due to a system update breaking dynamically linked C libraries. ?Carson > On Aug 8, 2017, at 1:33 AM, jltan at mmu.edu.my wrote: > > Hi, > > I am installing MAKER to annotate a fungus genome. However, I experienced > issue with > "Argument "2.53_01" isn't numeric in numeric ge (>=) at > /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . > > I aware that the issue arise because of the "_" in the "2.53_01" however I > have no idea on how to solve it. > > Would you mind to give advice on this matter? > > Thank you. > > > > Best regards, > > Dr. Joon Liang Tan > PhD, Bsc (Hons) > Lecturer (Bioinformatics Programme) > Faculty of Information Science and Technology (FIST) > Multimedia University > 75450 Melaka > Malaysia > Phone: +60 62524813 > > > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org From carsonhh at gmail.com Mon Aug 14 11:30:33 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 14 Aug 2017 11:30:33 -0600 Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly In-Reply-To: References: Message-ID: If running under MPI, you can get messages from multiple processes (slightly out of order), in which case the more descript cause of the error may be further upstream in the STDERR log. If running without MPI, and the error you see is matched with the Widget::RepeatMasker command used, then you can simply copy it and run it outside of MAKER. If there are installation issues with your RepeatMasker copy then the cause will become more apparent. i.e. Run the command by itself ?> /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 ?Carson > On Aug 11, 2017, at 12:43 PM, Zach Cohen wrote: > > Hello All, > I'm receiving a RepeatMasker on some (not all) of my scaffolds. > Widget::RepeatMasker: > > cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 > > #-------------------------------# > > ERROR: RepeatMasker failed > > --> rank=NA, hostname=82853d8df2a5 > > ERROR: Failed while doing repeat masking > > ERROR: Chunk failed at level:0, tier_type:1 > > FAILED CONTIG:scaffold2852_size18614 > > ERROR: Chunk failed at level:2, tier_type:0 > > FAILED CONTIG:scaffold2852_size18614 > > examining contents of the fasta file and run log > > > > I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! > > Best, > > Z > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Mon Aug 14 12:59:16 2017 From: chzelin at gmail.com (zl c) Date: Mon, 14 Aug 2017 14:59:16 -0400 Subject: [maker-devel] maker MPI problem Message-ID: Hello, I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? CMD: export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so export OMPI_MCA_mpi_warn_on_fork=0 mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] Ph.D. NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: run05.mpi.o47346077 Type: application/octet-stream Size: 60802 bytes Desc: not available URL: From chzelin at gmail.com Mon Aug 14 13:11:01 2017 From: chzelin at gmail.com (zl c) Date: Mon, 14 Aug 2017 15:11:01 -0400 Subject: [maker-devel] maker problem large number of files Message-ID: Hello, Besides, Maker produces large number of temporary files. Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 14 13:18:22 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 14 Aug 2017 13:18:22 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: Message-ID: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> This is rather vague ?> ?crashed the computer cluster? Do you have a specific error? ?Carson > On Aug 14, 2017, at 12:59 PM, zl c wrote: > > Hello, > > > I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? > > > CMD: > > export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so > > export OMPI_MCA_mpi_warn_on_fork=0 > > mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta > > > Thanks, > > Zelin Chen > > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] Ph.D. > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From alyce.fowler at bayer.com Mon Aug 14 13:20:55 2017 From: alyce.fowler at bayer.com (Alyce Fowler) Date: Mon, 14 Aug 2017 19:20:55 +0000 Subject: [maker-devel] unsubscribe Message-ID: -----Original Message----- From: maker-devel [mailto:maker-devel-bounces at yandell-lab.org] On Behalf Of maker-devel-request at yandell-lab.org Sent: Monday, August 14, 2017 1:31 PM To: maker-devel at yandell-lab.org Subject: maker-devel Digest, Vol 111, Issue 3 Send maker-devel mailing list submissions to maker-devel at yandell-lab.org To subscribe or unsubscribe via the World Wide Web, visit http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org or, via email, send a message with subject or body 'help' to maker-devel-request at yandell-lab.org You can reach the person managing the list at maker-devel-owner at yandell-lab.org When replying, please edit your Subject line so it is more specific than "Re: Contents of maker-devel digest..." Today's Topics: 1. Problem with MAKER installation (jltan at mmu.edu.my) 2. split_fasta script (Patrick Michael Chiuco) 3. Inconsistent RepeatMasker error on draft assembly (Zach Cohen) 4. Re: split_fasta script (Carson Holt) 5. Re: Problem with MAKER installation (Carson Holt) 6. Re: Inconsistent RepeatMasker error on draft assembly (Carson Holt) ---------------------------------------------------------------------- Message: 1 Date: Tue, 8 Aug 2017 15:33:01 +0800 From: jltan at mmu.edu.my To: maker-devel at yandell-lab.org Subject: [maker-devel] Problem with MAKER installation Message-ID: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel at mlkstf.mmu.edu.my> Content-Type: text/plain;charset=iso-8859-1 Hi, I am installing MAKER to annotate a fungus genome. However, I experienced issue with "Argument "2.53_01" isn't numeric in numeric ge (>=) at /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . I aware that the issue arise because of the "_" in the "2.53_01" however I have no idea on how to solve it. Would you mind to give advice on this matter? Thank you. Best regards, Dr. Joon Liang Tan PhD, Bsc (Hons) Lecturer (Bioinformatics Programme) Faculty of Information Science and Technology (FIST) Multimedia University 75450 Melaka Malaysia Phone: +60 62524813 ------------------------------ Message: 2 Date: Thu, 10 Aug 2017 19:35:47 +0800 From: Patrick Michael Chiuco To: maker-devel at yandell-lab.org Subject: [maker-devel] split_fasta script Message-ID: <56824384580b99132afdba6167d0d0b0 at smicro00.upd.edu.ph> Content-Type: text/plain; charset="utf-8" Hi! Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline [1] we're currently using. Thanks! Patrick Links: ------ [1] https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1426-6 -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 3 Date: Fri, 11 Aug 2017 18:43:58 +0000 From: Zach Cohen To: maker-devel at yandell-lab.org Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Content-Type: text/plain; charset="utf-8" Hello All, I'm receiving a RepeatMasker on some (not all) of my scaffolds. *Widget::RepeatMasker:* *cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2* *#-------------------------------#* *ERROR: RepeatMasker failed* *--> rank=NA, hostname=82853d8df2a5* *ERROR: Failed while doing repeat masking* *ERROR: Chunk failed at level:0, tier_type:1* FAILED CONTIG:scaffold2852_size18614 *ERROR: Chunk failed at level:2, tier_type:0* *FAILED CONTIG:scaffold2852_size18614* *examining contents of the fasta file and run log* I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! Best, Z -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 4 Date: Fri, 11 Aug 2017 23:53:49 -0600 From: Carson Holt To: Patrick Michael Chiuco Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] split_fasta script Message-ID: <10D08630-4EA1-40EC-9939-0717E7F9BF25 at gmail.com> Content-Type: text/plain; charset="utf-8" split_fasta was deprecated quite a while ago (2010) and replaced by fasta_tool. I was able to find an old copy in the subversion repository, I can?t guarantee it will work as expected though with how much other libraries in maker have changed since then. ?Carson > On Aug 10, 2017, at 5:35 AM, Patrick Michael Chiuco wrote: > > > Hi! > > Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline we're currently using. Thanks! > > Patrick > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: split_fasta Type: application/octet-stream Size: 1405 bytes Desc: not available URL: -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 5 Date: Sat, 12 Aug 2017 00:00:24 -0600 From: Carson Holt To: jltan at mmu.edu.my Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] Problem with MAKER installation Message-ID: <71E16226-8E3D-4F68-9877-5D26B33B936D at gmail.com> Content-Type: text/plain; charset=utf-8 You may need to reinstall your forks and forks::shared modules. If you use CPAN, you can use the ?force? option to do this. Also if forks is broken, other modules may be as well, so you may get another error in another module after the reinstall (then you will have to reinstall that module). This can possibly be caused by a processor version issue if this is a cluster with mixed architectures (old vs new Intel chips or AMD vs Intel), or it can be due to a system update breaking dynamically linked C libraries. ?Carson > On Aug 8, 2017, at 1:33 AM, jltan at mmu.edu.my wrote: > > Hi, > > I am installing MAKER to annotate a fungus genome. However, I experienced > issue with > "Argument "2.53_01" isn't numeric in numeric ge (>=) at > /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . > > I aware that the issue arise because of the "_" in the "2.53_01" however I > have no idea on how to solve it. > > Would you mind to give advice on this matter? > > Thank you. > > > > Best regards, > > Dr. Joon Liang Tan > PhD, Bsc (Hons) > Lecturer (Bioinformatics Programme) > Faculty of Information Science and Technology (FIST) > Multimedia University > 75450 Melaka > Malaysia > Phone: +60 62524813 > > > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org ------------------------------ Message: 6 Date: Mon, 14 Aug 2017 11:30:33 -0600 From: Carson Holt To: Zach Cohen Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Content-Type: text/plain; charset="utf-8" If running under MPI, you can get messages from multiple processes (slightly out of order), in which case the more descript cause of the error may be further upstream in the STDERR log. If running without MPI, and the error you see is matched with the Widget::RepeatMasker command used, then you can simply copy it and run it outside of MAKER. If there are installation issues with your RepeatMasker copy then the cause will become more apparent. i.e. Run the command by itself ?> /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 ?Carson > On Aug 11, 2017, at 12:43 PM, Zach Cohen wrote: > > Hello All, > I'm receiving a RepeatMasker on some (not all) of my scaffolds. > Widget::RepeatMasker: > > cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 > > #-------------------------------# > > ERROR: RepeatMasker failed > > --> rank=NA, hostname=82853d8df2a5 > > ERROR: Failed while doing repeat masking > > ERROR: Chunk failed at level:0, tier_type:1 > > FAILED CONTIG:scaffold2852_size18614 > > ERROR: Chunk failed at level:2, tier_type:0 > > FAILED CONTIG:scaffold2852_size18614 > > examining contents of the fasta file and run log > > > > I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! > > Best, > > Z > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Subject: Digest Footer _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org ------------------------------ End of maker-devel Digest, Vol 111, Issue 3 ******************************************* ________________________________________________________________________ The information contained in this e-mail is for the exclusive use of the intended recipient(s) and may be confidential, proprietary, and/or legally privileged. Inadvertent disclosure of this message does not constitute a waiver of any privilege. If you receive this message in error, please do not directly or indirectly use, print, copy, forward, or disclose any part of this message. Please also delete this e-mail and all copies and notify the sender. Thank you. ________________________________________________________________________ From cjfields at illinois.edu Mon Aug 14 19:23:07 2017 From: cjfields at illinois.edu (Fields, Christopher J) Date: Tue, 15 Aug 2017 01:23:07 +0000 Subject: [maker-devel] maker MPI problem In-Reply-To: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: Carson, It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. chris From: maker-devel on behalf of Carson Holt Date: Monday, August 14, 2017 at 2:18 PM To: zl c Cc: "maker-devel at yandell-lab.org" Subject: Re: [maker-devel] maker MPI problem This is rather vague ?> ?crashed the computer cluster? Do you have a specific error? ?Carson On Aug 14, 2017, at 12:59 PM, zl c > wrote: Hello, I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? CMD: export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so export OMPI_MCA_mpi_warn_on_fork=0 mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] Ph.D. NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 08:33:37 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 08:33:37 -0600 Subject: [maker-devel] Fwd: maker MPI problem References: Message-ID: <4D7D32B5-58F4-401D-83EC-A1B38E0DCF09@gmail.com> Just forwarding this to the list. --Carson > From: Carson Holt > Date: August 14, 2017 at 2:00:11 PM MDT > To: zl c > Subject: Re: [maker-devel] maker MPI problem > > Yes. You can delete them. > > Also I notice this library being mentioned in the segfault ?> libpthread.so > > MAKER doesn?t use pthreads, so I?m surprised it?s showing up in an error. You could try installing a separate version of perl without pthread support and running MAKER with that (pthreads is optional for perl). It may remove an OpenMPI/perl incompatibility happening on your system. > > ?Carson > > >> On Aug 14, 2017, at 1:50 PM, zl c wrote: >> >> Maker dies. >> >> I've set LD_PRELOAD before install. >> >> I'll try the option. >> >> Can I remove the .NFS files before rerunning? >> >> Thanks, >> Zelin >> >> >> >>> On Mon, Aug 14, 2017 at 3:35 PM, Carson Holt wrote: >>> Is the issue that your cluster dies or that MAKER dies? (i.e. I want to know if this is an issue with your cluster or just an issue running MAKER) >>> >>> I see in the file that you are getting segfaults which should not crash the cluster but would kill maker. They would indicate either an installation problem, or just a command configuration option. >>> >>> You may need to recompile while the LD_PRELOAD value is set (it must be set during MAKER install and whenever you run with OpenMPI). Or you may still have the native infiniband communication active (causes segfaults with system calls). >>> >>> You can try this (to do ip over infiiniband instead, worls only if ib0 exists or set it to eth0 if eth0 exists) ?> '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0' >>> >>> That would replace the '-mca btl ^openib' >>> >>> Also make sure you can run maker on a single node under MPI before trying to work across nodes, then try on two nodes for your first test. >>> >>> The NFSLock files are file locks that are not cleaned up on a hard failure. >>> >>> ?Carson >>> >>> >>> >>> >>> >>>> On Aug 14, 2017, at 1:22 PM, zl c wrote: >>>> >>>> It's in the attached file. >>>> >>>> Beside, I see there are lots of .NFS... files.like: >>>> .NFSLock..NFSLock.genomedb.NFSLock.share.tmp.2247.26272.7466.34069868502337 >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>>> On Mon, Aug 14, 2017 at 3:18 PM, Carson Holt wrote: >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> Do you have a specific error? >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>>> >>>>>> Hello, >>>>>> >>>>>> >>>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>>> >>>>>> >>>>>> CMD: >>>>>> >>>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>>> >>>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>>> >>>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>>> >>>>>> >>>>>> Thanks, >>>>>> >>>>>> Zelin Chen >>>>>> >>>>>> >>>>>> -------------------------------------------- >>>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>>> >>>>>> NIH/NHGRI >>>>>> Building 50, Room 5531 >>>>>> 50 SOUTH DR, MSC 8004 >>>>>> BETHESDA, MD 20892-8004 >>>>>> _______________________________________________ >>>>>> maker-devel mailing list >>>>>> maker-devel at box290.bluehost.com >>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>> >>>> >>>> >>> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 08:39:35 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 08:39:35 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? --Carson Sent from my iPhone > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > Configuring MAKER with MPI support > Installing MAKER... > Configuring MAKER with MPI support > Subroutine dl_load_flags redefined at (eval 125) line 8. > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J wrote: >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >> >> >> >> chris >> >> >> >> From: maker-devel on behalf of Carson Holt >> Date: Monday, August 14, 2017 at 2:18 PM >> To: zl c >> Cc: "maker-devel at yandell-lab.org" >> Subject: Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Mon Aug 14 13:21:21 2017 From: dandence at gmail.com (Daniel Ence) Date: Mon, 14 Aug 2017 15:21:21 -0400 Subject: [maker-devel] maker problem large number of files In-Reply-To: References: Message-ID: <12B2834F-CC76-45BA-981B-4712982C9482@gmail.com> Hi Zelin, The large number of temporary files is part of the normal behavior for maker. After MAKER has finished, the only output files you really need are the fasta files of the annotated protein and transcript sequences and the gff file. The full maker output facilitates rerunning in the case of failure or trying out different parameters, which is sometimes a good reason for keeping the full output. ~Daniel > On Aug 14, 2017, at 3:11 PM, zl c wrote: > > Hello, > > Besides, Maker produces large number of temporary files. > > Thanks, > Zelin Chen > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 08:27:21 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 10:27:21 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: When I installed by './Build install', I got following some messages: Configuring MAKER with MPI support Installing MAKER... Configuring MAKER with MPI support Subroutine dl_load_flags redefined at (eval 125) line 8. Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. I'm not sure whether it's correctly installed. Thanks, -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < cjfields at illinois.edu> wrote: > Carson, > > > > It was attached to the initial message (named ?run05.mpi.o47346077?). It > looks like a Perl issue with threads, though I don?t see why this would > crash a cluster. The fact there is a log file would suggest it just ended > the job. > > > > chris > > > > *From: *maker-devel on behalf of > Carson Holt > *Date: *Monday, August 14, 2017 at 2:18 PM > *To: *zl c > *Cc: *"maker-devel at yandell-lab.org" > *Subject: *Re: [maker-devel] maker MPI problem > > > > This is rather vague ?> ?crashed the computer cluster? > > > > Do you have a specific error? > > > > ?Carson > > > > > > > > On Aug 14, 2017, at 12:59 PM, zl c wrote: > > > > Hello, > > > > I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I > attached the log file. Could you help me to solve the problem? > > > > CMD: > > export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so > > export OMPI_MCA_mpi_warn_on_fork=0 > > mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g > genome.fasta > > > > Thanks, > > Zelin Chen > > > > -------------------------------------------- > > Zelin Chen [chzelin at gmail.com] Ph.D. > > > > NIH/NHGRI > > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 09:30:48 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 11:30:48 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: The other option doesn't work. I reinstall it with a perl without multiple threads. Now it's building the blast database. -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > You may need to delete the .../maker/perl directory before doing the > reinstall if not doing a brand new installation. Otherwise you can ignore > the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for > MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > > Configuring MAKER with MPI support > > Installing MAKER... > > Configuring MAKER with MPI support > > Subroutine dl_load_flags redefined at (eval 125) line 8. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at > (eval 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) > line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < > cjfields at illinois.edu> wrote: > >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It >> looks like a Perl issue with threads, though I don?t see why this would >> crash a cluster. The fact there is a log file would suggest it just ended >> the job. >> >> >> >> chris >> >> >> >> *From: *maker-devel on behalf of >> Carson Holt >> *Date: *Monday, August 14, 2017 at 2:18 PM >> *To: *zl c >> *Cc: *"maker-devel at yandell-lab.org" >> *Subject: *Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I >> attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >> genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 09:34:32 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 11:34:32 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: Here are some latest message: [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > You may need to delete the .../maker/perl directory before doing the > reinstall if not doing a brand new installation. Otherwise you can ignore > the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for > MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > > Configuring MAKER with MPI support > > Installing MAKER... > > Configuring MAKER with MPI support > > Subroutine dl_load_flags redefined at (eval 125) line 8. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at > (eval 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) > line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < > cjfields at illinois.edu> wrote: > >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It >> looks like a Perl issue with threads, though I don?t see why this would >> crash a cluster. The fact there is a log file would suggest it just ended >> the job. >> >> >> >> chris >> >> >> >> *From: *maker-devel on behalf of >> Carson Holt >> *Date: *Monday, August 14, 2017 at 2:18 PM >> *To: *zl c >> *Cc: *"maker-devel at yandell-lab.org" >> *Subject: *Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I >> attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >> genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 09:47:04 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 09:47:04 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Did it die or did you just get a warning? Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. #add if MPI not using all CPU given --oversubscribe --bind-to none #workaround for infinaband (use instead of --mca ^openib) --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 #add to stop certain other warnings --mca orte_base_help_aggregate 0 #stop fork warnings --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 ?Carson > On Aug 15, 2017, at 9:34 AM, zl c wrote: > > Here are some latest message: > > [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork > [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > > > On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: > You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c > wrote: > >> When I installed by './Build install', I got following some messages: >> Configuring MAKER with MPI support >> Installing MAKER... >> Configuring MAKER with MPI support >> Subroutine dl_load_flags redefined at (eval 125) line 8. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >> >> I'm not sure whether it's correctly installed. >> >> Thanks, >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >> >> >> >> chris >> >> >> >> From: maker-devel > on behalf of Carson Holt > >> Date: Monday, August 14, 2017 at 2:18 PM >> To: zl c > >> Cc: "maker-devel at yandell-lab.org " > >> Subject: Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com ] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 14:50:05 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 14:50:05 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Message-ID: <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? --Carson Sent from my iPhone > On Aug 15, 2017, at 2:47 PM, zl c wrote: > > Hi Carson, Christopher, Daniel, > > Thank you for your kind help. > > Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? > > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: >>>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>>> >>>>> When I installed by './Build install', I got following some messages: >>>>> Configuring MAKER with MPI support >>>>> Installing MAKER... >>>>> Configuring MAKER with MPI support >>>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>>> >>>>> I'm not sure whether it's correctly installed. >>>>> >>>>> Thanks, >>>>> >>>>> -------------------------------------------- >>>>> Zelin Chen [chzelin at gmail.com] >>>>> >>>>> NIH/NHGRI >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J wrote: >>>>>> Carson, >>>>>> >>>>>> >>>>>> >>>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>>>> >>>>>> >>>>>> >>>>>> chris >>>>>> >>>>>> >>>>>> >>>>>> From: maker-devel on behalf of Carson Holt >>>>>> Date: Monday, August 14, 2017 at 2:18 PM >>>>>> To: zl c >>>>>> Cc: "maker-devel at yandell-lab.org" >>>>>> Subject: Re: [maker-devel] maker MPI problem >>>>>> >>>>>> >>>>>> >>>>>> This is rather vague ?> ?crashed the computer cluster? >>>>>> >>>>>> >>>>>> >>>>>> Do you have a specific error? >>>>>> >>>>>> >>>>>> >>>>>> ?Carson >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>>> >>>>>> >>>>>> >>>>>> Hello, >>>>>> >>>>>> >>>>>> >>>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>>> >>>>>> >>>>>> >>>>>> CMD: >>>>>> >>>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>>> >>>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>>> >>>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>>> >>>>>> >>>>>> >>>>>> Thanks, >>>>>> >>>>>> Zelin Chen >>>>>> >>>>>> >>>>>> >>>>>> -------------------------------------------- >>>>>> >>>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>>> >>>>>> >>>>>> >>>>>> NIH/NHGRI >>>>>> >>>>>> Building 50, Room 5531 >>>>>> 50 SOUTH DR, MSC 8004 >>>>>> BETHESDA, MD 20892-8004 >>>>>> >>>>>> _______________________________________________ >>>>>> maker-devel mailing list >>>>>> maker-devel at box290.bluehost.com >>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>> >>>>>> >>>>>> >>>>> >>> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 14:47:14 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 16:47:14 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Message-ID: Hi Carson, Christopher, Daniel, Thank you for your kind help. Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? Zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: > Did it die or did you just get a warning? > > Here is a list of flags to add that suppress warnings and other issues > with OpenMPI. You can add them all or one at a time depending on issues you > get. > > #add if MPI not using all CPU given > --oversubscribe --bind-to none > > #workaround for infinaband (use instead of --mca ^openib) > --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 > > #add to stop certain other warnings > --mca orte_base_help_aggregate 0 > > #stop fork warnings > --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 > > ?Carson > > > > On Aug 15, 2017, at 9:34 AM, zl c wrote: > > Here are some latest message: > > [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt > / opal_init:warn-fork > [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see > all help / error messages > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > > On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > >> You may need to delete the .../maker/perl directory before doing the >> reinstall if not doing a brand new installation. Otherwise you can ignore >> the subroutine redefined warnings during compile. >> >> Have you been able to test the alternate flags on the command line for >> MPI? How about an alternate perl without threads? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 8:27 AM, zl c wrote: >> >> When I installed by './Build install', I got following some messages: >> Configuring MAKER with MPI support >> Installing MAKER... >> Configuring MAKER with MPI support >> Subroutine dl_load_flags redefined at (eval 125) line 8. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) >> line 9. >> >> I'm not sure whether it's correctly installed. >> >> Thanks, >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >> cjfields at illinois.edu> wrote: >> >>> Carson, >>> >>> >>> >>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>> It looks like a Perl issue with threads, though I don?t see why this would >>> crash a cluster. The fact there is a log file would suggest it just ended >>> the job. >>> >>> >>> >>> chris >>> >>> >>> >>> *From: *maker-devel on behalf of >>> Carson Holt >>> *Date: *Monday, August 14, 2017 at 2:18 PM >>> *To: *zl c >>> *Cc: *"maker-devel at yandell-lab.org" >>> *Subject: *Re: [maker-devel] maker MPI problem >>> >>> >>> >>> This is rather vague ?> ?crashed the computer cluster? >>> >>> >>> >>> Do you have a specific error? >>> >>> >>> >>> ?Carson >>> >>> >>> >>> >>> >>> >>> >>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>> >>> >>> >>> Hello, >>> >>> >>> >>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. >>> I attached the log file. Could you help me to solve the problem? >>> >>> >>> >>> CMD: >>> >>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>> >>> export OMPI_MCA_mpi_warn_on_fork=0 >>> >>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>> genome.fasta >>> >>> >>> >>> Thanks, >>> >>> Zelin Chen >>> >>> >>> >>> -------------------------------------------- >>> >>> Zelin Chen [chzelin at gmail.com] Ph.D. >>> >>> >>> >>> NIH/NHGRI >>> >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> _______________________________________________ >>> maker-devel mailing list >>> maker-devel at box290.bluehost.com >>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >>> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 15:13:04 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 15:13:04 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: Some notes: First, the mpiexec command still needs the --mca parameters (either '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0?). Otherwise if you have infiniband on the nodes it will try and use OpenFabrics compatible libraries which will kill code doing system calls (like MAKER does). Second, try using a higher count than 2 in your batch. One process is always sacrificed by maker to act only for message management among processes, so with -n 2, you have one process working and one managing data. So only one contig will run at a time. If you set it to a higher number the issue will go away. The message manger process starts to get saturated at ~200 CPUs, so anything above that processor count becomes less beneficial to the job. Thanks, Carson > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt > wrote: > What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 2:47 PM, zl c > wrote: > >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt > wrote: >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >>> On Aug 15, 2017, at 9:34 AM, zl c > wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com ] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: >>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>> >>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>> >>> --Carson >>> >>> Sent from my iPhone >>> >>> On Aug 15, 2017, at 8:27 AM, zl c > wrote: >>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com ] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >>>> Carson, >>>> >>>> >>>> >>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>> >>>> >>>> >>>> chris >>>> >>>> >>>> >>>> From: maker-devel > on behalf of Carson Holt > >>>> Date: Monday, August 14, 2017 at 2:18 PM >>>> To: zl c > >>>> Cc: "maker-devel at yandell-lab.org " > >>>> Subject: Re: [maker-devel] maker MPI problem >>>> >>>> >>>> >>>> This is rather vague ?> ?crashed the computer cluster? >>>> >>>> >>>> >>>> Do you have a specific error? >>>> >>>> >>>> >>>> ?Carson >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >>>> >>>> >>>> >>>> Hello, >>>> >>>> >>>> >>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>> >>>> >>>> >>>> CMD: >>>> >>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>> >>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>> >>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>> >>>> >>>> >>>> Thanks, >>>> >>>> Zelin Chen >>>> >>>> >>>> >>>> -------------------------------------------- >>>> >>>> Zelin Chen [chzelin at gmail.com ] Ph.D. >>>> >>>> >>>> >>>> NIH/NHGRI >>>> >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>>> >>> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 15:05:18 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 17:05:18 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: I submit a job: sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh CMD in run06.maker.mpi.sh mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta Another question: How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. Thanks, zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > What is your command line? Are you running interactively or as a submitted > batch? If it's a batch job what options did you give it? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 2:47 PM, zl c wrote: > > Hi Carson, Christopher, Daniel, > > Thank you for your kind help. > > Now it works without any other options on one nodes and 4 CPUs. I set the > number of task to 2, but there's only one contigs in running. Should it be > two contigs running at the same time? > > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: > >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues >> with OpenMPI. You can add them all or one at a time depending on issues you >> get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >> On Aug 15, 2017, at 9:34 AM, zl c wrote: >> >> Here are some latest message: >> >> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt >> / opal_init:warn-fork >> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >> all help / error messages >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> >> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: >> >>> You may need to delete the .../maker/perl directory before doing the >>> reinstall if not doing a brand new installation. Otherwise you can ignore >>> the subroutine redefined warnings during compile. >>> >>> Have you been able to test the alternate flags on the command line for >>> MPI? How about an alternate perl without threads? >>> >>> --Carson >>> >>> Sent from my iPhone >>> >>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>> >>> When I installed by './Build install', I got following some messages: >>> Configuring MAKER with MPI support >>> Installing MAKER... >>> Configuring MAKER with MPI support >>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) >>> line 9. >>> >>> I'm not sure whether it's correctly installed. >>> >>> Thanks, >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> NIH/NHGRI >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>> cjfields at illinois.edu> wrote: >>> >>>> Carson, >>>> >>>> >>>> >>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>> It looks like a Perl issue with threads, though I don?t see why this would >>>> crash a cluster. The fact there is a log file would suggest it just ended >>>> the job. >>>> >>>> >>>> >>>> chris >>>> >>>> >>>> >>>> *From: *maker-devel on behalf of >>>> Carson Holt >>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>> *To: *zl c >>>> *Cc: *"maker-devel at yandell-lab.org" >>>> *Subject: *Re: [maker-devel] maker MPI problem >>>> >>>> >>>> >>>> This is rather vague ?> ?crashed the computer cluster? >>>> >>>> >>>> >>>> Do you have a specific error? >>>> >>>> >>>> >>>> ?Carson >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>> >>>> >>>> >>>> Hello, >>>> >>>> >>>> >>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. >>>> I attached the log file. Could you help me to solve the problem? >>>> >>>> >>>> >>>> CMD: >>>> >>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>> >>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>> >>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>> genome.fasta >>>> >>>> >>>> >>>> Thanks, >>>> >>>> Zelin Chen >>>> >>>> >>>> >>>> -------------------------------------------- >>>> >>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>> >>>> >>>> >>>> NIH/NHGRI >>>> >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>>> >>> >>> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 15:17:20 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 17:17:20 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: This is a test run, so I use only 2 tasks. I'll try more tasks and your options. Thanks, Zelin On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either > '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include > ib0?). Otherwise if you have infiniband on the nodes it will try and use > OpenFabrics compatible libraries which will kill code doing system calls > (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is > always sacrificed by maker to act only for message management among > processes, so with -n 2, you have one process working and one managing > data. So only one contig will run at a time. If you set it to a higher > number the issue will go away. The message manger process starts to get > saturated at ~200 CPUs, so anything above that processor count becomes less > beneficial to the job. > > Thanks, > Carson > > > > > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 > --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A > run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and > large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > >> What is your command line? Are you running interactively or as a >> submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c wrote: >> >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set >> the number of task to 2, but there's only one contigs in running. Should it >> be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues >>> with OpenMPI. You can add them all or one at a time depending on issues you >>> get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message >>> help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >>> all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt >>> wrote: >>> >>>> You may need to delete the .../maker/perl directory before doing the >>>> reinstall if not doing a brand new installation. Otherwise you can ignore >>>> the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for >>>> MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval >>>> 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>>> cjfields at illinois.edu> wrote: >>>> >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>>> It looks like a Perl issue with threads, though I don?t see why this would >>>>> crash a cluster. The fact there is a log file would suggest it just ended >>>>> the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> *From: *maker-devel on behalf >>>>> of Carson Holt >>>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>>> *To: *zl c >>>>> *Cc: *"maker-devel at yandell-lab.org" >>>>> *Subject: *Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer >>>>> cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>>> genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yand >>>>> ell-lab.org >>>>> >>>>> >>>>> >>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 16 14:00:44 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 16 Aug 2017 16:00:44 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> Message-ID: Dear Carson and Daniel: Thank you for your explanation about the details of repeat masking. But we still have some concerns, would you please give us some suggestions? Thanks (1) We are doing genome annotation for a new rodent species, we wonder whether we should use repeat library for "Mammalia" or "rodent"? Which is more proper, if we did not construct a species-specific repeat library for the new genome? #-----Repeat Masking (leave values blank to skip repeat masking) model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker repeat_protein=/gs/gsfs0/hpc01/apps/MAKER/2.31.9/data/te_proteins.fasta #provide a fasta file of transposable element proteins for RepeatRunner (2) With some concerns as discussed above emails, we did not train a species-specific repeat library. Since we have finished the annotation only using the repeat library from repeatMasker and Maker2, we wonder whether it is worth for us to firstly train a species-specific repeat library and then do the genome annotation again? Will it (i.e., trainning a species-specific repeat library) significantly affect the gene annotation and downstream analysis (e.g., gene family expansion analysis, positive selection)? (3) We identified some gene families under contraction, but we want to confirm those gene families really lost copies in our new genome. Do you think it is worth to do the genome annotation without repeat masking, so there will not be genes missing from annotation due to repeat mask? Many thanks. Best Quanwei 2017-07-31 13:02 GMT-04:00 Carson Holt : > Please note that the unmask option Dan is talking about is a feature to > run both masked and unmasked raw predictions in the first round of > prediction (it does not affect alignemnt of the second round of > predictiopn). It tends to increase the false positive rate but can be a > quick test when you believe you are missing a gene because of overmasking > from a user created library and protein/EST evidence is overly sparse (so > the gene cannot be recovered through evidence alignment and the second > round of unmasked prediction). > > ?Carson > > On Jul 31, 2017, at 10:53 AM, Daniel Ence wrote: > > Hi Quanwei, Running maker on the unmasked genome will probably give you > more genes, but won?t be helpful in the end. Maker soft-masks repeats, > which prevents blast alignments from being seeded in the masked regions, > but still allows them to extend into those regions. This solves the problem > missing exons mentioned in the text you sent. There?s an option in the > control file to run the ab-inition programs on the unmasked sequence > (?unmask?) which is set to false (0) by default. > > Hope this helps, > Daniel Ence > > > On Jul 31, 2017, at 12:42 PM, Quanwei Zhang wrote: > > Hello: > > We are using the Maker2 pipeline to annotating a new genome. We just read > something about the repeat masking from repeatMasker's documents. It > suggests to leave low complexity region unmasked and to do gene annotation > using both masked and unmasked genome. I wonder what your opinion and > suggestions on this? Many thanks > > > The paragraph below is from http://www.binfo.ncku.edu.tw/ > RM/webrepeatmaskerhelp.html > Use in association with gene prediction programs > > Predicting genes from a masked sequence faces several problems. First, > one should not mask low complexity regions, e.g. to avoid masking > trinucleotide repeats in coding regions. But even with only interspersed > repeats masked, gene prediction programs may fail to identify exons > correctly. As mentioned above, sometimes tail ends of coding regions may > have originated from transposable elements. Even if no coding regions have > been masked, splice sites may be compromised; e.g. the polypyrimidine > region that is part of the acceptor splice site may be contained within a > repeat. > > Thus, I generally recommend to run a gene prediction program on unmasked > DNA (as well) and compare the predicted genes and exons with the > RepeatMasker output. Some gene prediction program allow you to force > certain exons out of the predictions (e.g. often the old ORFs of LINE1 > elements and endogenous retroviruses are included in genes). Work is also > in progress at several sites to incorporate RepeatMasker into gene > prediction programs, in which cases matches to repeats are weighted in > along with the other parameters used. > > Best > > Quanwei > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Thu Aug 17 07:39:29 2017 From: chzelin at gmail.com (zl c) Date: Thu, 17 Aug 2017 09:39:29 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: I use '--mca btl ^openib' and it runs on multiple nodes. It works and I see some sequences is done for the test run. Then I make another run using the large nr database and use local space on the computer cluster, which fails. Submit CMD: sbatch --gres=lscratch:100 --time=168:00:00 --partition=multinode --constraint=x2680 --mem-per-cpu=64g --ntasks=8 --ntasks-per-core=1 --job-name run05.mpi -o log.mpi.00/run05.mpi.o%A run05.mpi.sh Error message: #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_BLLXNq/rna%2Efasta.mpi.10.21 -query /lscratch/47455932/maker_BLLXNq/50/tig00017383_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_ canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/ goldfish.arrow.renamed_datastore/5A/65/tig00017383_ arrow//theVoid.tig00017383_arrow/0/tig00017383_arrow.0. rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.21.tblastx #-------------------------------# Thread 1 terminated abnormally: can't open /lscratch/47455932/mpiavG_z: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. --> rank=37, hostname=cn4120 FATAL: Thread terminated, causing all processes to fail --> rank=37, hostname=cn4120 ------------------------------------------------------- Primary job terminated normally, but 1 process returned a non-zero exit code.. Per user-direction, the job has been aborted. ------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received running blast search. #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_Zsg_Gg/rna%2Efasta.mpi.10.8 -query /lscratch/47455932/maker_Zsg_Gg/62/tig00001111_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_ canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/ goldfish.arrow.renamed_datastore/B8/A5/tig00001111_ arrow//theVoid.tig00001111_arrow/0/tig00001111_arrow.0. rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.8.tblastx #-------------------------------# Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached -------------------------------------------------------------------------- An MPI communication peer process has unexpectedly disconnected. This usually indicates a failure in the peer process (e.g., a crash or otherwise exiting without calling MPI_FINALIZE first). Although this local MPI process will likely now behave unpredictably (it may even hang or crash), the root cause of this problem is the failure of the peer -- that is what you need to investigate. For example, there may be a core file that you can examine. More generally: such peer hangups are frequently caused by application bugs or other external events. Local host: cn4130 Local PID: 18831 Peer host: cn3683 -------------------------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received formating database... #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype prot -in /lscratch/47455932/maker_rNzO3X/27/blastprep/protein2%2Efasta.mpi.10.25 #-------------------------------# SIGTERM received SIGTERM received SIGTERM received SIGTERM received ... SIGTERM received SIGTERM received SIGTERM received Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached ... [cn3683:36010] 59 more processes have sent help message help-mpi-btl-tcp.txt / peer hung up [cn3683:36010] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages -------------------------------------------------------------------------- mpiexec detected that one or more processes exited with non-zero status, thus causing the job to be terminated. The first process to do so was: Process name: [[352,1],37] Exit code: 255 -------------------------------------------------------------------------- I rebuild the mpi_blast and rerun it again, also get the error: #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_k6a7Hy/32/blastprep/rna%2Efasta.mpi.10.3 #-------------------------------# Thread 1 terminated abnormally: can't open /lscratch/47559740/mpiS84Ju: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. --> rank=27, hostname=cn4115 FATAL: Thread terminated, causing all processes to fail --> rank=27, hostname=cn4115 deleted:276 hits doing tblastx of alt-ESTs formating database... #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_nCKTgE/2/blastprep/rna%2Efasta.mpi.10.11 #-------------------------------# running blast search. #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47559740/maker_0kWZTA/rna%2Efasta.mpi.10.20 -query /lscratch/47559740/maker_0kWZTA/35/tig00027947_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/86/7F/tig00027947_arrow//theVoid.tig00027947_arrow/0/tig00027947_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.20.tblastx #-------------------------------# ------------------------------------------------------- Primary job terminated normally, but 1 process returned a non-zero exit code.. Per user-direction, the job has been aborted. ------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Thanks, Zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either > '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include > ib0?). Otherwise if you have infiniband on the nodes it will try and use > OpenFabrics compatible libraries which will kill code doing system calls > (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is > always sacrificed by maker to act only for message management among > processes, so with -n 2, you have one process working and one managing > data. So only one contig will run at a time. If you set it to a higher > number the issue will go away. The message manger process starts to get > saturated at ~200 CPUs, so anything above that processor count becomes less > beneficial to the job. > > Thanks, > Carson > > > > > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 > --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A > run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and > large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > >> What is your command line? Are you running interactively or as a >> submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c wrote: >> >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set >> the number of task to 2, but there's only one contigs in running. Should it >> be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues >>> with OpenMPI. You can add them all or one at a time depending on issues you >>> get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message >>> help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >>> all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt >>> wrote: >>> >>>> You may need to delete the .../maker/perl directory before doing the >>>> reinstall if not doing a brand new installation. Otherwise you can ignore >>>> the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for >>>> MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval >>>> 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>>> cjfields at illinois.edu> wrote: >>>> >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>>> It looks like a Perl issue with threads, though I don?t see why this would >>>>> crash a cluster. The fact there is a log file would suggest it just ended >>>>> the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> *From: *maker-devel on behalf >>>>> of Carson Holt >>>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>>> *To: *zl c >>>>> *Cc: *"maker-devel at yandell-lab.org" >>>>> *Subject: *Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer >>>>> cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>>> genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yand >>>>> ell-lab.org >>>>> >>>>> >>>>> >>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Thu Aug 17 09:36:20 2017 From: carsonhh at gmail.com (Carson Holt) Date: Thu, 17 Aug 2017 09:36:20 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: This is the causal error ?> can't open /lscratch/47455932/mpiavG_z It kills one process and causes everything else to die in an ugly way. There are several possible causes: 1. /lscratch/47455932/ is not actually locally mounted. It may be a virtual directory created at run time that exists on the network but not as a true locally mounted disk. If this is the case, there can be a slight IO delay under heavy IO load (common on NFS) that can cause directories and files to appear to not exist. This is one of the reasons TMP= must be sent to a true locally mounted disk. The IO load MAKER can produce can swamp network mounted disks creating strange errors. 2. /lscratch/47455932/ may only exist on the head node and not other nodes for the job. True local temporary storage is not available across nodes. It is only available on the node it is attached to. So if you are creating the location as part of your job, it may only exist on the head node and not the other nodes. Usually this value is set to /tmp because each machine should have it?s own independent /tmp location. 3. /lscratch/47455932/ exists on all nodes, but is full on one of them. ?Carson ?Carson > On Aug 17, 2017, at 7:39 AM, zl c wrote: > > I use '--mca btl ^openib' and it runs on multiple nodes. It works and I see some sequences is done for the test run. > > Then I make another run using the large nr database and use local space on the computer cluster, which fails. > Submit CMD: > sbatch --gres=lscratch:100 --time=168:00:00 --partition=multinode --constraint=x2680 --mem-per-cpu=64g --ntasks=8 --ntasks-per-core=1 --job-name run05.mpi -o log.mpi.00/run05.mpi.o%A run05.mpi.sh > Error message: > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_BLLXNq/rna%2Efasta.mpi.10.21 -query /lscratch/47455932/maker_BLLXNq/50/tig00017383_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/5A/65/tig00017383_arrow//theVoid.tig00017383_arrow/0/tig00017383_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.21.tblastx > #-------------------------------# > Thread 1 terminated abnormally: can't open /lscratch/47455932/mpiavG_z: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. > --> rank=37, hostname=cn4120 > FATAL: Thread terminated, causing all processes to fail > --> rank=37, hostname=cn4120 > ------------------------------------------------------- > Primary job terminated normally, but 1 process returned > a non-zero exit code.. Per user-direction, the job has been aborted. > ------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > running blast search. > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_Zsg_Gg/rna%2Efasta.mpi.10.8 -query /lscratch/47455932/maker_Zsg_Gg/62/tig00001111_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/B8/A5/tig00001111_arrow//theVoid.tig00001111_arrow/0/tig00001111_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.8.tblastx > #-------------------------------# > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > -------------------------------------------------------------------------- > An MPI communication peer process has unexpectedly disconnected. This > usually indicates a failure in the peer process (e.g., a crash or > otherwise exiting without calling MPI_FINALIZE first). > > Although this local MPI process will likely now behave unpredictably > (it may even hang or crash), the root cause of this problem is the > failure of the peer -- that is what you need to investigate. For > example, there may be a core file that you can examine. More > generally: such peer hangups are frequently caused by application bugs > or other external events. > > Local host: cn4130 > Local PID: 18831 > Peer host: cn3683 > -------------------------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > formating database... > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype prot -in /lscratch/47455932/maker_rNzO3X/27/blastprep/protein2%2Efasta.mpi.10.25 > #-------------------------------# > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > ... > SIGTERM received > SIGTERM received > SIGTERM received > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > > ... > [cn3683:36010] 59 more processes have sent help message help-mpi-btl-tcp.txt / peer hung up > [cn3683:36010] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages > -------------------------------------------------------------------------- > mpiexec detected that one or more processes exited with non-zero status, thus causing > the job to be terminated. The first process to do so was: > > Process name: [[352,1],37] > Exit code: 255 > -------------------------------------------------------------------------- > > > I rebuild the mpi_blast and rerun it again, also get the error: > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_k6a7Hy/32/blastprep/rna%2Efasta.mpi.10.3 > #-------------------------------# > Thread 1 terminated abnormally: can't open /lscratch/47559740/mpiS84Ju: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. > --> rank=27, hostname=cn4115 > FATAL: Thread terminated, causing all processes to fail > --> rank=27, hostname=cn4115 > deleted:276 hits > doing tblastx of alt-ESTs > formating database... > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_nCKTgE/2/blastprep/rna%2Efasta.mpi.10.11 > #-------------------------------# > running blast search. > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47559740/maker_0kWZTA/rna%2Efasta.mpi.10.20 -query /lscratch/47559740/maker_0kWZTA/35/tig00027947_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/86/7F/tig00027947_arrow//theVoid.tig00027947_arrow/0/tig00027947_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.20.tblastx > #-------------------------------# > ------------------------------------------------------- > Primary job terminated normally, but 1 process returned > a non-zero exit code.. Per user-direction, the job has been aborted. > ------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > > Thanks, > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt > wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0?). Otherwise if you have infiniband on the nodes it will try and use OpenFabrics compatible libraries which will kill code doing system calls (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is always sacrificed by maker to act only for message management among processes, so with -n 2, you have one process working and one managing data. So only one contig will run at a time. If you set it to a higher number the issue will go away. The message manger process starts to get saturated at ~200 CPUs, so anything above that processor count becomes less beneficial to the job. > > Thanks, > Carson > > > > >> On Aug 15, 2017, at 3:05 PM, zl c > wrote: >> >> I submit a job: >> sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh >> >> CMD in run06.maker.mpi.sh >> mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta >> >> Another question: >> How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. >> >> Thanks, >> zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> >> On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt > wrote: >> What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c > wrote: >> >>> Hi Carson, Christopher, Daniel, >>> >>> Thank you for your kind help. >>> >>> Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? >>> >>> Zelin >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com ] >>> >>> >>> NIH/NHGRI >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt > wrote: >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>>> On Aug 15, 2017, at 9:34 AM, zl c > wrote: >>>> >>>> Here are some latest message: >>>> >>>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com ] >>>> >>>> >>>> >>>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: >>>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c > wrote: >>>> >>>>> When I installed by './Build install', I got following some messages: >>>>> Configuring MAKER with MPI support >>>>> Installing MAKER... >>>>> Configuring MAKER with MPI support >>>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>>> >>>>> I'm not sure whether it's correctly installed. >>>>> >>>>> Thanks, >>>>> >>>>> -------------------------------------------- >>>>> Zelin Chen [chzelin at gmail.com ] >>>>> >>>>> NIH/NHGRI >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> From: maker-devel > on behalf of Carson Holt > >>>>> Date: Monday, August 14, 2017 at 2:18 PM >>>>> To: zl c > >>>>> Cc: "maker-devel at yandell-lab.org " > >>>>> Subject: Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com ] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>> >>>>> >>>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From yplee614 at 163.com Fri Aug 18 04:46:08 2017 From: yplee614 at 163.com (yplee) Date: Fri, 18 Aug 2017 18:46:08 +0800 Subject: [maker-devel] basis of gene removed in maker re-annotation Message-ID: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> Dear maker author, I am yongping li, a student from huazhong agriculture university, china. We used MAKER to re-annotation our genome annotation. There is some gene were removal in MAKER output when i input out previous annotation gff file, so what was the basis for gene removal? would you please provide us the details of gene remove? The reviews ask question when i submit my re-annotation paper to journal. Best regards Yours Sincerely From carsonhh at gmail.com Fri Aug 18 09:35:48 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 18 Aug 2017 09:35:48 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> Message-ID: <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Hi Quanwei, > (1) We are doing genome annotation for a new rodent species, we wonder whether we should use repeat library for "Mammalia" or "rodent"? Which is more proper, if we did not construct a species-specific repeat library for the new genome? Over masking can occur, but you should really only worry about it if there is a specific gene you are looking for or gene family and you don?t care about false positive gene models. On a genome wide level you will find that undermasking is almost always the greater danger. So I?d recommend using Mammalia. Also you should always build a species specific library when working with repeat rich organisms like mammals. > (2) With some concerns as discussed above emails, we did not train a species-specific repeat library. Since we have finished the annotation only using the repeat library from repeatMasker and Maker2, we wonder whether it is worth for us to firstly train a species-specific repeat library and then do the genome annotation again? Will it (i.e., trainning a species-specific repeat library) significantly affect the gene annotation and downstream analysis (e.g., gene family expansion analysis, positive selection)? It might be ok. Both Mammalia and rodent are already rich in related species repeats in RepBase. But you still may have a lot of false positives because of missed repeats. Repeats and transposable elements tend to create false regions of high evidence homology (make it look like you are getting evidence for a gene in the region, but when you look at the underlying sequence you realize it is a spurious alignment). > (3) We identified some gene families under contraction, but we want to confirm those gene families really lost copies in our new genome. Do you think it is worth to do the genome annotation without repeat masking, so there will not be genes missing from annotation due to repeat mask? Without repeat masking you will get a lot of false alignments. If you find anything without repeat masking you will need to do heavy manual review of the alignment and perhaps even domain identification to further weed out the many false positives you are sure to get. ?Carson From carsonhh at gmail.com Fri Aug 18 09:37:38 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 18 Aug 2017 09:37:38 -0600 Subject: [maker-devel] basis of gene removed in maker re-annotation In-Reply-To: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> References: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> Message-ID: Genes are removed if they have no evidence support or are overlapped by another gene that has better evidence support (the AED score measures evidence support). If you pass in old gene models in GFF3 format (model_gff), they will always be kept, even without evidence support but can be replaced by better supported overlapping models. ?Carson > On Aug 18, 2017, at 4:46 AM, yplee wrote: > > Dear maker author, > > I am yongping li, a student from huazhong agriculture university, china. We used MAKER to re-annotation our genome annotation. There is some gene were removal in MAKER output when i input out previous annotation gff file, so what was the basis for gene removal? > > would you please provide us the details of gene remove? The reviews ask question when i submit my re-annotation paper to journal. > > > > Best regards > > > Yours Sincerely > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org From qwzhang0601 at gmail.com Mon Aug 21 10:51:34 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Mon, 21 Aug 2017 12:51:34 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: Dear Carson: I am trying to build a species specific repeat library for our new rodent species, following " http://weatherby.genetics.utah.edu/MAKER/wiki/index.php/Repeat_Library_Construction--Basic". But there are somethings not clear to us, would you please explain? Thanks (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder"*. *Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). In the file "maker_opts.ctl" #-----Repeat Masking (leave values blank to skip repeat masking) model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker Many thanks Best Quanwei 2017-08-18 11:35 GMT-04:00 Carson Holt : > Hi Quanwei, > > > (1) We are doing genome annotation for a new rodent species, we wonder > whether we should use repeat library for "Mammalia" or "rodent"? Which is > more proper, if we did not construct a species-specific repeat library for > the new genome? > > Over masking can occur, but you should really only worry about it if there > is a specific gene you are looking for or gene family and you don?t care > about false positive gene models. On a genome wide level you will find that > undermasking is almost always the greater danger. So I?d recommend using > Mammalia. Also you should always build a species specific library when > working with repeat rich organisms like mammals. > > > > (2) With some concerns as discussed above emails, we did not train a > species-specific repeat library. Since we have finished the annotation only > using the repeat library from repeatMasker and Maker2, we wonder whether it > is worth for us to firstly train a species-specific repeat library and > then do the genome annotation again? Will it (i.e., trainning a > species-specific repeat library) significantly affect the gene annotation > and downstream analysis (e.g., gene family expansion analysis, positive > selection)? > > It might be ok. Both Mammalia and rodent are already rich in related > species repeats in RepBase. But you still may have a lot of false positives > because of missed repeats. Repeats and transposable elements tend to create > false regions of high evidence homology (make it look like you are getting > evidence for a gene in the region, but when you look at the underlying > sequence you realize it is a spurious alignment). > > > > (3) We identified some gene families under contraction, but we want to > confirm those gene families really lost copies in our new genome. Do you > think it is worth to do the genome annotation without repeat masking, so > there will not be genes missing from annotation due to repeat mask? > > Without repeat masking you will get a lot of false alignments. If you find > anything without repeat masking you will need to do heavy manual review of > the alignment and perhaps even domain identification to further weed out > the many false positives you are sure to get. > > ?Carson -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 22 10:15:59 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 22 Aug 2017 10:15:59 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> Message-ID: The est2genome option takes an alignment and then just identifies the longest ORF in that alignment and turns it into a model (these models are good enough to rain with). The reason est2genoime is not recommended for the annotation step are several. 1. They are likely to be partial in many cases or include a number of merged assemblies depending on the organism. 2. They will likely only represent a fraction of the genes so relying only on est2genome models will result in low sensitivity since not everything is expected to be expressed or assembled. 3. Ab initio predictors that receive the intron/exon hints from a transcript evidence alignment should still replicate the structure of correctly assembled transcripts anyways, but they can still call genes in other regions without transcript evidence to improve sensitivity or improve structure for models with only partial transcript evidence alignment (i.e. they can complete the incomplete models). 4. If their are assembly error?s (you can expect a lot of these in a draft assembly), ab initio predictors can work around the errors to create an intron/exon structure with reasonable similar ORF that will be similar to the true ORF if not exactly correct, where alignment based methods cannot and will just produce a truncated ORF. 5. est2genome models will always have great AED scores (falsely good scores) since they are their own evidence and match themselves exactly, so spurious alignments and partial alignments always score very high even when they are bad models. By turning est2genome off, you allows the HMM scoring mechanism to act as an additional filter on those models. If you have really really good transcript evidence, it is possible for est2genome to work very well. But the likelihood of having evidence that perfect is low. So for those reasons we recommend using it only as an intermediate step. ?Carson > On Aug 19, 2017, at 10:38 AM, Tim Fallon wrote: > > Hi Carson, > > Just a follow up to this, for posterity. I was able to do what I wanted by using just the est2genome=1, and turning off protein2genome. The input to the est2genome is a Trinity de novo transcriptome assembly with strand specific libraries + assembly and jaccard clip. The results seem quite reliable, and I?m not getting the problem where tandem similar genes were getting fused anymore (the original problem with this inquiry). I expect this is due to there being enough nucleotide differences in the est2genome alignment of two similar and tandem transcripts to effectively distinguish them. > > In any event, it wasn?t clear to me that est2genome=1 alone would produce ORF/CDS predictions (for the genes), and I?ve done a lot of reading around the Maker documentation and papers. Might be worth considering making the documentation more clear in this respect in the future. I know that est2genome & protein2genome were originally intended more as an intermediate step for ab-initio gene predictor training, but in my opinion with the quality and cost-effectivness of transcript discovery RNA-Seq, it seems reasonable to ditch the ab-initio gene prediction and go entirely with a ?est2genome=1? like approach. It might be worthwhile to document what your thought process would be for reliable ab-initio free gene annotation w/ Maker. I?ll mention I haven?t looked into the PASA pipeline for this, which is the only other major publicly available gene structure annotation pipeline known to me, as the parallelization in Maker has been working quite well for me. > > Are the heuristics for this ORF prediction in est2genome=1 documented anywhere? E.g., does it only pick the longest ORF per transcript? Or if there are multiple ?good? ORFs (>200 amino acids) per transcript, will it try and split those into different genes? I ask as my current task is trying to merge the previously mentioned de novo transcriptome derived gene models from est2genome with est2genome gene models of a reference guided transcriptome assembly. Although the reference guided transcript assembly captures more genes that the Trinity assembly (by tblastn), the transcripts are notably artifactually chimeric, sometimes containing 4-5 CDSs, so the heuristics for the Maker est2genome could be pretty influential. > > All the best, > -Tim > >> On Jul 13, 2017, at 1:05 PM, Carson Holt > wrote: >> >> est2genome and protein2genome take BLAST hits, polish them with exonerate around splice sites and then turn the alignment directly into a gene model. So if the alignment is partial because the EST or mRNA-seq do not cross the entire transcript or the protein homology does not cross the entire CDS, then the resulting model will be partial. It can be end to end, but partial tends to be more common than not unless you are using a protein evidence library with limited divergence. >> >> ?Carson >> >> >> >>> On Jul 10, 2017, at 2:00 PM, Tim Fallon > wrote: >>> >>> Hi Carson, >>> >>> So far what I've noticed with just est2genome, and protein2genome, using only de novo assembled transcripts with transdecoder predicted peptides (both mapped in maker with blast evalue limit = 1e-50), the gene models (for the genes where I have enough information about the "correct" gene structure), have been full length. Is this unexpected? >>> >>> Will try Apollo. Though I'd like to avoid manual curation. Perhaps it is worth talking to the Augustus developers to see why Augustus was making the exon error in my key gene that led me to ditching it altogether. >>> >>> Agree there are varying qualities of draft assemblies. In our case, we did 100X Illumina hybrid assembly w/ 50X PacBio. The local structure so far seems to be pretty good. >>> >>> Good to know that the human and mouse assemblies even have gene errors, makes me feel better about how much time I've put in trying to get my genome annotation perfect :) >>> >>> All the best, >>> -Tim >>> >>> On Jul 10, 2017, at 3:20 PM, Carson Holt > wrote: >>> >>>> est2genome and protein2genome will almost always be partial. Also the error rate on draft assemblies is much higher than most people realize. Beyond issues already mentioned in the previous e-mail, there is also the issue that organisms are diploid, but the assembly is haploid, so variation gets squashed which also breaks ORFs (there are several examples of this in both the mature human and mouse genome assemblies). For many draft assemblies, you can expect ORF affecting errors in as much as 10-15% of your annotations. >>>> >>>> Try opening the cases with issues and manually editing them in Apollo. Possible sources of sequence guiding the annotation may become more apparent (look at mismatches in the mRNA-seq alignments relative to the assembly for example). And if not, and the region is just too complex for the predictor, then you can force the model with Apollo. >>>> >>>> ?Carson >>>> >>>> >>>>> On Jul 6, 2017, at 6:45 AM, Tim Fallon > wrote: >>>>> >>>>> Hi Carson, >>>>> >>>>> This region is definitely entirely correct at the genomic nucleotide level, no missassemblies. Would you have any strong reservations about ditching the ab-initio prediction and sticking entirely with the est2genome predictions and protein2genome predictions? Right now this is what I?m thinking, as troubleshooting the ab-initio training seems like it could be a long road. >>>>> >>>>> All the best, >>>>> -Tim >>>>> >>>>>> On Jun 26, 2017, at 6:00 PM, Carson Holt > wrote: >>>>>> >>>>>> Augustus uses an HMM with scoring bonuses for evidence match. If a difference in the assembly breaks the ORF anywhere in the transcript relative to the evidence or removes high scoring transcript start/stop sequences, then Augustus will add/skip exons or trim/extend transcripts to capture what scoring bonuses it can as best it can. So wherever you see Augustus behaving weirdly, you likely have something off in the assembly (small stretch of NN?s or single basepair duplications/deletions that affect the ORF and scoring model). So what Augustus produces is the best fit gene model to hop around assembly anomalies while still producing a canonical model. >>>>>> >>>>>> In areas like the ones I describe above, EVM refuses to produce any model. So you can experiment with the EVM options in MAKER3, but what you may find is that problem regions tend to get no models with EVM. I believe using the pred_gff trick I mentioned previously may be the easiest work around. Also make sure to prefilter mRNA-seq evidence to avoid transcript joining (trinity has a jaccard_clip option which can help). Because if you are getting transcript joining in proteins, you are almost certain to get it in transcript evidence as well. >>>>>> >>>>>> ?Carson >>>>>> >>>>>>> On Jun 22, 2017, at 10:59 PM, Tim Fallon > wrote: >>>>>>> >>>>>>> Hi Carson, >>>>>>> >>>>>>> Thanks for the response! After sending my initial email, I did notice this particular issue was warned about in the Cambell et al. 2014 Maker protocols paper. Perhaps future versions of the pipeline might have a workaround or warning for this presumably common issue. At least in my case, the genome I?m annotating has large introns, and also tandem gene clusters of homologous genes, so I?ve been unable to solve this issue entirely by changing existing parameters (e.g. split_hit), though perhaps exonerate / protein2genome direct gene annotation does handle it correctly. >>>>>>> >>>>>>> Regarding the protein2genome only being a intermediate stage, as I?ve been working towards a final annotation, I?ve actually been mostly relying on the protein2genome direct gene annotation, as although I have a trained Augustus that is presumably getting the hints from the evidence, my main target genes have been producing subtly wrong gene-models (Augustus produced splice sit off by a handful of nucleotides, leading to unintended & unsupported amino acids in the protein). I also trained SNAP, but those predictions were worse than the Augustus predictions. >>>>>>> >>>>>>> Do you have any tips for using the Evidence Modeler integration of the Maker 3.0.0 beta? That seems to be the best way to have the final gene models rely more on extrinsic evidence over my mildly incorrect ab-initio predictions. Or perhaps PASA is more appropriate for gene-models that would strictly adhere to extrinsic de novo assembled transcript / predicted ORF evidence? >>>>>>> >>>>>>> All the best, >>>>>>> -Tim >>>>>>> >>>>>>>> On Jun 23, 2017, at 12:27 AM, Carson Holt > wrote: >>>>>>>> >>>>>>>> The protein_match features are the direct BLASTX results. Because of how BLAST works, if you have neighboring paralogs, it can place HSPs in both. So the final hit ends up being to large. The protein2genome feature is then the result of exonerate polishing these blast alignments (this will usually remove false merging and bad exon order). The protein2genome=1 option on the other hand just tell maker that you want to try and convert the exonerate hits directly into gene models (only do this for training and not final annotation). One way to drop the BLASTX results may be to filter the GFF3 results to keep only protein2genome features, pass those into protein_gff, and then turn off protein= for the next run. This forces the blastx results to be dropped. You may want to set blast_depth parameters to something like 10 in maker_bopts.ctl before doing this to trim per locus evidence depth to 10 if you are using too much input data. >>>>>>>> >>>>>>>> ?Carson >>>>>>>> >>>>>>>> >>>>>>>> >>>>>>>>> On Jun 13, 2017, at 11:35 AM, Tim Fallon > wrote: >>>>>>>>> >>>>>>>>> Hi there, >>>>>>>>> >>>>>>>>> I am aligning reference proteins to an insect genome through Maker, in preparation for using the gene models from the protein alignments as evidence to train SNAP (alongside de-novo assembled RNA-Seq). I also plan on passing the protein alignments to a future Maker run as hints for SNAP / Augustus. >>>>>>>>> >>>>>>>>> I?ve noticed that the maker blastx "protein_match? feature, which I presume is a result of Maker trying to make the blastx HSPs contiguous to format as a reference for exonerate (this Maker run did have protein2genome turned on), tends to fuse tandem genes from the same gene family. See attached image. >>>>>>>>> >>>>>>>>> The red regions highlight two de novo assembled transcripts which I aligned manually, from two genes that are homologous. The top track is the blastx ?match_part? features, the bottom track is the blastx ?protein_match? features. You can see that the protein_match fuses the two genes, using ~1000 bp in an intervening region, that doesn?t have blastx HSP support in the blastx ?match_part? track. The trick seems to be that a single reference protein, has blastx matches on both the left and right gene. >>>>>>>>> >>>>>>>>> Cleary this isn?t a good gene model to train SNAP with, but would this misannotation screw up the hints passed to pretrained SNAP / Augustus? >>>>>>>>> >>>>>>>>> Is there anyway to prevent this protein_match fusing of adjacent similar genes from happening? For species that are closer, I?ve set the ?eval_blastx? to be a lot higher (1e-50), and in that case the genes don?t get fused (but, with that level of stringent search, it is more like an orthology search, rather than just annotating general protein similarity). I do have (rare) introns ~1000 bp, so I wouldn?t want to change the Maker ?split_hit? parameter to be too low. >>>>>>>>> >>>>>>>>> All the best, >>>>>>>>> -Tim >>>>>>>>> >>>>>>>>> Timothy R. Fallon >>>>>>>>> PhD candidate >>>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>>> Department of Biology >>>>>>>>> MIT >>>>>>>>> >>>>>>>>> tfallon at mit.edu >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>> _______________________________________________ >>>>>>>>> maker-devel mailing list >>>>>>>>> maker-devel at box290.bluehost.com >>>>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>>>> >>>>>>> >>>>>>> Timothy R. Fallon >>>>>>> PhD candidate >>>>>>> Laboratory of Jing-Ke Weng >>>>>>> Department of Biology >>>>>>> MIT >>>>>>> >>>>>>> tfallon at mit.edu >>>>>> >>>>> >>>>> Timothy R. Fallon >>>>> PhD candidate >>>>> Laboratory of Jing-Ke Weng >>>>> Department of Biology >>>>> MIT >>>>> >>>>> tfallon at mit.edu >>>> >> > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From tfallon at mit.edu Tue Aug 22 10:38:47 2017 From: tfallon at mit.edu (Tim Fallon) Date: Tue, 22 Aug 2017 12:38:47 -0400 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> Message-ID: <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) All the best, -Tim > On Aug 22, 2017, at 12:15 PM, Carson Holt wrote: > > The est2genome option takes an alignment and then just identifies the longest ORF in that alignment and turns it into a model (these models are good enough to rain with). The reason est2genoime is not recommended for the annotation step are several. > > 1. They are likely to be partial in many cases or include a number of merged assemblies depending on the organism. > 2. They will likely only represent a fraction of the genes so relying only on est2genome models will result in low sensitivity since not everything is expected to be expressed or assembled. > 3. Ab initio predictors that receive the intron/exon hints from a transcript evidence alignment should still replicate the structure of correctly assembled transcripts anyways, but they can still call genes in other regions without transcript evidence to improve sensitivity or improve structure for models with only partial transcript evidence alignment (i.e. they can complete the incomplete models). > 4. If their are assembly error?s (you can expect a lot of these in a draft assembly), ab initio predictors can work around the errors to create an intron/exon structure with reasonable similar ORF that will be similar to the true ORF if not exactly correct, where alignment based methods cannot and will just produce a truncated ORF. > 5. est2genome models will always have great AED scores (falsely good scores) since they are their own evidence and match themselves exactly, so spurious alignments and partial alignments always score very high even when they are bad models. By turning est2genome off, you allows the HMM scoring mechanism to act as an additional filter on those models. > > If you have really really good transcript evidence, it is possible for est2genome to work very well. But the likelihood of having evidence that perfect is low. So for those reasons we recommend using it only as an intermediate step. > > ?Carson > > > >> On Aug 19, 2017, at 10:38 AM, Tim Fallon > wrote: >> >> Hi Carson, >> >> Just a follow up to this, for posterity. I was able to do what I wanted by using just the est2genome=1, and turning off protein2genome. The input to the est2genome is a Trinity de novo transcriptome assembly with strand specific libraries + assembly and jaccard clip. The results seem quite reliable, and I?m not getting the problem where tandem similar genes were getting fused anymore (the original problem with this inquiry). I expect this is due to there being enough nucleotide differences in the est2genome alignment of two similar and tandem transcripts to effectively distinguish them. >> >> In any event, it wasn?t clear to me that est2genome=1 alone would produce ORF/CDS predictions (for the genes), and I?ve done a lot of reading around the Maker documentation and papers. Might be worth considering making the documentation more clear in this respect in the future. I know that est2genome & protein2genome were originally intended more as an intermediate step for ab-initio gene predictor training, but in my opinion with the quality and cost-effectivness of transcript discovery RNA-Seq, it seems reasonable to ditch the ab-initio gene prediction and go entirely with a ?est2genome=1? like approach. It might be worthwhile to document what your thought process would be for reliable ab-initio free gene annotation w/ Maker. I?ll mention I haven?t looked into the PASA pipeline for this, which is the only other major publicly available gene structure annotation pipeline known to me, as the parallelization in Maker has been working quite well for me. >> >> Are the heuristics for this ORF prediction in est2genome=1 documented anywhere? E.g., does it only pick the longest ORF per transcript? Or if there are multiple ?good? ORFs (>200 amino acids) per transcript, will it try and split those into different genes? I ask as my current task is trying to merge the previously mentioned de novo transcriptome derived gene models from est2genome with est2genome gene models of a reference guided transcriptome assembly. Although the reference guided transcript assembly captures more genes that the Trinity assembly (by tblastn), the transcripts are notably artifactually chimeric, sometimes containing 4-5 CDSs, so the heuristics for the Maker est2genome could be pretty influential. >> >> All the best, >> -Tim >> >>> On Jul 13, 2017, at 1:05 PM, Carson Holt > wrote: >>> >>> est2genome and protein2genome take BLAST hits, polish them with exonerate around splice sites and then turn the alignment directly into a gene model. So if the alignment is partial because the EST or mRNA-seq do not cross the entire transcript or the protein homology does not cross the entire CDS, then the resulting model will be partial. It can be end to end, but partial tends to be more common than not unless you are using a protein evidence library with limited divergence. >>> >>> ?Carson >>> >>> >>> >>>> On Jul 10, 2017, at 2:00 PM, Tim Fallon > wrote: >>>> >>>> Hi Carson, >>>> >>>> So far what I've noticed with just est2genome, and protein2genome, using only de novo assembled transcripts with transdecoder predicted peptides (both mapped in maker with blast evalue limit = 1e-50), the gene models (for the genes where I have enough information about the "correct" gene structure), have been full length. Is this unexpected? >>>> >>>> Will try Apollo. Though I'd like to avoid manual curation. Perhaps it is worth talking to the Augustus developers to see why Augustus was making the exon error in my key gene that led me to ditching it altogether. >>>> >>>> Agree there are varying qualities of draft assemblies. In our case, we did 100X Illumina hybrid assembly w/ 50X PacBio. The local structure so far seems to be pretty good. >>>> >>>> Good to know that the human and mouse assemblies even have gene errors, makes me feel better about how much time I've put in trying to get my genome annotation perfect :) >>>> >>>> All the best, >>>> -Tim >>>> >>>> On Jul 10, 2017, at 3:20 PM, Carson Holt > wrote: >>>> >>>>> est2genome and protein2genome will almost always be partial. Also the error rate on draft assemblies is much higher than most people realize. Beyond issues already mentioned in the previous e-mail, there is also the issue that organisms are diploid, but the assembly is haploid, so variation gets squashed which also breaks ORFs (there are several examples of this in both the mature human and mouse genome assemblies). For many draft assemblies, you can expect ORF affecting errors in as much as 10-15% of your annotations. >>>>> >>>>> Try opening the cases with issues and manually editing them in Apollo. Possible sources of sequence guiding the annotation may become more apparent (look at mismatches in the mRNA-seq alignments relative to the assembly for example). And if not, and the region is just too complex for the predictor, then you can force the model with Apollo. >>>>> >>>>> ?Carson >>>>> >>>>> >>>>>> On Jul 6, 2017, at 6:45 AM, Tim Fallon > wrote: >>>>>> >>>>>> Hi Carson, >>>>>> >>>>>> This region is definitely entirely correct at the genomic nucleotide level, no missassemblies. Would you have any strong reservations about ditching the ab-initio prediction and sticking entirely with the est2genome predictions and protein2genome predictions? Right now this is what I?m thinking, as troubleshooting the ab-initio training seems like it could be a long road. >>>>>> >>>>>> All the best, >>>>>> -Tim >>>>>> >>>>>>> On Jun 26, 2017, at 6:00 PM, Carson Holt > wrote: >>>>>>> >>>>>>> Augustus uses an HMM with scoring bonuses for evidence match. If a difference in the assembly breaks the ORF anywhere in the transcript relative to the evidence or removes high scoring transcript start/stop sequences, then Augustus will add/skip exons or trim/extend transcripts to capture what scoring bonuses it can as best it can. So wherever you see Augustus behaving weirdly, you likely have something off in the assembly (small stretch of NN?s or single basepair duplications/deletions that affect the ORF and scoring model). So what Augustus produces is the best fit gene model to hop around assembly anomalies while still producing a canonical model. >>>>>>> >>>>>>> In areas like the ones I describe above, EVM refuses to produce any model. So you can experiment with the EVM options in MAKER3, but what you may find is that problem regions tend to get no models with EVM. I believe using the pred_gff trick I mentioned previously may be the easiest work around. Also make sure to prefilter mRNA-seq evidence to avoid transcript joining (trinity has a jaccard_clip option which can help). Because if you are getting transcript joining in proteins, you are almost certain to get it in transcript evidence as well. >>>>>>> >>>>>>> ?Carson >>>>>>> >>>>>>>> On Jun 22, 2017, at 10:59 PM, Tim Fallon > wrote: >>>>>>>> >>>>>>>> Hi Carson, >>>>>>>> >>>>>>>> Thanks for the response! After sending my initial email, I did notice this particular issue was warned about in the Cambell et al. 2014 Maker protocols paper. Perhaps future versions of the pipeline might have a workaround or warning for this presumably common issue. At least in my case, the genome I?m annotating has large introns, and also tandem gene clusters of homologous genes, so I?ve been unable to solve this issue entirely by changing existing parameters (e.g. split_hit), though perhaps exonerate / protein2genome direct gene annotation does handle it correctly. >>>>>>>> >>>>>>>> Regarding the protein2genome only being a intermediate stage, as I?ve been working towards a final annotation, I?ve actually been mostly relying on the protein2genome direct gene annotation, as although I have a trained Augustus that is presumably getting the hints from the evidence, my main target genes have been producing subtly wrong gene-models (Augustus produced splice sit off by a handful of nucleotides, leading to unintended & unsupported amino acids in the protein). I also trained SNAP, but those predictions were worse than the Augustus predictions. >>>>>>>> >>>>>>>> Do you have any tips for using the Evidence Modeler integration of the Maker 3.0.0 beta? That seems to be the best way to have the final gene models rely more on extrinsic evidence over my mildly incorrect ab-initio predictions. Or perhaps PASA is more appropriate for gene-models that would strictly adhere to extrinsic de novo assembled transcript / predicted ORF evidence? >>>>>>>> >>>>>>>> All the best, >>>>>>>> -Tim >>>>>>>> >>>>>>>>> On Jun 23, 2017, at 12:27 AM, Carson Holt > wrote: >>>>>>>>> >>>>>>>>> The protein_match features are the direct BLASTX results. Because of how BLAST works, if you have neighboring paralogs, it can place HSPs in both. So the final hit ends up being to large. The protein2genome feature is then the result of exonerate polishing these blast alignments (this will usually remove false merging and bad exon order). The protein2genome=1 option on the other hand just tell maker that you want to try and convert the exonerate hits directly into gene models (only do this for training and not final annotation). One way to drop the BLASTX results may be to filter the GFF3 results to keep only protein2genome features, pass those into protein_gff, and then turn off protein= for the next run. This forces the blastx results to be dropped. You may want to set blast_depth parameters to something like 10 in maker_bopts.ctl before doing this to trim per locus evidence depth to 10 if you are using too much input data. >>>>>>>>> >>>>>>>>> ?Carson >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>>> On Jun 13, 2017, at 11:35 AM, Tim Fallon > wrote: >>>>>>>>>> >>>>>>>>>> Hi there, >>>>>>>>>> >>>>>>>>>> I am aligning reference proteins to an insect genome through Maker, in preparation for using the gene models from the protein alignments as evidence to train SNAP (alongside de-novo assembled RNA-Seq). I also plan on passing the protein alignments to a future Maker run as hints for SNAP / Augustus. >>>>>>>>>> >>>>>>>>>> I?ve noticed that the maker blastx "protein_match? feature, which I presume is a result of Maker trying to make the blastx HSPs contiguous to format as a reference for exonerate (this Maker run did have protein2genome turned on), tends to fuse tandem genes from the same gene family. See attached image. >>>>>>>>>> >>>>>>>>>> The red regions highlight two de novo assembled transcripts which I aligned manually, from two genes that are homologous. The top track is the blastx ?match_part? features, the bottom track is the blastx ?protein_match? features. You can see that the protein_match fuses the two genes, using ~1000 bp in an intervening region, that doesn?t have blastx HSP support in the blastx ?match_part? track. The trick seems to be that a single reference protein, has blastx matches on both the left and right gene. >>>>>>>>>> >>>>>>>>>> Cleary this isn?t a good gene model to train SNAP with, but would this misannotation screw up the hints passed to pretrained SNAP / Augustus? >>>>>>>>>> >>>>>>>>>> Is there anyway to prevent this protein_match fusing of adjacent similar genes from happening? For species that are closer, I?ve set the ?eval_blastx? to be a lot higher (1e-50), and in that case the genes don?t get fused (but, with that level of stringent search, it is more like an orthology search, rather than just annotating general protein similarity). I do have (rare) introns ~1000 bp, so I wouldn?t want to change the Maker ?split_hit? parameter to be too low. >>>>>>>>>> >>>>>>>>>> All the best, >>>>>>>>>> -Tim >>>>>>>>>> >>>>>>>>>> Timothy R. Fallon >>>>>>>>>> PhD candidate >>>>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>>>> Department of Biology >>>>>>>>>> MIT >>>>>>>>>> >>>>>>>>>> tfallon at mit.edu >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> _______________________________________________ >>>>>>>>>> maker-devel mailing list >>>>>>>>>> maker-devel at box290.bluehost.com >>>>>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>>>>> >>>>>>>> >>>>>>>> Timothy R. Fallon >>>>>>>> PhD candidate >>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>> Department of Biology >>>>>>>> MIT >>>>>>>> >>>>>>>> tfallon at mit.edu >>>>>>> >>>>>> >>>>>> Timothy R. Fallon >>>>>> PhD candidate >>>>>> Laboratory of Jing-Ke Weng >>>>>> Department of Biology >>>>>> MIT >>>>>> >>>>>> tfallon at mit.edu >>>>> >>> >> >> >> > Timothy R. Fallon PhD candidate Laboratory of Jing-Ke Weng Department of Biology MIT tfallon at mit.edu -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: smime.p7s Type: application/pkcs7-signature Size: 1853 bytes Desc: not available URL: From isabel.marcelino.im at gmail.com Wed Aug 23 10:29:57 2017 From: isabel.marcelino.im at gmail.com (Isabel Marcelino) Date: Wed, 23 Aug 2017 12:29:57 -0400 Subject: [maker-devel] Fwd: Errors with Blast engine and Fasta index In-Reply-To: References: Message-ID: ---------- Forwarded message ---------- From: Isabel Marcelino Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker-devel at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/ Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/ Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI Garanti sans virus. www.avast.com <#DAB4FAD8-2DD7-40BB-A1B8-4E2AA1F9FDF2> -------------- next part -------------- An HTML attachment was scrubbed... URL: From willett4 at email.unc.edu Wed Aug 23 10:26:05 2017 From: willett4 at email.unc.edu (Willett, Christopher S) Date: Wed, 23 Aug 2017 16:26:05 +0000 Subject: [maker-devel] question about FASTA warnings Message-ID: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Hello- I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. Thanks for your help, Best, Chris Willett here is a portion of the run log with some examples of the warnings: ------------------------------------------------------------ # LSBATCH: User input maker ------------------------------------------------------------ Successfully completed. Resource usage summary: CPU time : 59.63 sec. Total Requested Memory : 0.50 GB Delta Memory : - Max Processes : 7 Max Threads : 8 Run time : 47 sec. Turnaround time : 55 sec. The output (if any) follows: STATUS: Parsing control files... STATUS: Processing and indexing input FASTA files... STATUS: Setting up database for any GFF3 input... A data structure will be created for you at: /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore To access files for individual sequences use the datastore index: /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log STATUS: Now running MAKER... examining contents of the fasta file and run log --Next Contig-- #--------------------------------------------------------------------- Now starting the contig!! SeqID: contig-dpp-500-500 Length: 32156 #--------------------------------------------------------------------- setting up GFF3 output and fasta chunks doing repeat masking running repeat masker. #--------- command -------------# Widget::RepeatMasker: cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 #-------------------------------# doing blastx repeats formating database... #--------- command -------------# Widget::formater: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 #-------------------------------# Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. running blast search. #--------- command -------------# Widget::blastx: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner #-------------------------------# deleted:0 hits doing blastx repeats formating database... #--------- command -------------# Widget::formater: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 #-------------------------------# Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) (continues on as above but title lengths are different) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Research Associate Professor Department of Biology CB#3280 Coker Hall University of North Carolina, Chapel Hill Chapel Hill, NC, 27599-3280 Office: 2252 Genome Science Building phone: 919-843-8663 fax: 919-962-1625 http://labs.bio.unc.edu/Willett/ -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Wed Aug 23 10:57:59 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Wed, 23 Aug 2017 16:57:59 +0000 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: References: Message-ID: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? ~Daniel On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: ---------- Forwarded message ---------- From: Isabel Marcelino > Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker-devel at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI [https://ipmcdn.avast.com/images/icons/icon-envelope-tick-round-orange-animated-no-repeat-v1.gif] Garanti sans virus. www.avast.com _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Wed Aug 23 10:47:40 2017 From: dandence at gmail.com (Daniel Ence) Date: Wed, 23 Aug 2017 12:47:40 -0400 Subject: [maker-devel] question about FASTA warnings In-Reply-To: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> References: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Message-ID: Hi Chris, I haven?t seen that warning either in my usage of MAKER. My guess is that the version of Repeatmasker installed on your cluster has this warning and expects a certain format in the fasta headers. This could be checked by looking at the TE protein file that maker is using. Do you have access to that? In any case it probably isn?t an issue that needs to be fixed if the output otherwise looks good. ~Daniel > On Aug 23, 2017, at 12:26 PM, Willett, Christopher S wrote: > > Hello- > > I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. > > Thanks for your help, > > Best, > > Chris Willett > > here is a portion of the run log with some examples of the warnings: > > ------------------------------------------------------------ > # LSBATCH: User input > maker > ------------------------------------------------------------ > > Successfully completed. > > Resource usage summary: > > CPU time : 59.63 sec. > Total Requested Memory : 0.50 GB > Delta Memory : - > Max Processes : 7 > Max Threads : 8 > Run time : 47 sec. > Turnaround time : 55 sec. > > The output (if any) follows: > > STATUS: Parsing control files... > STATUS: Processing and indexing input FASTA files... > STATUS: Setting up database for any GFF3 input... > A data structure will be created for you at: > /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore > > To access files for individual sequences use the datastore index: > /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log > > STATUS: Now running MAKER... > examining contents of the fasta file and run log > > > > --Next Contig-- > > #--------------------------------------------------------------------- > Now starting the contig!! > SeqID: contig-dpp-500-500 > Length: 32156 > #--------------------------------------------------------------------- > > > setting up GFF3 output and fasta chunks > doing repeat masking > running repeat masker. > #--------- command -------------# > Widget::RepeatMasker: > cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 > #-------------------------------# > doing blastx repeats > formating database... > #--------- command -------------# > Widget::formater: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 > #-------------------------------# > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > running blast search. > #--------- command -------------# > Widget::blastx: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner > #-------------------------------# > deleted:0 hits > doing blastx repeats > formating database... > #--------- command -------------# > Widget::formater: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 > #-------------------------------# > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) > > (continues on as above but title lengths are different) > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > Research Associate Professor > Department of Biology > CB#3280 Coker Hall > University of North Carolina, Chapel Hill > Chapel Hill, NC, 27599-3280 > > Office: 2252 Genome Science Building > phone: > 919-843-8663 > fax: > 919-962-1625 > > http://labs.bio.unc.edu/Willett/ > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From isabel.marcelino.im at gmail.com Wed Aug 23 11:38:06 2017 From: isabel.marcelino.im at gmail.com (Isabel Marcelino) Date: Wed, 23 Aug 2017 10:38:06 -0700 (PDT) Subject: [maker-devel] Fwd: Errors with Blast engine and Fasta index In-Reply-To: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Message-ID: <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> Hi Daniel, Thank you for your feedback. In fact, my fasta entry is not empty (please see below). I even tried to reprocess the genome fasta file that I already processed using MAKER and it doesn't work either... Isabel (PS: I do not manage to "reply" your message but only "forward" it. I was wondering if there are any settings I should change? I participate in other google groups and I can "reply" to messages. Thanks for the help) (>NODE_1_length_465927_cov_94.9908 ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....) On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote: > > Hi Isabel, The warning is referring to an empty entry in one of the fasta > files (?Warning: Sequence contains no data?). This is probably in the > genome fasta file that you are trying to annotate. Can you check the fasta > entry ?NODE_1_length_465927_cov_94.9908?? > > ~Daniel > > > > On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: > > > ---------- Forwarded message ---------- > From: Isabel Marcelino > > Date: 23 August 2017 at 11:37 > Subject: Errors with Blast engine and Fasta index > To: maker... at googlegroups.com > > > Hello, > > I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) > running smoothly a few weeks ago and I could perform a de novo annotation > of one of my genome. In the meantime, I worked on other topics and, > yesterday, when I tried to annotate another genome, MAKER was not working. > The following message was appearing: > > BLAST engine error: Warning: Sequence contains no data > deleted:0 hits > stop here: NODE_1_length_465927_cov_94.9908 > ERROR: Fasta index error > at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 1095. > Process::MpiChunk::__ANON__() called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm > line 415 > eval {...} called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm > line 407 > Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 4224 > Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', > 'HASH(0x4cca458)', 3, 0) called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 341 > Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) > called at ../../bin/maker line 1614 > main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 > --> rank=2, hostname=SRV-WGS > ERROR: Failed while preparing masked sequence > ERROR: Chunk failed at level:3, tier_type:0 > FAILED CONTIG:NODE_1_length_465927_cov_94.9908 > > I tried to solve the problem (re-install Repeatmasker and blast, check > location of the several executables, check tmp folder, re-install MAKER, > etc) but still, I am not able to solve the problem. > Could you please help me out with this? Thank you so much. > > Cheers, > Isabel > > ************************************************* > Isabel MARCELINO, PhD > Unit? Environnement Sant? > Institut Pasteur de Guadeloupe > Morne Jolivi?re - B.P. 484 > 97183 LES ABYMES Cedex > Guadeloupe, FWI > > > > > Garanti > sans virus. www.avast.com > > _______________________________________________ > maker-devel mailing list > maker... at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 12:00:26 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:00:26 -0600 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Message-ID: It can also be that your temporary directory became full at one point or you set TMP= to a location that is not a local disk (i.e. set it to a network mounted storage location). The fasta index is based off of BerkleyDB which has issues if run of of network storage. In any case just restart, and it will probably get past the error on the retry. ?Carson > On Aug 23, 2017, at 10:57 AM, Ence,daniel wrote: > > Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? > > ~Daniel > > > >> On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: >> >> >> ---------- Forwarded message ---------- >> From: Isabel Marcelino > >> Date: 23 August 2017 at 11:37 >> Subject: Errors with Blast engine and Fasta index >> To: maker-devel at googlegroups.com >> >> >> Hello, >> >> I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. >> The following message was appearing: >> >> BLAST engine error: Warning: Sequence contains no data >> deleted:0 hits >> stop here: NODE_1_length_465927_cov_94.9908 >> ERROR: Fasta index error >> at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. >> Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 >> eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 >> Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 >> Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 >> Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 >> main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 >> --> rank=2, hostname=SRV-WGS >> ERROR: Failed while preparing masked sequence >> ERROR: Chunk failed at level:3, tier_type:0 >> FAILED CONTIG:NODE_1_length_465927_cov_94.9908 >> >> I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. >> Could you please help me out with this? Thank you so much. >> >> Cheers, >> Isabel >> >> ************************************************* >> Isabel MARCELINO, PhD >> Unit? Environnement Sant? >> Institut Pasteur de Guadeloupe >> Morne Jolivi?re - B.P. 484 >> 97183 LES ABYMES Cedex >> Guadeloupe, FWI >> >> >> >> Garanti sans virus. www.avast.com _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 11:57:30 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 11:57:30 -0600 Subject: [maker-devel] question about FASTA warnings In-Reply-To: References: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Message-ID: <725B8728-A7F7-4F60-80C7-D842240D67F9@gmail.com> They are warnings from makeblastdb. It depends on what version of BLAST you have installed. Either upgrade or downgrade to get them to go away. They are just warnings and not errors though, so you can safely ignore them. They are just really annoying. ?Carson > On Aug 23, 2017, at 10:47 AM, Daniel Ence wrote: > > Hi Chris, I haven?t seen that warning either in my usage of MAKER. My guess is that the version of Repeatmasker installed on your cluster has this warning and expects a certain format in the fasta headers. This could be checked by looking at the TE protein file that maker is using. Do you have access to that? > > In any case it probably isn?t an issue that needs to be fixed if the output otherwise looks good. > > ~Daniel > > > >> On Aug 23, 2017, at 12:26 PM, Willett, Christopher S > wrote: >> >> Hello- >> >> I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. >> >> Thanks for your help, >> >> Best, >> >> Chris Willett >> >> here is a portion of the run log with some examples of the warnings: >> >> ------------------------------------------------------------ >> # LSBATCH: User input >> maker >> ------------------------------------------------------------ >> >> Successfully completed. >> >> Resource usage summary: >> >> CPU time : 59.63 sec. >> Total Requested Memory : 0.50 GB >> Delta Memory : - >> Max Processes : 7 >> Max Threads : 8 >> Run time : 47 sec. >> Turnaround time : 55 sec. >> >> The output (if any) follows: >> >> STATUS: Parsing control files... >> STATUS: Processing and indexing input FASTA files... >> STATUS: Setting up database for any GFF3 input... >> A data structure will be created for you at: >> /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore >> >> To access files for individual sequences use the datastore index: >> /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log >> >> STATUS: Now running MAKER... >> examining contents of the fasta file and run log >> >> >> >> --Next Contig-- >> >> #--------------------------------------------------------------------- >> Now starting the contig!! >> SeqID: contig-dpp-500-500 >> Length: 32156 >> #--------------------------------------------------------------------- >> >> >> setting up GFF3 output and fasta chunks >> doing repeat masking >> running repeat masker. >> #--------- command -------------# >> Widget::RepeatMasker: >> cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 >> #-------------------------------# >> doing blastx repeats >> formating database... >> #--------- command -------------# >> Widget::formater: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 >> #-------------------------------# >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> running blast search. >> #--------- command -------------# >> Widget::blastx: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner >> #-------------------------------# >> deleted:0 hits >> doing blastx repeats >> formating database... >> #--------- command -------------# >> Widget::formater: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 >> #-------------------------------# >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) >> >> (continues on as above but title lengths are different) >> >> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ >> Research Associate Professor >> Department of Biology >> CB#3280 Coker Hall >> University of North Carolina, Chapel Hill >> Chapel Hill, NC, 27599-3280 >> >> Office: 2252 Genome Science Building >> phone: >> 919-843-8663 >> fax: >> 919-962-1625 >> >> http://labs.bio.unc.edu/Willett/ >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 12:10:44 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:10:44 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: > (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". > I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? Try Swiss-Prot. That is a well curated cross species set. > (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). > > In the file "maker_opts.ctl" > #-----Repeat Masking (leave values blank to skip repeat masking) > model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker > rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker Yes. Supply both. ?Carson -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Wed Aug 23 12:20:51 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Wed, 23 Aug 2017 18:20:51 +0000 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> Message-ID: Hi Isabel, if the issue isn?t with the fasta file itself, then I would look into the things that Carson suggested: out of memory issues on the disk where the TMP directory is located, etc. ~Daniel On Aug 23, 2017, at 1:38 PM, Isabel Marcelino > wrote: Hi Daniel, Thank you for your feedback. In fact, my fasta entry is not empty (please see below). I even tried to reprocess the genome fasta file that I already processed using MAKER and it doesn't work either... Isabel (PS: I do not manage to "reply" your message but only "forward" it. I was wondering if there are any settings I should change? I participate in other google groups and I can "reply" to messages. Thanks for the help) (>NODE_1_length_465927_cov_94.9908 ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....) On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote: Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? ~Daniel On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: ---------- Forwarded message ---------- From: Isabel Marcelino > Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker... at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI [https://lh6.googleusercontent.com/proxy/JjzEPM_1UQiAcgcIii9zH3waHJfrDmD6mwOpzjvKSWAzeFyvEmJKxjsfyB4-JKbN4o_rmMG0O6UuV95TfuAG3NaBCtKzucfHCUODobStNrGqQJzTwuEOKfxUSFySxNn_igewCYnfXbgJP-gAq2cupOvC=w5000-h5000] Garanti sans virus. www.avast.com _______________________________________________ maker-devel mailing list maker... at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 12:21:44 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:21:44 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> Message-ID: <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> > Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? We don?t have an externally editable wiki, but the mailing list is archived on google groups and is searchable. > As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). Related to this, I just got off of a conference call where we were looking at Augustus behavior, and a student did an experiment where they introduced early stop codons into 100 genes, then let Augustus predict again. 80% of the time Augustus altered splicing patterns to try and jump over the stop codon, 11% of the time it would truncate the transcript, and 9% of the time it would refuse to call anything. So when you see splicing errors, it is usually because something is affecting the ORF somewhere, so it alters splicing to extend the ORF to get the maximum scoring bonus by capturing downstream parts of features en hints > A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) MAKER only annotates tRNA?s and whatever snoscan annotates. It does not annotated any other non-coding features. ?Carson From carsonhh at gmail.com Wed Aug 23 12:25:24 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:25:24 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> Message-ID: Sorry 19,000 genes and not 100 genes in the Augustus test. ?Carson > On Aug 23, 2017, at 12:21 PM, Carson Holt wrote: > >> Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? > > We don?t have an externally editable wiki, but the mailing list is archived on google groups and is searchable. > > >> As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). > > Related to this, I just got off of a conference call where we were looking at Augustus behavior, and a student did an experiment where they introduced early stop codons into 100 genes, then let Augustus predict again. 80% of the time Augustus altered splicing patterns to try and jump over the stop codon, 11% of the time it would truncate the transcript, and 9% of the time it would refuse to call anything. So when you see splicing errors, it is usually because something is affecting the ORF somewhere, so it alters splicing to extend the ORF to get the maximum scoring bonus by capturing downstream parts of features en hints > > >> A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) > > MAKER only annotates tRNA?s and whatever snoscan annotates. It does not annotated any other non-coding features. > > ?Carson From eennadi at gmail.com Sun Aug 27 08:16:03 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Sun, 27 Aug 2017 15:16:03 +0100 Subject: [maker-devel] Maker not installing Message-ID: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 07:00:11 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 13:00:11 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: Message-ID: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 07:57:22 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 13:57:22 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Message-ID: <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? Thanks, Daniel Ence On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9 ============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 08:07:14 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 14:07:14 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Message-ID: <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: Hi Daniel The reply is emmannamekasMBP:maker emmannaemeka$ MAKER -ctl -bash: MAKER: command not found Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? Thanks, Daniel Ence On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9 ============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 07:24:58 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 14:24:58 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Message-ID: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: > Hi Emmanuel, In order for anyone to help you, you need post to the mailing > list the command and output (including errors) of the step that didn?t > work. > > Thanks, > Daniel Ence > > > On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: > > Hello all, > > I downloaded Maker and tried to install it. I succeeded in installing all > prerequisites however running maker ./build install, it showed that maker > installed. > > However trying to run maker it wouldn't run. > > Please how do I install maker to run on local computer? > > Thanks > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 08:00:04 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 15:00:04 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Message-ID: Hi Daniel The reply is emmannamekasMBP:maker emmannaemeka$ MAKER -ctl -bash: MAKER: command not found Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel wrote: > Hi, It looks like MAKER installed ok. What is the command that you used to > try to run MAKER? Can you show the result of running ?MAKER -ctl?? > > Thanks, > Daniel Ence > > > On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi wrote: > > Hi Ence, > Thanks for your reply, > > This is the step and error received > > emmannamekasMBP:src emmannaemeka$ ./build install > Installing MAKER... > Building MAKER > Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) > > The build status is > ============================================================================= > STATUS MAKER v2.31.9============================================================================== > PERL Dependencies: VERIFIED > External Programs: VERIFIED > External C Libraries: VERIFIED > MPI SUPPORT: DISABLED > MWAS Web Interface: DISABLED > MAKER PACKAGE: CONFIGURATION OK > > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: > >> Hi Emmanuel, In order for anyone to help you, you need post to the >> mailing list the command and output (including errors) of the step that >> didn?t work. >> >> Thanks, >> Daniel Ence >> >> >> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: >> >> Hello all, >> >> I downloaded Maker and tried to install it. I succeeded in installing all >> prerequisites however running maker ./build install, it showed that maker >> installed. >> >> However trying to run maker it wouldn't run. >> >> Please how do I install maker to run on local computer? >> >> Thanks >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/ >> profile/Emmanuel_Nnadi/publications >> >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 28 09:49:32 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 28 Aug 2017 09:49:32 -0600 Subject: [maker-devel] Maker not installing In-Reply-To: <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: After install the executables will be in the ?/maker/bin directory. Example (if you did the install in your home directory) ?> ~/maker/bin/maker You need to add the ?/maker/bin directory to your PATH for it to be found just by typing ?maker' Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html ?Carson > On Aug 28, 2017, at 8:07 AM, Ence,daniel wrote: > > Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? > > > >> On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: >> >> Hi Daniel >> The reply is >> emmannamekasMBP:maker emmannaemeka$ MAKER -ctl >> -bash: MAKER: command not found >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >> On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: >> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >> >> Thanks, >> Daniel Ence >> >> >>> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: >>> >>> Hi Ence, >>> Thanks for your reply, >>> >>> This is the step and error received >>> emmannamekasMBP:src emmannaemeka$ ./build install >>> Installing MAKER... >>> Building MAKER >>> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >>> >>> The build status is >>> >>> ============================================================================= >>> STATUS MAKER v2.31.9 >>> ============================================================================== >>> PERL Dependencies: VERIFIED >>> External Programs: VERIFIED >>> External C Libraries: VERIFIED >>> MPI SUPPORT: DISABLED >>> MWAS Web Interface: DISABLED >>> MAKER PACKAGE: CONFIGURATION OK >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: >>> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. >>> >>> Thanks, >>> Daniel Ence >>> >>> >>>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: >>>> >>>> Hello all, >>>> >>>> I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. >>>> >>>> However trying to run maker it wouldn't run. >>>> >>>> Please how do I install maker to run on local computer? >>>> >>>> Thanks >>>> >>>> Nnadi Nnaemeka Emmanuel >>>> Department of Microbiology, >>>> Faculty of Natural and Applied Science, >>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>> >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >> >> > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 11:32:40 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 18:32:40 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: Thanks I tried to export PATH running echo $PATH in the maker directory this returned /usr/bin:/bin:/usr/sbin:/sbin:/opt/X11/bin:/Users/emmannaemeka/Desktop/Gpm/maker/bin/maker 1. Does it mean that PATH has been exported? secondly, I tried to run the command maker -h, which maker, maker -CTL nothing returned. 2. how do i start up maker? 3. Do I need to be in maker directory to start maker? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 4:49 PM, Carson Holt wrote: > After install the executables will be in the ?/maker/bin directory. > Example (if you did the install in your home directory) ?> ~/maker/bin/maker > > You need to add the ?/maker/bin directory to your PATH for it to be found > just by typing ?maker' > > Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html > > ?Carson > > > On Aug 28, 2017, at 8:07 AM, Ence,daniel wrote: > > Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the > result of ?which maker?? > > > > On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi wrote: > > Hi Daniel > The reply is > emmannamekasMBP:maker emmannaemeka$ MAKER -ctl > -bash: MAKER: command not found > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel wrote: > >> Hi, It looks like MAKER installed ok. What is the command that you used >> to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >> >> Thanks, >> Daniel Ence >> >> >> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi wrote: >> >> Hi Ence, >> Thanks for your reply, >> >> This is the step and error received >> >> emmannamekasMBP:src emmannaemeka$ ./build install >> Installing MAKER... >> Building MAKER >> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >> >> The build status is >> ============================================================================= >> STATUS MAKER v2.31.9============================================================================== >> PERL Dependencies: VERIFIED >> External Programs: VERIFIED >> External C Libraries: VERIFIED >> MPI SUPPORT: DISABLED >> MWAS Web Interface: DISABLED >> MAKER PACKAGE: CONFIGURATION OK >> >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/ >> profile/Emmanuel_Nnadi/publications >> >> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: >> >>> Hi Emmanuel, In order for anyone to help you, you need post to the >>> mailing list the command and output (including errors) of the step that >>> didn?t work. >>> >>> Thanks, >>> Daniel Ence >>> >>> >>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: >>> >>> Hello all, >>> >>> I downloaded Maker and tried to install it. I succeeded in installing >>> all prerequisites however running maker ./build install, it showed that >>> maker installed. >>> >>> However trying to run maker it wouldn't run. >>> >>> Please how do I install maker to run on local computer? >>> >>> Thanks >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/ >>> profile/Emmanuel_Nnadi/publications >>> >>> >>> _______________________________________________ >>> maker-devel mailing list >>> maker-devel at box290.bluehost.com >>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >>> >> >> > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 28 11:36:51 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 28 Aug 2017 11:36:51 -0600 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: <8EAFE412-9EF7-4DB7-85A3-632BAC3372FD@gmail.com> Path needs to be a list of directories to search (you specified an executable location). So not this ?> /Users/emmannaemeka/Desktop/Gpm/maker/bin/maker Instead it needs to be this ?> /Users/emmannaemeka/Desktop/Gpm/maker/bin ?Carson > On Aug 28, 2017, at 11:32 AM, Emmanuel Nnadi > wrote: > > Thanks > > I tried to export PATH > > running > echo $PATH in the maker directory this returned > > /usr/bin:/bin:/usr/sbin:/sbin:/opt/X11/bin:/Users/emmannaemeka/Desktop/Gpm/maker/bin/maker > > 1. Does it mean that PATH has been exported? > > > secondly, > > I tried to run > the command maker -h, which maker, maker -CTL > > nothing returned. > > 2. how do i start up maker? > 3. Do I need to be in maker directory to start maker? > > Thanks > > > > > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications > On Mon, Aug 28, 2017 at 4:49 PM, Carson Holt > wrote: > After install the executables will be in the ?/maker/bin directory. Example (if you did the install in your home directory) ?> ~/maker/bin/maker > > You need to add the ?/maker/bin directory to your PATH for it to be found just by typing ?maker' > > Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html > > ?Carson > > >> On Aug 28, 2017, at 8:07 AM, Ence,daniel > wrote: >> >> Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? >> >> >> >>> On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: >>> >>> Hi Daniel >>> The reply is >>> emmannamekasMBP:maker emmannaemeka$ MAKER -ctl >>> -bash: MAKER: command not found >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>> On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: >>> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >>> >>> Thanks, >>> Daniel Ence >>> >>> >>>> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: >>>> >>>> Hi Ence, >>>> Thanks for your reply, >>>> >>>> This is the step and error received >>>> emmannamekasMBP:src emmannaemeka$ ./build install >>>> Installing MAKER... >>>> Building MAKER >>>> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >>>> >>>> The build status is >>>> >>>> ============================================================================= >>>> STATUS MAKER v2.31.9 >>>> ============================================================================== >>>> PERL Dependencies: VERIFIED >>>> External Programs: VERIFIED >>>> External C Libraries: VERIFIED >>>> MPI SUPPORT: DISABLED >>>> MWAS Web Interface: DISABLED >>>> MAKER PACKAGE: CONFIGURATION OK >>>> >>>> Nnadi Nnaemeka Emmanuel >>>> Department of Microbiology, >>>> Faculty of Natural and Applied Science, >>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: >>>> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. >>>> >>>> Thanks, >>>> Daniel Ence >>>> >>>> >>>>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: >>>>> >>>>> Hello all, >>>>> >>>>> I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. >>>>> >>>>> However trying to run maker it wouldn't run. >>>>> >>>>> Please how do I install maker to run on local computer? >>>>> >>>>> Thanks >>>>> >>>>> Nnadi Nnaemeka Emmanuel >>>>> Department of Microbiology, >>>>> Faculty of Natural and Applied Science, >>>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>>> >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>> >>> >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 30 08:01:02 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 30 Aug 2017 10:01:02 -0400 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: Dear Carson: Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? Thanks Best Quanwei 2017-08-23 14:10 GMT-04:00 Carson Holt : > > (1) For the predicted unknown (unclassified) repeat sequences (those in > Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were > searched against a transposase database (derived from RepeatMaske > r) and sequences matching transposase were > considered as transposons belonging to the relevant superfamily". > I wonder how to do this search. Annotate the "unknown" repeat sequences > using the Repeatmaker? Then what to do, if for an "unknown" repeat > sequence, only part of the sequence match the known repeat elements. > > > You can use RepBase match I guess, but I would not be overly worried about > classification. MAKER won?t use any classification info you give it. > > > (2) To exclude gene fragments, I need map the predicted repeat sequences > against a protein database, and then run the package "ProExcluder"*. * > Right? I wonder how to get such protein database. Since I am working on > a new rodent species, can I use all the rodent proteins from Uniprot (both > Swiss-Prot and TrEMBL)? > > > Try Swiss-Prot. That is a well curated cross species set. > > > (3) After I generate the species specific repeat library, do I still need > to select a model organism for RepBase masking (as shown below). > > In the file "maker_opts.ctl" > #-----Repeat Masking (leave values blank to skip repeat masking) > model_org=Mammalia #select a model organism for RepBase masking in > RepeatMasker > rmlib=myRepeat.fa #provide an organism specific repeat library in fasta > format for RepeatMasker > > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 30 08:21:15 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 30 Aug 2017 10:21:15 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> Message-ID: Dear Daniel: Thank you! I am running it on an unmasked genome. Just want to make sure it is the correct way. Have a nice day! Best Quanwei 2017-08-30 10:19 GMT-04:00 Daniel Ence : > Hi Quanwei, > > I think you should run it on an unmasked genome. I don?t think that > redundancy between repeat libraries will be an issue. > > Thanks, > Daniel > > > > On Aug 30, 2017, at 10:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the > species specific repeat library. I wonder whether I need to remove the > masked the regions by existing repeatMasker library, before I run > repeatModeler? I think there may be some redundancy if I run repeatModeler > directly on the genome and then use both existing repeatMasker library and > the repeatModeler library to mask the genome. Does it matter, if there is > such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt : > >> >> (1) For the predicted unknown (unclassified) repeat sequences (those in >> Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were >> searched against a transposase database (derived from RepeatMaske >> r) and sequences matching transposase were >> considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences >> using the Repeatmaker? Then what to do, if for an "unknown" repeat >> sequence, only part of the sequence match the known repeat elements. >> >> >> You can use RepBase match I guess, but I would not be overly worried >> about classification. MAKER won?t use any classification info you give it. >> >> >> (2) To exclude gene fragments, I need map the predicted repeat sequences >> against a protein database, and then run the package "ProExcluder"*. * >> Right? I wonder how to get such protein database. Since I am working on >> a new rodent species, can I use all the rodent proteins from Uniprot (both >> Swiss-Prot and TrEMBL)? >> >> >> Try Swiss-Prot. That is a well curated cross species set. >> >> >> (3) After I generate the species specific repeat library, do I still need >> to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in >> RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta >> format for RepeatMasker >> >> >> Yes. Supply both. >> >> >> ?Carson >> > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From lcampbell at ebi.ac.uk Wed Aug 30 03:41:48 2017 From: lcampbell at ebi.ac.uk (Lahcen Campbell) Date: Wed, 30 Aug 2017 10:41:48 +0100 Subject: [maker-devel] Processing contig output - MPI job fail Message-ID: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> Hello folks, Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) /............/ /clustering transcripts into genes for annotations// //Processing transcripts into genes// //adding statistics to annotations// //Calculating annotation quality statistics// //choosing best annotation set// //Choosing best annotations// //processing chunk output// //processing contig output/ However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. *_The following error output was captured_*/*_:_* / Calculating annotation quality statistics choosing best annotation set Choosing best annotations processing chunk output processing contig output [proxy:0:0 at loom7.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:0 at loom7.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:0 at loom7.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:4 at loom6.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [mpiexec at loom7.ebi.ac.uk] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting [mpiexec at loom7.ebi.ac.uk] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. Any hints or insight on this would be greatly appreciated. Thank you in advance, Lahcen EBI-Hinxton, UK. -------------- next part -------------- An HTML attachment was scrubbed... URL: From lahcencampbell at gmail.com Wed Aug 30 03:44:03 2017 From: lahcencampbell at gmail.com (lahcen campbell) Date: Wed, 30 Aug 2017 10:44:03 +0100 Subject: [maker-devel] Processing contig output - MPI job fail Message-ID: *REPOSTED UNDER CORRECTED SUBSCRIBED MEMBER EMAIL ACCOUNT.* Hello folks, Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) *............* *clustering transcripts into genes for annotations* *Processing transcripts into genes* *adding statistics to annotations* *Calculating annotation quality statistics* *choosing best annotation set* *Choosing best annotations* *processing chunk output* *processing contig output* However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. *The following error output was captured* *: * Calculating annotation quality statistics choosing best annotation set Choosing best annotations processing chunk output processing contig output [proxy:0:0 at loom7.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:0 at loom7.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:0 at loom7.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:4 at loom6.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [mpiexec at loom7.ebi.ac.uk] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting [mpiexec at loom7.ebi.ac.uk] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. Any hints or insight on this would be greatly appreciated. Thank you in advance, Lahcen EBI-Hinxton, UK. -- ========================================== > Dr. Lahcen Campbell < > Contact: lahcencampbell at gmail.com < > https://www.ebi.ac.uk/about/people/lahcen-campbell < ========================================== -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Wed Aug 30 08:19:13 2017 From: dandence at gmail.com (Daniel Ence) Date: Wed, 30 Aug 2017 10:19:13 -0400 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> Hi Quanwei, I think you should run it on an unmasked genome. I don?t think that redundancy between repeat libraries will be an issue. Thanks, Daniel > On Aug 30, 2017, at 10:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt >: > >> (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. > > You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > > >> (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? > > Try Swiss-Prot. That is a well curated cross species set. > > >> (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 30 08:53:48 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 30 Aug 2017 08:53:48 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: You don?t need to worry about redundancy. ?Carson > On Aug 30, 2017, at 8:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt >: > >> (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. > > You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > > >> (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? > > Try Swiss-Prot. That is a well curated cross species set. > > >> (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 30 08:55:02 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 30 Aug 2017 08:55:02 -0600 Subject: [maker-devel] Processing contig output - MPI job fail In-Reply-To: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> References: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> Message-ID: MAKER will start up where it left off as long as the settings are identical between runs. ?Carson > On Aug 30, 2017, at 3:41 AM, Lahcen Campbell wrote: > > Hello folks, > Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. > I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) > ............ > > clustering transcripts into genes for annotations > Processing transcripts into genes > adding statistics to annotations > Calculating annotation quality statistics > choosing best annotation set > Choosing best annotations > processing chunk output > processing contig output > > However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. > The following error output was captured: > > Calculating annotation quality statistics > choosing best annotation set > Choosing best annotations > processing chunk output > processing contig output > > [proxy:0:0 at loom7.ebi.ac.uk ] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:0 at loom7.ebi.ac.uk ] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:0 at loom7.ebi.ac.uk ] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:4 at loom6.ebi.ac.uk ] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:4 at loom6.ebi.ac.uk ] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:4 at loom6.ebi.ac.uk ] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [mpiexec at loom7.ebi.ac.uk ] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting > [mpiexec at loom7.ebi.ac.uk ] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion > [mpiexec at loom7.ebi.ac.uk ] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion > [mpiexec at loom7.ebi.ac.uk ] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion > > Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. > > Any hints or insight on this would be greatly appreciated. > > Thank you in advance, > > Lahcen > > EBI-Hinxton, UK. > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Tue Aug 1 07:32:44 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Tue, 1 Aug 2017 09:32:44 -0400 Subject: [maker-devel] Pseudogene identification In-Reply-To: References: Message-ID: Hi Carson: I took a look at the description about the pipe line of pseudogene identification. In my understanding it will use the annotated (predicted by Maker2) protein coding genes as input (i.e., query sequences), search in the intergenic spaces (so annotated genes will not be checked) and find the regions where show certain level of similarity to the annotated genes. If my understanding is correct, I think it is not what I want to do get. Based on the annotated coding genes from Maker2, we found some genes are under expansion in the new species. We want to check and make sure all the gene copies in the expanded gene family really function (to make sure they are not pseudogenes). Do you think the pseudogene identification pipe line of Maker2 can be helpful for my goal? Or do you have any suggestions on this? Many thanks Best Quanwei 2017-07-31 19:54 GMT-04:00 Carson Holt : > The MAKER-P fork was merged back into standard MAKER with version 2.29 > (roughly 3 years ago - a separate download no longer exists). This is > because MAKER-P?s functionality is almost entirely in accessory scripts and > written protocols. The ?/maker/bin/maker called by both MAKER2 and MAKER-P > is actually the same script. So no need to rerun, because if you are using > version 2.29 or later, you already ran it. > > Pseudogene calling is therefore handled by accessory scripts and protocols > you can find here ?> http://shiulab.plantbiology.msu.edu/wiki/ > index.php/Protocol:Pseudogene > > The other MAKER-P protocols can be found here ?> > http://www.yandell-lab.org/software/maker-p.html > > --Carson > > > > On Jul 31, 2017, at 5:02 PM, Quanwei Zhang wrote: > > Hello: > > We used Maker2 to annotate a new rodent genome. By using the annotated > genes we did gene family expansion analysis, and found several gene > families under expansion in the new rodent genome. But we want to check > whether some annotated genes are Pseudogenes, which lead to the expansion. > Do you have any suggestions on this? > > We found the Maker-P can annotate Pseudogene, but we are not sure whether > it is worth to repeat our annotation with Maker-P. Besides, we are not sure > whether the default parameters of Maker-P are good for a rodent species. > What's more, in my understanding the Maker-P will identify Pseudogenes in > the intergenic spaces (which I think the annotated coding genes will be not > be tested and checked). > > Do you have any suggestions to solve our problem? We do not want to > identify Pseudogene on the genome wide, but only want to check those genes > showing expansion (to make sure all those gene copies really function). > > Many thanks > > Best > Quanwei > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From nathan.ricks at gmail.com Tue Aug 1 15:51:25 2017 From: nathan.ricks at gmail.com (Nathan Ricks) Date: Tue, 1 Aug 2017 15:51:25 -0600 Subject: [maker-devel] Output of fasta_merge Message-ID: When I run the command fasta_merge it produces a number of different files: .all.maker.model_gff%3Amaker.proteins.fasta .all.maker.non_overlapping_ab_initio.proteins.fasta .all.maker.snap_masked.proteins.fasta .all.maker.proteins.fasta I was wondering what the difference between these files is Thank you for your time -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 1 15:58:36 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 1 Aug 2017 15:58:36 -0600 Subject: [maker-devel] Output of fasta_merge In-Reply-To: References: Message-ID: <3348C5BF-8342-4E2B-88BF-1AF4558D4169@gmail.com> From the list archives ?> https://groups.google.com/forum/#!searchin/maker-devel/output$20files%7Csort:relevance/maker-devel/43hN_LDQv6c/SWpyYejGiqcJ Also described in ?/maker/README under the "MAKER OUTPUT" section. ?Carson > On Aug 1, 2017, at 3:51 PM, Nathan Ricks wrote: > > When I run the command fasta_merge it produces a number of different files: > .all.maker.model_gff%3Amaker.proteins.fasta > .all.maker.non_overlapping_ab_initio.proteins.fasta > .all.maker.snap_masked.proteins.fasta > .all.maker.proteins.fasta > > I was wondering what the difference between these files is > Thank you for your time > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From nathan.ricks at gmail.com Wed Aug 2 15:33:35 2017 From: nathan.ricks at gmail.com (Nathan Ricks) Date: Wed, 2 Aug 2017 15:33:35 -0600 Subject: [maker-devel] (no subject) Message-ID: As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ -------------- next part -------------- An HTML attachment was scrubbed... URL: From cjfields at illinois.edu Thu Aug 3 09:14:06 2017 From: cjfields at illinois.edu (Fields, Christopher J) Date: Thu, 3 Aug 2017 15:14:06 +0000 Subject: [maker-devel] (no subject) In-Reply-To: References: Message-ID: If you have a fairly recent version of Bioperl (now at 1.7.1) this should not be an issue within bioperl (note this isn?t a bug per se, just that the default universal codon table has rare codons so we simply added a ?strict? alternative table). Also, based on that thread Carson also added a workaround in MAKER explicitly setting a ?strict? codon table that should be in 3.00. chris From: maker-devel on behalf of Nathan Ricks Date: Wednesday, August 2, 2017 at 9:54 PM To: "maker-devel at yandell-lab.org" Subject: [maker-devel] (no subject) As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Thu Aug 3 09:27:51 2017 From: carsonhh at gmail.com (Carson Holt) Date: Thu, 3 Aug 2017 09:27:51 -0600 Subject: [maker-devel] (no subject) In-Reply-To: References: Message-ID: <29E5FB26-0670-4EF1-A5E5-CB10EDC228BD@gmail.com> Correct. Current MAKER 2.31.9 AND 3.00 beta have the strict codon table workaround for BioPerl. MAKER?s default behavior is to use the same ORF given to it be the predictor and alter start codon if MAKER itself is able to add extra sequence that can extend the ORF during the UTR addition phase and find a start codon. But if you set alway_complete=1 in the options, it will walk upstream and downstream to find start/stop codons in the surrounding sequence even if it has to add sequence to the exons. Thanks, Carson > On Aug 3, 2017, at 9:14 AM, Fields, Christopher J wrote: > > If you have a fairly recent version of Bioperl (now at 1.7.1) this should not be an issue within bioperl (note this isn?t a bug per se, just that the default universal codon table has rare codons so we simply added a ?strict? alternative table). > > Also, based on that thread Carson also added a workaround in MAKER explicitly setting a ?strict? codon table that should be in 3.00. > > chris > > From: maker-devel > on behalf of Nathan Ricks > > Date: Wednesday, August 2, 2017 at 9:54 PM > To: "maker-devel at yandell-lab.org " > > Subject: [maker-devel] (no subject) > > As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? > I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 > > https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From jltan at mmu.edu.my Tue Aug 8 01:33:01 2017 From: jltan at mmu.edu.my (jltan at mmu.edu.my) Date: Tue, 8 Aug 2017 15:33:01 +0800 Subject: [maker-devel] Problem with MAKER installation Message-ID: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> Hi, I am installing MAKER to annotate a fungus genome. However, I experienced issue with "Argument "2.53_01" isn't numeric in numeric ge (>=) at /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . I aware that the issue arise because of the "_" in the "2.53_01" however I have no idea on how to solve it. Would you mind to give advice on this matter? Thank you. Best regards, Dr. Joon Liang Tan PhD, Bsc (Hons) Lecturer (Bioinformatics Programme) Faculty of Information Science and Technology (FIST) Multimedia University 75450 Melaka Malaysia Phone: +60 62524813 From patrick_michael.chiuco at upd.edu.ph Thu Aug 10 05:35:47 2017 From: patrick_michael.chiuco at upd.edu.ph (Patrick Michael Chiuco) Date: Thu, 10 Aug 2017 19:35:47 +0800 Subject: [maker-devel] split_fasta script In-Reply-To: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> References: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> Message-ID: <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> Hi! Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline [1] we're currently using. Thanks! Patrick Links: ------ [1] https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1426-6 -------------- next part -------------- An HTML attachment was scrubbed... URL: From zachary.pcohen at gmail.com Fri Aug 11 12:43:58 2017 From: zachary.pcohen at gmail.com (Zach Cohen) Date: Fri, 11 Aug 2017 18:43:58 +0000 Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Hello All, I'm receiving a RepeatMasker on some (not all) of my scaffolds. *Widget::RepeatMasker:* *cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2* *#-------------------------------#* *ERROR: RepeatMasker failed* *--> rank=NA, hostname=82853d8df2a5* *ERROR: Failed while doing repeat masking* *ERROR: Chunk failed at level:0, tier_type:1* FAILED CONTIG:scaffold2852_size18614 *ERROR: Chunk failed at level:2, tier_type:0* *FAILED CONTIG:scaffold2852_size18614* *examining contents of the fasta file and run log* I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! Best, Z -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Fri Aug 11 23:53:49 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 11 Aug 2017 23:53:49 -0600 Subject: [maker-devel] split_fasta script In-Reply-To: <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> References: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> Message-ID: <10D08630-4EA1-40EC-9939-0717E7F9BF25@gmail.com> split_fasta was deprecated quite a while ago (2010) and replaced by fasta_tool. I was able to find an old copy in the subversion repository, I can?t guarantee it will work as expected though with how much other libraries in maker have changed since then. ?Carson > On Aug 10, 2017, at 5:35 AM, Patrick Michael Chiuco wrote: > > > Hi! > > Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline we're currently using. Thanks! > > Patrick > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: split_fasta Type: application/octet-stream Size: 1405 bytes Desc: not available URL: -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Sat Aug 12 00:00:24 2017 From: carsonhh at gmail.com (Carson Holt) Date: Sat, 12 Aug 2017 00:00:24 -0600 Subject: [maker-devel] Problem with MAKER installation In-Reply-To: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> References: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> Message-ID: <71E16226-8E3D-4F68-9877-5D26B33B936D@gmail.com> You may need to reinstall your forks and forks::shared modules. If you use CPAN, you can use the ?force? option to do this. Also if forks is broken, other modules may be as well, so you may get another error in another module after the reinstall (then you will have to reinstall that module). This can possibly be caused by a processor version issue if this is a cluster with mixed architectures (old vs new Intel chips or AMD vs Intel), or it can be due to a system update breaking dynamically linked C libraries. ?Carson > On Aug 8, 2017, at 1:33 AM, jltan at mmu.edu.my wrote: > > Hi, > > I am installing MAKER to annotate a fungus genome. However, I experienced > issue with > "Argument "2.53_01" isn't numeric in numeric ge (>=) at > /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . > > I aware that the issue arise because of the "_" in the "2.53_01" however I > have no idea on how to solve it. > > Would you mind to give advice on this matter? > > Thank you. > > > > Best regards, > > Dr. Joon Liang Tan > PhD, Bsc (Hons) > Lecturer (Bioinformatics Programme) > Faculty of Information Science and Technology (FIST) > Multimedia University > 75450 Melaka > Malaysia > Phone: +60 62524813 > > > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org From carsonhh at gmail.com Mon Aug 14 11:30:33 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 14 Aug 2017 11:30:33 -0600 Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly In-Reply-To: References: Message-ID: If running under MPI, you can get messages from multiple processes (slightly out of order), in which case the more descript cause of the error may be further upstream in the STDERR log. If running without MPI, and the error you see is matched with the Widget::RepeatMasker command used, then you can simply copy it and run it outside of MAKER. If there are installation issues with your RepeatMasker copy then the cause will become more apparent. i.e. Run the command by itself ?> /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 ?Carson > On Aug 11, 2017, at 12:43 PM, Zach Cohen wrote: > > Hello All, > I'm receiving a RepeatMasker on some (not all) of my scaffolds. > Widget::RepeatMasker: > > cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 > > #-------------------------------# > > ERROR: RepeatMasker failed > > --> rank=NA, hostname=82853d8df2a5 > > ERROR: Failed while doing repeat masking > > ERROR: Chunk failed at level:0, tier_type:1 > > FAILED CONTIG:scaffold2852_size18614 > > ERROR: Chunk failed at level:2, tier_type:0 > > FAILED CONTIG:scaffold2852_size18614 > > examining contents of the fasta file and run log > > > > I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! > > Best, > > Z > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Mon Aug 14 12:59:16 2017 From: chzelin at gmail.com (zl c) Date: Mon, 14 Aug 2017 14:59:16 -0400 Subject: [maker-devel] maker MPI problem Message-ID: Hello, I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? CMD: export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so export OMPI_MCA_mpi_warn_on_fork=0 mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] Ph.D. NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: run05.mpi.o47346077 Type: application/octet-stream Size: 60803 bytes Desc: not available URL: From chzelin at gmail.com Mon Aug 14 13:11:01 2017 From: chzelin at gmail.com (zl c) Date: Mon, 14 Aug 2017 15:11:01 -0400 Subject: [maker-devel] maker problem large number of files Message-ID: Hello, Besides, Maker produces large number of temporary files. Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 14 13:18:22 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 14 Aug 2017 13:18:22 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: Message-ID: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> This is rather vague ?> ?crashed the computer cluster? Do you have a specific error? ?Carson > On Aug 14, 2017, at 12:59 PM, zl c wrote: > > Hello, > > > I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? > > > CMD: > > export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so > > export OMPI_MCA_mpi_warn_on_fork=0 > > mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta > > > Thanks, > > Zelin Chen > > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] Ph.D. > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From alyce.fowler at bayer.com Mon Aug 14 13:20:55 2017 From: alyce.fowler at bayer.com (Alyce Fowler) Date: Mon, 14 Aug 2017 19:20:55 +0000 Subject: [maker-devel] unsubscribe Message-ID: -----Original Message----- From: maker-devel [mailto:maker-devel-bounces at yandell-lab.org] On Behalf Of maker-devel-request at yandell-lab.org Sent: Monday, August 14, 2017 1:31 PM To: maker-devel at yandell-lab.org Subject: maker-devel Digest, Vol 111, Issue 3 Send maker-devel mailing list submissions to maker-devel at yandell-lab.org To subscribe or unsubscribe via the World Wide Web, visit http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org or, via email, send a message with subject or body 'help' to maker-devel-request at yandell-lab.org You can reach the person managing the list at maker-devel-owner at yandell-lab.org When replying, please edit your Subject line so it is more specific than "Re: Contents of maker-devel digest..." Today's Topics: 1. Problem with MAKER installation (jltan at mmu.edu.my) 2. split_fasta script (Patrick Michael Chiuco) 3. Inconsistent RepeatMasker error on draft assembly (Zach Cohen) 4. Re: split_fasta script (Carson Holt) 5. Re: Problem with MAKER installation (Carson Holt) 6. Re: Inconsistent RepeatMasker error on draft assembly (Carson Holt) ---------------------------------------------------------------------- Message: 1 Date: Tue, 8 Aug 2017 15:33:01 +0800 From: jltan at mmu.edu.my To: maker-devel at yandell-lab.org Subject: [maker-devel] Problem with MAKER installation Message-ID: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel at mlkstf.mmu.edu.my> Content-Type: text/plain;charset=iso-8859-1 Hi, I am installing MAKER to annotate a fungus genome. However, I experienced issue with "Argument "2.53_01" isn't numeric in numeric ge (>=) at /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . I aware that the issue arise because of the "_" in the "2.53_01" however I have no idea on how to solve it. Would you mind to give advice on this matter? Thank you. Best regards, Dr. Joon Liang Tan PhD, Bsc (Hons) Lecturer (Bioinformatics Programme) Faculty of Information Science and Technology (FIST) Multimedia University 75450 Melaka Malaysia Phone: +60 62524813 ------------------------------ Message: 2 Date: Thu, 10 Aug 2017 19:35:47 +0800 From: Patrick Michael Chiuco To: maker-devel at yandell-lab.org Subject: [maker-devel] split_fasta script Message-ID: <56824384580b99132afdba6167d0d0b0 at smicro00.upd.edu.ph> Content-Type: text/plain; charset="utf-8" Hi! Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline [1] we're currently using. Thanks! Patrick Links: ------ [1] https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1426-6 -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 3 Date: Fri, 11 Aug 2017 18:43:58 +0000 From: Zach Cohen To: maker-devel at yandell-lab.org Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Content-Type: text/plain; charset="utf-8" Hello All, I'm receiving a RepeatMasker on some (not all) of my scaffolds. *Widget::RepeatMasker:* *cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2* *#-------------------------------#* *ERROR: RepeatMasker failed* *--> rank=NA, hostname=82853d8df2a5* *ERROR: Failed while doing repeat masking* *ERROR: Chunk failed at level:0, tier_type:1* FAILED CONTIG:scaffold2852_size18614 *ERROR: Chunk failed at level:2, tier_type:0* *FAILED CONTIG:scaffold2852_size18614* *examining contents of the fasta file and run log* I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! Best, Z -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 4 Date: Fri, 11 Aug 2017 23:53:49 -0600 From: Carson Holt To: Patrick Michael Chiuco Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] split_fasta script Message-ID: <10D08630-4EA1-40EC-9939-0717E7F9BF25 at gmail.com> Content-Type: text/plain; charset="utf-8" split_fasta was deprecated quite a while ago (2010) and replaced by fasta_tool. I was able to find an old copy in the subversion repository, I can?t guarantee it will work as expected though with how much other libraries in maker have changed since then. ?Carson > On Aug 10, 2017, at 5:35 AM, Patrick Michael Chiuco wrote: > > > Hi! > > Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline we're currently using. Thanks! > > Patrick > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: split_fasta Type: application/octet-stream Size: 1405 bytes Desc: not available URL: -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 5 Date: Sat, 12 Aug 2017 00:00:24 -0600 From: Carson Holt To: jltan at mmu.edu.my Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] Problem with MAKER installation Message-ID: <71E16226-8E3D-4F68-9877-5D26B33B936D at gmail.com> Content-Type: text/plain; charset=utf-8 You may need to reinstall your forks and forks::shared modules. If you use CPAN, you can use the ?force? option to do this. Also if forks is broken, other modules may be as well, so you may get another error in another module after the reinstall (then you will have to reinstall that module). This can possibly be caused by a processor version issue if this is a cluster with mixed architectures (old vs new Intel chips or AMD vs Intel), or it can be due to a system update breaking dynamically linked C libraries. ?Carson > On Aug 8, 2017, at 1:33 AM, jltan at mmu.edu.my wrote: > > Hi, > > I am installing MAKER to annotate a fungus genome. However, I experienced > issue with > "Argument "2.53_01" isn't numeric in numeric ge (>=) at > /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . > > I aware that the issue arise because of the "_" in the "2.53_01" however I > have no idea on how to solve it. > > Would you mind to give advice on this matter? > > Thank you. > > > > Best regards, > > Dr. Joon Liang Tan > PhD, Bsc (Hons) > Lecturer (Bioinformatics Programme) > Faculty of Information Science and Technology (FIST) > Multimedia University > 75450 Melaka > Malaysia > Phone: +60 62524813 > > > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org ------------------------------ Message: 6 Date: Mon, 14 Aug 2017 11:30:33 -0600 From: Carson Holt To: Zach Cohen Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Content-Type: text/plain; charset="utf-8" If running under MPI, you can get messages from multiple processes (slightly out of order), in which case the more descript cause of the error may be further upstream in the STDERR log. If running without MPI, and the error you see is matched with the Widget::RepeatMasker command used, then you can simply copy it and run it outside of MAKER. If there are installation issues with your RepeatMasker copy then the cause will become more apparent. i.e. Run the command by itself ?> /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 ?Carson > On Aug 11, 2017, at 12:43 PM, Zach Cohen wrote: > > Hello All, > I'm receiving a RepeatMasker on some (not all) of my scaffolds. > Widget::RepeatMasker: > > cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 > > #-------------------------------# > > ERROR: RepeatMasker failed > > --> rank=NA, hostname=82853d8df2a5 > > ERROR: Failed while doing repeat masking > > ERROR: Chunk failed at level:0, tier_type:1 > > FAILED CONTIG:scaffold2852_size18614 > > ERROR: Chunk failed at level:2, tier_type:0 > > FAILED CONTIG:scaffold2852_size18614 > > examining contents of the fasta file and run log > > > > I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! > > Best, > > Z > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Subject: Digest Footer _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org ------------------------------ End of maker-devel Digest, Vol 111, Issue 3 ******************************************* ________________________________________________________________________ The information contained in this e-mail is for the exclusive use of the intended recipient(s) and may be confidential, proprietary, and/or legally privileged. Inadvertent disclosure of this message does not constitute a waiver of any privilege. If you receive this message in error, please do not directly or indirectly use, print, copy, forward, or disclose any part of this message. Please also delete this e-mail and all copies and notify the sender. Thank you. ________________________________________________________________________ From cjfields at illinois.edu Mon Aug 14 19:23:07 2017 From: cjfields at illinois.edu (Fields, Christopher J) Date: Tue, 15 Aug 2017 01:23:07 +0000 Subject: [maker-devel] maker MPI problem In-Reply-To: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: Carson, It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. chris From: maker-devel on behalf of Carson Holt Date: Monday, August 14, 2017 at 2:18 PM To: zl c Cc: "maker-devel at yandell-lab.org" Subject: Re: [maker-devel] maker MPI problem This is rather vague ?> ?crashed the computer cluster? Do you have a specific error? ?Carson On Aug 14, 2017, at 12:59 PM, zl c > wrote: Hello, I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? CMD: export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so export OMPI_MCA_mpi_warn_on_fork=0 mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] Ph.D. NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 08:33:37 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 08:33:37 -0600 Subject: [maker-devel] Fwd: maker MPI problem References: Message-ID: <4D7D32B5-58F4-401D-83EC-A1B38E0DCF09@gmail.com> Just forwarding this to the list. --Carson > From: Carson Holt > Date: August 14, 2017 at 2:00:11 PM MDT > To: zl c > Subject: Re: [maker-devel] maker MPI problem > > Yes. You can delete them. > > Also I notice this library being mentioned in the segfault ?> libpthread.so > > MAKER doesn?t use pthreads, so I?m surprised it?s showing up in an error. You could try installing a separate version of perl without pthread support and running MAKER with that (pthreads is optional for perl). It may remove an OpenMPI/perl incompatibility happening on your system. > > ?Carson > > >> On Aug 14, 2017, at 1:50 PM, zl c wrote: >> >> Maker dies. >> >> I've set LD_PRELOAD before install. >> >> I'll try the option. >> >> Can I remove the .NFS files before rerunning? >> >> Thanks, >> Zelin >> >> >> >>> On Mon, Aug 14, 2017 at 3:35 PM, Carson Holt wrote: >>> Is the issue that your cluster dies or that MAKER dies? (i.e. I want to know if this is an issue with your cluster or just an issue running MAKER) >>> >>> I see in the file that you are getting segfaults which should not crash the cluster but would kill maker. They would indicate either an installation problem, or just a command configuration option. >>> >>> You may need to recompile while the LD_PRELOAD value is set (it must be set during MAKER install and whenever you run with OpenMPI). Or you may still have the native infiniband communication active (causes segfaults with system calls). >>> >>> You can try this (to do ip over infiiniband instead, worls only if ib0 exists or set it to eth0 if eth0 exists) ?> '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0' >>> >>> That would replace the '-mca btl ^openib' >>> >>> Also make sure you can run maker on a single node under MPI before trying to work across nodes, then try on two nodes for your first test. >>> >>> The NFSLock files are file locks that are not cleaned up on a hard failure. >>> >>> ?Carson >>> >>> >>> >>> >>> >>>> On Aug 14, 2017, at 1:22 PM, zl c wrote: >>>> >>>> It's in the attached file. >>>> >>>> Beside, I see there are lots of .NFS... files.like: >>>> .NFSLock..NFSLock.genomedb.NFSLock.share.tmp.2247.26272.7466.34069868502337 >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>>> On Mon, Aug 14, 2017 at 3:18 PM, Carson Holt wrote: >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> Do you have a specific error? >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>>> >>>>>> Hello, >>>>>> >>>>>> >>>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>>> >>>>>> >>>>>> CMD: >>>>>> >>>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>>> >>>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>>> >>>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>>> >>>>>> >>>>>> Thanks, >>>>>> >>>>>> Zelin Chen >>>>>> >>>>>> >>>>>> -------------------------------------------- >>>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>>> >>>>>> NIH/NHGRI >>>>>> Building 50, Room 5531 >>>>>> 50 SOUTH DR, MSC 8004 >>>>>> BETHESDA, MD 20892-8004 >>>>>> _______________________________________________ >>>>>> maker-devel mailing list >>>>>> maker-devel at box290.bluehost.com >>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>> >>>> >>>> >>> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 08:39:35 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 08:39:35 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? --Carson Sent from my iPhone > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > Configuring MAKER with MPI support > Installing MAKER... > Configuring MAKER with MPI support > Subroutine dl_load_flags redefined at (eval 125) line 8. > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J wrote: >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >> >> >> >> chris >> >> >> >> From: maker-devel on behalf of Carson Holt >> Date: Monday, August 14, 2017 at 2:18 PM >> To: zl c >> Cc: "maker-devel at yandell-lab.org" >> Subject: Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Mon Aug 14 13:21:21 2017 From: dandence at gmail.com (Daniel Ence) Date: Mon, 14 Aug 2017 15:21:21 -0400 Subject: [maker-devel] maker problem large number of files In-Reply-To: References: Message-ID: <12B2834F-CC76-45BA-981B-4712982C9482@gmail.com> Hi Zelin, The large number of temporary files is part of the normal behavior for maker. After MAKER has finished, the only output files you really need are the fasta files of the annotated protein and transcript sequences and the gff file. The full maker output facilitates rerunning in the case of failure or trying out different parameters, which is sometimes a good reason for keeping the full output. ~Daniel > On Aug 14, 2017, at 3:11 PM, zl c wrote: > > Hello, > > Besides, Maker produces large number of temporary files. > > Thanks, > Zelin Chen > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 08:27:21 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 10:27:21 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: When I installed by './Build install', I got following some messages: Configuring MAKER with MPI support Installing MAKER... Configuring MAKER with MPI support Subroutine dl_load_flags redefined at (eval 125) line 8. Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. I'm not sure whether it's correctly installed. Thanks, -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < cjfields at illinois.edu> wrote: > Carson, > > > > It was attached to the initial message (named ?run05.mpi.o47346077?). It > looks like a Perl issue with threads, though I don?t see why this would > crash a cluster. The fact there is a log file would suggest it just ended > the job. > > > > chris > > > > *From: *maker-devel on behalf of > Carson Holt > *Date: *Monday, August 14, 2017 at 2:18 PM > *To: *zl c > *Cc: *"maker-devel at yandell-lab.org" > *Subject: *Re: [maker-devel] maker MPI problem > > > > This is rather vague ?> ?crashed the computer cluster? > > > > Do you have a specific error? > > > > ?Carson > > > > > > > > On Aug 14, 2017, at 12:59 PM, zl c wrote: > > > > Hello, > > > > I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I > attached the log file. Could you help me to solve the problem? > > > > CMD: > > export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so > > export OMPI_MCA_mpi_warn_on_fork=0 > > mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g > genome.fasta > > > > Thanks, > > Zelin Chen > > > > -------------------------------------------- > > Zelin Chen [chzelin at gmail.com] Ph.D. > > > > NIH/NHGRI > > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 09:30:48 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 11:30:48 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: The other option doesn't work. I reinstall it with a perl without multiple threads. Now it's building the blast database. -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > You may need to delete the .../maker/perl directory before doing the > reinstall if not doing a brand new installation. Otherwise you can ignore > the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for > MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > > Configuring MAKER with MPI support > > Installing MAKER... > > Configuring MAKER with MPI support > > Subroutine dl_load_flags redefined at (eval 125) line 8. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at > (eval 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) > line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < > cjfields at illinois.edu> wrote: > >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It >> looks like a Perl issue with threads, though I don?t see why this would >> crash a cluster. The fact there is a log file would suggest it just ended >> the job. >> >> >> >> chris >> >> >> >> *From: *maker-devel on behalf of >> Carson Holt >> *Date: *Monday, August 14, 2017 at 2:18 PM >> *To: *zl c >> *Cc: *"maker-devel at yandell-lab.org" >> *Subject: *Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I >> attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >> genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 09:34:32 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 11:34:32 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: Here are some latest message: [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > You may need to delete the .../maker/perl directory before doing the > reinstall if not doing a brand new installation. Otherwise you can ignore > the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for > MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > > Configuring MAKER with MPI support > > Installing MAKER... > > Configuring MAKER with MPI support > > Subroutine dl_load_flags redefined at (eval 125) line 8. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at > (eval 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) > line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < > cjfields at illinois.edu> wrote: > >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It >> looks like a Perl issue with threads, though I don?t see why this would >> crash a cluster. The fact there is a log file would suggest it just ended >> the job. >> >> >> >> chris >> >> >> >> *From: *maker-devel on behalf of >> Carson Holt >> *Date: *Monday, August 14, 2017 at 2:18 PM >> *To: *zl c >> *Cc: *"maker-devel at yandell-lab.org" >> *Subject: *Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I >> attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >> genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 09:47:04 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 09:47:04 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Did it die or did you just get a warning? Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. #add if MPI not using all CPU given --oversubscribe --bind-to none #workaround for infinaband (use instead of --mca ^openib) --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 #add to stop certain other warnings --mca orte_base_help_aggregate 0 #stop fork warnings --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 ?Carson > On Aug 15, 2017, at 9:34 AM, zl c wrote: > > Here are some latest message: > > [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork > [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > > > On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: > You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c > wrote: > >> When I installed by './Build install', I got following some messages: >> Configuring MAKER with MPI support >> Installing MAKER... >> Configuring MAKER with MPI support >> Subroutine dl_load_flags redefined at (eval 125) line 8. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >> >> I'm not sure whether it's correctly installed. >> >> Thanks, >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >> >> >> >> chris >> >> >> >> From: maker-devel > on behalf of Carson Holt > >> Date: Monday, August 14, 2017 at 2:18 PM >> To: zl c > >> Cc: "maker-devel at yandell-lab.org " > >> Subject: Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com ] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 14:50:05 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 14:50:05 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Message-ID: <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? --Carson Sent from my iPhone > On Aug 15, 2017, at 2:47 PM, zl c wrote: > > Hi Carson, Christopher, Daniel, > > Thank you for your kind help. > > Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? > > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: >>>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>>> >>>>> When I installed by './Build install', I got following some messages: >>>>> Configuring MAKER with MPI support >>>>> Installing MAKER... >>>>> Configuring MAKER with MPI support >>>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>>> >>>>> I'm not sure whether it's correctly installed. >>>>> >>>>> Thanks, >>>>> >>>>> -------------------------------------------- >>>>> Zelin Chen [chzelin at gmail.com] >>>>> >>>>> NIH/NHGRI >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J wrote: >>>>>> Carson, >>>>>> >>>>>> >>>>>> >>>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>>>> >>>>>> >>>>>> >>>>>> chris >>>>>> >>>>>> >>>>>> >>>>>> From: maker-devel on behalf of Carson Holt >>>>>> Date: Monday, August 14, 2017 at 2:18 PM >>>>>> To: zl c >>>>>> Cc: "maker-devel at yandell-lab.org" >>>>>> Subject: Re: [maker-devel] maker MPI problem >>>>>> >>>>>> >>>>>> >>>>>> This is rather vague ?> ?crashed the computer cluster? >>>>>> >>>>>> >>>>>> >>>>>> Do you have a specific error? >>>>>> >>>>>> >>>>>> >>>>>> ?Carson >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>>> >>>>>> >>>>>> >>>>>> Hello, >>>>>> >>>>>> >>>>>> >>>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>>> >>>>>> >>>>>> >>>>>> CMD: >>>>>> >>>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>>> >>>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>>> >>>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>>> >>>>>> >>>>>> >>>>>> Thanks, >>>>>> >>>>>> Zelin Chen >>>>>> >>>>>> >>>>>> >>>>>> -------------------------------------------- >>>>>> >>>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>>> >>>>>> >>>>>> >>>>>> NIH/NHGRI >>>>>> >>>>>> Building 50, Room 5531 >>>>>> 50 SOUTH DR, MSC 8004 >>>>>> BETHESDA, MD 20892-8004 >>>>>> >>>>>> _______________________________________________ >>>>>> maker-devel mailing list >>>>>> maker-devel at box290.bluehost.com >>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>> >>>>>> >>>>>> >>>>> >>> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 14:47:14 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 16:47:14 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Message-ID: Hi Carson, Christopher, Daniel, Thank you for your kind help. Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? Zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: > Did it die or did you just get a warning? > > Here is a list of flags to add that suppress warnings and other issues > with OpenMPI. You can add them all or one at a time depending on issues you > get. > > #add if MPI not using all CPU given > --oversubscribe --bind-to none > > #workaround for infinaband (use instead of --mca ^openib) > --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 > > #add to stop certain other warnings > --mca orte_base_help_aggregate 0 > > #stop fork warnings > --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 > > ?Carson > > > > On Aug 15, 2017, at 9:34 AM, zl c wrote: > > Here are some latest message: > > [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt > / opal_init:warn-fork > [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see > all help / error messages > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > > On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > >> You may need to delete the .../maker/perl directory before doing the >> reinstall if not doing a brand new installation. Otherwise you can ignore >> the subroutine redefined warnings during compile. >> >> Have you been able to test the alternate flags on the command line for >> MPI? How about an alternate perl without threads? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 8:27 AM, zl c wrote: >> >> When I installed by './Build install', I got following some messages: >> Configuring MAKER with MPI support >> Installing MAKER... >> Configuring MAKER with MPI support >> Subroutine dl_load_flags redefined at (eval 125) line 8. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) >> line 9. >> >> I'm not sure whether it's correctly installed. >> >> Thanks, >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >> cjfields at illinois.edu> wrote: >> >>> Carson, >>> >>> >>> >>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>> It looks like a Perl issue with threads, though I don?t see why this would >>> crash a cluster. The fact there is a log file would suggest it just ended >>> the job. >>> >>> >>> >>> chris >>> >>> >>> >>> *From: *maker-devel on behalf of >>> Carson Holt >>> *Date: *Monday, August 14, 2017 at 2:18 PM >>> *To: *zl c >>> *Cc: *"maker-devel at yandell-lab.org" >>> *Subject: *Re: [maker-devel] maker MPI problem >>> >>> >>> >>> This is rather vague ?> ?crashed the computer cluster? >>> >>> >>> >>> Do you have a specific error? >>> >>> >>> >>> ?Carson >>> >>> >>> >>> >>> >>> >>> >>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>> >>> >>> >>> Hello, >>> >>> >>> >>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. >>> I attached the log file. Could you help me to solve the problem? >>> >>> >>> >>> CMD: >>> >>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>> >>> export OMPI_MCA_mpi_warn_on_fork=0 >>> >>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>> genome.fasta >>> >>> >>> >>> Thanks, >>> >>> Zelin Chen >>> >>> >>> >>> -------------------------------------------- >>> >>> Zelin Chen [chzelin at gmail.com] Ph.D. >>> >>> >>> >>> NIH/NHGRI >>> >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> _______________________________________________ >>> maker-devel mailing list >>> maker-devel at box290.bluehost.com >>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >>> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 15:13:04 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 15:13:04 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: Some notes: First, the mpiexec command still needs the --mca parameters (either '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0?). Otherwise if you have infiniband on the nodes it will try and use OpenFabrics compatible libraries which will kill code doing system calls (like MAKER does). Second, try using a higher count than 2 in your batch. One process is always sacrificed by maker to act only for message management among processes, so with -n 2, you have one process working and one managing data. So only one contig will run at a time. If you set it to a higher number the issue will go away. The message manger process starts to get saturated at ~200 CPUs, so anything above that processor count becomes less beneficial to the job. Thanks, Carson > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt > wrote: > What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 2:47 PM, zl c > wrote: > >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt > wrote: >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >>> On Aug 15, 2017, at 9:34 AM, zl c > wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com ] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: >>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>> >>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>> >>> --Carson >>> >>> Sent from my iPhone >>> >>> On Aug 15, 2017, at 8:27 AM, zl c > wrote: >>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com ] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >>>> Carson, >>>> >>>> >>>> >>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>> >>>> >>>> >>>> chris >>>> >>>> >>>> >>>> From: maker-devel > on behalf of Carson Holt > >>>> Date: Monday, August 14, 2017 at 2:18 PM >>>> To: zl c > >>>> Cc: "maker-devel at yandell-lab.org " > >>>> Subject: Re: [maker-devel] maker MPI problem >>>> >>>> >>>> >>>> This is rather vague ?> ?crashed the computer cluster? >>>> >>>> >>>> >>>> Do you have a specific error? >>>> >>>> >>>> >>>> ?Carson >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >>>> >>>> >>>> >>>> Hello, >>>> >>>> >>>> >>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>> >>>> >>>> >>>> CMD: >>>> >>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>> >>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>> >>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>> >>>> >>>> >>>> Thanks, >>>> >>>> Zelin Chen >>>> >>>> >>>> >>>> -------------------------------------------- >>>> >>>> Zelin Chen [chzelin at gmail.com ] Ph.D. >>>> >>>> >>>> >>>> NIH/NHGRI >>>> >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>>> >>> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 15:05:18 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 17:05:18 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: I submit a job: sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh CMD in run06.maker.mpi.sh mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta Another question: How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. Thanks, zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > What is your command line? Are you running interactively or as a submitted > batch? If it's a batch job what options did you give it? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 2:47 PM, zl c wrote: > > Hi Carson, Christopher, Daniel, > > Thank you for your kind help. > > Now it works without any other options on one nodes and 4 CPUs. I set the > number of task to 2, but there's only one contigs in running. Should it be > two contigs running at the same time? > > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: > >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues >> with OpenMPI. You can add them all or one at a time depending on issues you >> get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >> On Aug 15, 2017, at 9:34 AM, zl c wrote: >> >> Here are some latest message: >> >> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt >> / opal_init:warn-fork >> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >> all help / error messages >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> >> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: >> >>> You may need to delete the .../maker/perl directory before doing the >>> reinstall if not doing a brand new installation. Otherwise you can ignore >>> the subroutine redefined warnings during compile. >>> >>> Have you been able to test the alternate flags on the command line for >>> MPI? How about an alternate perl without threads? >>> >>> --Carson >>> >>> Sent from my iPhone >>> >>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>> >>> When I installed by './Build install', I got following some messages: >>> Configuring MAKER with MPI support >>> Installing MAKER... >>> Configuring MAKER with MPI support >>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) >>> line 9. >>> >>> I'm not sure whether it's correctly installed. >>> >>> Thanks, >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> NIH/NHGRI >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>> cjfields at illinois.edu> wrote: >>> >>>> Carson, >>>> >>>> >>>> >>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>> It looks like a Perl issue with threads, though I don?t see why this would >>>> crash a cluster. The fact there is a log file would suggest it just ended >>>> the job. >>>> >>>> >>>> >>>> chris >>>> >>>> >>>> >>>> *From: *maker-devel on behalf of >>>> Carson Holt >>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>> *To: *zl c >>>> *Cc: *"maker-devel at yandell-lab.org" >>>> *Subject: *Re: [maker-devel] maker MPI problem >>>> >>>> >>>> >>>> This is rather vague ?> ?crashed the computer cluster? >>>> >>>> >>>> >>>> Do you have a specific error? >>>> >>>> >>>> >>>> ?Carson >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>> >>>> >>>> >>>> Hello, >>>> >>>> >>>> >>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. >>>> I attached the log file. Could you help me to solve the problem? >>>> >>>> >>>> >>>> CMD: >>>> >>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>> >>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>> >>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>> genome.fasta >>>> >>>> >>>> >>>> Thanks, >>>> >>>> Zelin Chen >>>> >>>> >>>> >>>> -------------------------------------------- >>>> >>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>> >>>> >>>> >>>> NIH/NHGRI >>>> >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>>> >>> >>> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 15:17:20 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 17:17:20 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: This is a test run, so I use only 2 tasks. I'll try more tasks and your options. Thanks, Zelin On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either > '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include > ib0?). Otherwise if you have infiniband on the nodes it will try and use > OpenFabrics compatible libraries which will kill code doing system calls > (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is > always sacrificed by maker to act only for message management among > processes, so with -n 2, you have one process working and one managing > data. So only one contig will run at a time. If you set it to a higher > number the issue will go away. The message manger process starts to get > saturated at ~200 CPUs, so anything above that processor count becomes less > beneficial to the job. > > Thanks, > Carson > > > > > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 > --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A > run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and > large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > >> What is your command line? Are you running interactively or as a >> submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c wrote: >> >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set >> the number of task to 2, but there's only one contigs in running. Should it >> be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues >>> with OpenMPI. You can add them all or one at a time depending on issues you >>> get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message >>> help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >>> all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt >>> wrote: >>> >>>> You may need to delete the .../maker/perl directory before doing the >>>> reinstall if not doing a brand new installation. Otherwise you can ignore >>>> the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for >>>> MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval >>>> 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>>> cjfields at illinois.edu> wrote: >>>> >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>>> It looks like a Perl issue with threads, though I don?t see why this would >>>>> crash a cluster. The fact there is a log file would suggest it just ended >>>>> the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> *From: *maker-devel on behalf >>>>> of Carson Holt >>>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>>> *To: *zl c >>>>> *Cc: *"maker-devel at yandell-lab.org" >>>>> *Subject: *Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer >>>>> cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>>> genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yand >>>>> ell-lab.org >>>>> >>>>> >>>>> >>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 16 14:00:44 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 16 Aug 2017 16:00:44 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> Message-ID: Dear Carson and Daniel: Thank you for your explanation about the details of repeat masking. But we still have some concerns, would you please give us some suggestions? Thanks (1) We are doing genome annotation for a new rodent species, we wonder whether we should use repeat library for "Mammalia" or "rodent"? Which is more proper, if we did not construct a species-specific repeat library for the new genome? #-----Repeat Masking (leave values blank to skip repeat masking) model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker repeat_protein=/gs/gsfs0/hpc01/apps/MAKER/2.31.9/data/te_proteins.fasta #provide a fasta file of transposable element proteins for RepeatRunner (2) With some concerns as discussed above emails, we did not train a species-specific repeat library. Since we have finished the annotation only using the repeat library from repeatMasker and Maker2, we wonder whether it is worth for us to firstly train a species-specific repeat library and then do the genome annotation again? Will it (i.e., trainning a species-specific repeat library) significantly affect the gene annotation and downstream analysis (e.g., gene family expansion analysis, positive selection)? (3) We identified some gene families under contraction, but we want to confirm those gene families really lost copies in our new genome. Do you think it is worth to do the genome annotation without repeat masking, so there will not be genes missing from annotation due to repeat mask? Many thanks. Best Quanwei 2017-07-31 13:02 GMT-04:00 Carson Holt : > Please note that the unmask option Dan is talking about is a feature to > run both masked and unmasked raw predictions in the first round of > prediction (it does not affect alignemnt of the second round of > predictiopn). It tends to increase the false positive rate but can be a > quick test when you believe you are missing a gene because of overmasking > from a user created library and protein/EST evidence is overly sparse (so > the gene cannot be recovered through evidence alignment and the second > round of unmasked prediction). > > ?Carson > > On Jul 31, 2017, at 10:53 AM, Daniel Ence wrote: > > Hi Quanwei, Running maker on the unmasked genome will probably give you > more genes, but won?t be helpful in the end. Maker soft-masks repeats, > which prevents blast alignments from being seeded in the masked regions, > but still allows them to extend into those regions. This solves the problem > missing exons mentioned in the text you sent. There?s an option in the > control file to run the ab-inition programs on the unmasked sequence > (?unmask?) which is set to false (0) by default. > > Hope this helps, > Daniel Ence > > > On Jul 31, 2017, at 12:42 PM, Quanwei Zhang wrote: > > Hello: > > We are using the Maker2 pipeline to annotating a new genome. We just read > something about the repeat masking from repeatMasker's documents. It > suggests to leave low complexity region unmasked and to do gene annotation > using both masked and unmasked genome. I wonder what your opinion and > suggestions on this? Many thanks > > > The paragraph below is from http://www.binfo.ncku.edu.tw/ > RM/webrepeatmaskerhelp.html > Use in association with gene prediction programs > > Predicting genes from a masked sequence faces several problems. First, > one should not mask low complexity regions, e.g. to avoid masking > trinucleotide repeats in coding regions. But even with only interspersed > repeats masked, gene prediction programs may fail to identify exons > correctly. As mentioned above, sometimes tail ends of coding regions may > have originated from transposable elements. Even if no coding regions have > been masked, splice sites may be compromised; e.g. the polypyrimidine > region that is part of the acceptor splice site may be contained within a > repeat. > > Thus, I generally recommend to run a gene prediction program on unmasked > DNA (as well) and compare the predicted genes and exons with the > RepeatMasker output. Some gene prediction program allow you to force > certain exons out of the predictions (e.g. often the old ORFs of LINE1 > elements and endogenous retroviruses are included in genes). Work is also > in progress at several sites to incorporate RepeatMasker into gene > prediction programs, in which cases matches to repeats are weighted in > along with the other parameters used. > > Best > > Quanwei > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Thu Aug 17 07:39:29 2017 From: chzelin at gmail.com (zl c) Date: Thu, 17 Aug 2017 09:39:29 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: I use '--mca btl ^openib' and it runs on multiple nodes. It works and I see some sequences is done for the test run. Then I make another run using the large nr database and use local space on the computer cluster, which fails. Submit CMD: sbatch --gres=lscratch:100 --time=168:00:00 --partition=multinode --constraint=x2680 --mem-per-cpu=64g --ntasks=8 --ntasks-per-core=1 --job-name run05.mpi -o log.mpi.00/run05.mpi.o%A run05.mpi.sh Error message: #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_BLLXNq/rna%2Efasta.mpi.10.21 -query /lscratch/47455932/maker_BLLXNq/50/tig00017383_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_ canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/ goldfish.arrow.renamed_datastore/5A/65/tig00017383_ arrow//theVoid.tig00017383_arrow/0/tig00017383_arrow.0. rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.21.tblastx #-------------------------------# Thread 1 terminated abnormally: can't open /lscratch/47455932/mpiavG_z: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. --> rank=37, hostname=cn4120 FATAL: Thread terminated, causing all processes to fail --> rank=37, hostname=cn4120 ------------------------------------------------------- Primary job terminated normally, but 1 process returned a non-zero exit code.. Per user-direction, the job has been aborted. ------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received running blast search. #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_Zsg_Gg/rna%2Efasta.mpi.10.8 -query /lscratch/47455932/maker_Zsg_Gg/62/tig00001111_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_ canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/ goldfish.arrow.renamed_datastore/B8/A5/tig00001111_ arrow//theVoid.tig00001111_arrow/0/tig00001111_arrow.0. rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.8.tblastx #-------------------------------# Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached -------------------------------------------------------------------------- An MPI communication peer process has unexpectedly disconnected. This usually indicates a failure in the peer process (e.g., a crash or otherwise exiting without calling MPI_FINALIZE first). Although this local MPI process will likely now behave unpredictably (it may even hang or crash), the root cause of this problem is the failure of the peer -- that is what you need to investigate. For example, there may be a core file that you can examine. More generally: such peer hangups are frequently caused by application bugs or other external events. Local host: cn4130 Local PID: 18831 Peer host: cn3683 -------------------------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received formating database... #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype prot -in /lscratch/47455932/maker_rNzO3X/27/blastprep/protein2%2Efasta.mpi.10.25 #-------------------------------# SIGTERM received SIGTERM received SIGTERM received SIGTERM received ... SIGTERM received SIGTERM received SIGTERM received Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached ... [cn3683:36010] 59 more processes have sent help message help-mpi-btl-tcp.txt / peer hung up [cn3683:36010] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages -------------------------------------------------------------------------- mpiexec detected that one or more processes exited with non-zero status, thus causing the job to be terminated. The first process to do so was: Process name: [[352,1],37] Exit code: 255 -------------------------------------------------------------------------- I rebuild the mpi_blast and rerun it again, also get the error: #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_k6a7Hy/32/blastprep/rna%2Efasta.mpi.10.3 #-------------------------------# Thread 1 terminated abnormally: can't open /lscratch/47559740/mpiS84Ju: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. --> rank=27, hostname=cn4115 FATAL: Thread terminated, causing all processes to fail --> rank=27, hostname=cn4115 deleted:276 hits doing tblastx of alt-ESTs formating database... #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_nCKTgE/2/blastprep/rna%2Efasta.mpi.10.11 #-------------------------------# running blast search. #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47559740/maker_0kWZTA/rna%2Efasta.mpi.10.20 -query /lscratch/47559740/maker_0kWZTA/35/tig00027947_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/86/7F/tig00027947_arrow//theVoid.tig00027947_arrow/0/tig00027947_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.20.tblastx #-------------------------------# ------------------------------------------------------- Primary job terminated normally, but 1 process returned a non-zero exit code.. Per user-direction, the job has been aborted. ------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Thanks, Zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either > '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include > ib0?). Otherwise if you have infiniband on the nodes it will try and use > OpenFabrics compatible libraries which will kill code doing system calls > (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is > always sacrificed by maker to act only for message management among > processes, so with -n 2, you have one process working and one managing > data. So only one contig will run at a time. If you set it to a higher > number the issue will go away. The message manger process starts to get > saturated at ~200 CPUs, so anything above that processor count becomes less > beneficial to the job. > > Thanks, > Carson > > > > > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 > --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A > run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and > large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > >> What is your command line? Are you running interactively or as a >> submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c wrote: >> >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set >> the number of task to 2, but there's only one contigs in running. Should it >> be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues >>> with OpenMPI. You can add them all or one at a time depending on issues you >>> get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message >>> help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >>> all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt >>> wrote: >>> >>>> You may need to delete the .../maker/perl directory before doing the >>>> reinstall if not doing a brand new installation. Otherwise you can ignore >>>> the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for >>>> MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval >>>> 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>>> cjfields at illinois.edu> wrote: >>>> >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>>> It looks like a Perl issue with threads, though I don?t see why this would >>>>> crash a cluster. The fact there is a log file would suggest it just ended >>>>> the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> *From: *maker-devel on behalf >>>>> of Carson Holt >>>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>>> *To: *zl c >>>>> *Cc: *"maker-devel at yandell-lab.org" >>>>> *Subject: *Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer >>>>> cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>>> genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yand >>>>> ell-lab.org >>>>> >>>>> >>>>> >>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Thu Aug 17 09:36:20 2017 From: carsonhh at gmail.com (Carson Holt) Date: Thu, 17 Aug 2017 09:36:20 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: This is the causal error ?> can't open /lscratch/47455932/mpiavG_z It kills one process and causes everything else to die in an ugly way. There are several possible causes: 1. /lscratch/47455932/ is not actually locally mounted. It may be a virtual directory created at run time that exists on the network but not as a true locally mounted disk. If this is the case, there can be a slight IO delay under heavy IO load (common on NFS) that can cause directories and files to appear to not exist. This is one of the reasons TMP= must be sent to a true locally mounted disk. The IO load MAKER can produce can swamp network mounted disks creating strange errors. 2. /lscratch/47455932/ may only exist on the head node and not other nodes for the job. True local temporary storage is not available across nodes. It is only available on the node it is attached to. So if you are creating the location as part of your job, it may only exist on the head node and not the other nodes. Usually this value is set to /tmp because each machine should have it?s own independent /tmp location. 3. /lscratch/47455932/ exists on all nodes, but is full on one of them. ?Carson ?Carson > On Aug 17, 2017, at 7:39 AM, zl c wrote: > > I use '--mca btl ^openib' and it runs on multiple nodes. It works and I see some sequences is done for the test run. > > Then I make another run using the large nr database and use local space on the computer cluster, which fails. > Submit CMD: > sbatch --gres=lscratch:100 --time=168:00:00 --partition=multinode --constraint=x2680 --mem-per-cpu=64g --ntasks=8 --ntasks-per-core=1 --job-name run05.mpi -o log.mpi.00/run05.mpi.o%A run05.mpi.sh > Error message: > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_BLLXNq/rna%2Efasta.mpi.10.21 -query /lscratch/47455932/maker_BLLXNq/50/tig00017383_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/5A/65/tig00017383_arrow//theVoid.tig00017383_arrow/0/tig00017383_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.21.tblastx > #-------------------------------# > Thread 1 terminated abnormally: can't open /lscratch/47455932/mpiavG_z: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. > --> rank=37, hostname=cn4120 > FATAL: Thread terminated, causing all processes to fail > --> rank=37, hostname=cn4120 > ------------------------------------------------------- > Primary job terminated normally, but 1 process returned > a non-zero exit code.. Per user-direction, the job has been aborted. > ------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > running blast search. > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_Zsg_Gg/rna%2Efasta.mpi.10.8 -query /lscratch/47455932/maker_Zsg_Gg/62/tig00001111_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/B8/A5/tig00001111_arrow//theVoid.tig00001111_arrow/0/tig00001111_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.8.tblastx > #-------------------------------# > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > -------------------------------------------------------------------------- > An MPI communication peer process has unexpectedly disconnected. This > usually indicates a failure in the peer process (e.g., a crash or > otherwise exiting without calling MPI_FINALIZE first). > > Although this local MPI process will likely now behave unpredictably > (it may even hang or crash), the root cause of this problem is the > failure of the peer -- that is what you need to investigate. For > example, there may be a core file that you can examine. More > generally: such peer hangups are frequently caused by application bugs > or other external events. > > Local host: cn4130 > Local PID: 18831 > Peer host: cn3683 > -------------------------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > formating database... > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype prot -in /lscratch/47455932/maker_rNzO3X/27/blastprep/protein2%2Efasta.mpi.10.25 > #-------------------------------# > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > ... > SIGTERM received > SIGTERM received > SIGTERM received > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > > ... > [cn3683:36010] 59 more processes have sent help message help-mpi-btl-tcp.txt / peer hung up > [cn3683:36010] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages > -------------------------------------------------------------------------- > mpiexec detected that one or more processes exited with non-zero status, thus causing > the job to be terminated. The first process to do so was: > > Process name: [[352,1],37] > Exit code: 255 > -------------------------------------------------------------------------- > > > I rebuild the mpi_blast and rerun it again, also get the error: > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_k6a7Hy/32/blastprep/rna%2Efasta.mpi.10.3 > #-------------------------------# > Thread 1 terminated abnormally: can't open /lscratch/47559740/mpiS84Ju: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. > --> rank=27, hostname=cn4115 > FATAL: Thread terminated, causing all processes to fail > --> rank=27, hostname=cn4115 > deleted:276 hits > doing tblastx of alt-ESTs > formating database... > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_nCKTgE/2/blastprep/rna%2Efasta.mpi.10.11 > #-------------------------------# > running blast search. > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47559740/maker_0kWZTA/rna%2Efasta.mpi.10.20 -query /lscratch/47559740/maker_0kWZTA/35/tig00027947_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/86/7F/tig00027947_arrow//theVoid.tig00027947_arrow/0/tig00027947_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.20.tblastx > #-------------------------------# > ------------------------------------------------------- > Primary job terminated normally, but 1 process returned > a non-zero exit code.. Per user-direction, the job has been aborted. > ------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > > Thanks, > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt > wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0?). Otherwise if you have infiniband on the nodes it will try and use OpenFabrics compatible libraries which will kill code doing system calls (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is always sacrificed by maker to act only for message management among processes, so with -n 2, you have one process working and one managing data. So only one contig will run at a time. If you set it to a higher number the issue will go away. The message manger process starts to get saturated at ~200 CPUs, so anything above that processor count becomes less beneficial to the job. > > Thanks, > Carson > > > > >> On Aug 15, 2017, at 3:05 PM, zl c > wrote: >> >> I submit a job: >> sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh >> >> CMD in run06.maker.mpi.sh >> mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta >> >> Another question: >> How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. >> >> Thanks, >> zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> >> On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt > wrote: >> What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c > wrote: >> >>> Hi Carson, Christopher, Daniel, >>> >>> Thank you for your kind help. >>> >>> Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? >>> >>> Zelin >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com ] >>> >>> >>> NIH/NHGRI >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt > wrote: >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>>> On Aug 15, 2017, at 9:34 AM, zl c > wrote: >>>> >>>> Here are some latest message: >>>> >>>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com ] >>>> >>>> >>>> >>>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: >>>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c > wrote: >>>> >>>>> When I installed by './Build install', I got following some messages: >>>>> Configuring MAKER with MPI support >>>>> Installing MAKER... >>>>> Configuring MAKER with MPI support >>>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>>> >>>>> I'm not sure whether it's correctly installed. >>>>> >>>>> Thanks, >>>>> >>>>> -------------------------------------------- >>>>> Zelin Chen [chzelin at gmail.com ] >>>>> >>>>> NIH/NHGRI >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> From: maker-devel > on behalf of Carson Holt > >>>>> Date: Monday, August 14, 2017 at 2:18 PM >>>>> To: zl c > >>>>> Cc: "maker-devel at yandell-lab.org " > >>>>> Subject: Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com ] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>> >>>>> >>>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From yplee614 at 163.com Fri Aug 18 04:46:08 2017 From: yplee614 at 163.com (yplee) Date: Fri, 18 Aug 2017 18:46:08 +0800 Subject: [maker-devel] basis of gene removed in maker re-annotation Message-ID: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> Dear maker author, I am yongping li, a student from huazhong agriculture university, china. We used MAKER to re-annotation our genome annotation. There is some gene were removal in MAKER output when i input out previous annotation gff file, so what was the basis for gene removal? would you please provide us the details of gene remove? The reviews ask question when i submit my re-annotation paper to journal. Best regards Yours Sincerely From carsonhh at gmail.com Fri Aug 18 09:35:48 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 18 Aug 2017 09:35:48 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> Message-ID: <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Hi Quanwei, > (1) We are doing genome annotation for a new rodent species, we wonder whether we should use repeat library for "Mammalia" or "rodent"? Which is more proper, if we did not construct a species-specific repeat library for the new genome? Over masking can occur, but you should really only worry about it if there is a specific gene you are looking for or gene family and you don?t care about false positive gene models. On a genome wide level you will find that undermasking is almost always the greater danger. So I?d recommend using Mammalia. Also you should always build a species specific library when working with repeat rich organisms like mammals. > (2) With some concerns as discussed above emails, we did not train a species-specific repeat library. Since we have finished the annotation only using the repeat library from repeatMasker and Maker2, we wonder whether it is worth for us to firstly train a species-specific repeat library and then do the genome annotation again? Will it (i.e., trainning a species-specific repeat library) significantly affect the gene annotation and downstream analysis (e.g., gene family expansion analysis, positive selection)? It might be ok. Both Mammalia and rodent are already rich in related species repeats in RepBase. But you still may have a lot of false positives because of missed repeats. Repeats and transposable elements tend to create false regions of high evidence homology (make it look like you are getting evidence for a gene in the region, but when you look at the underlying sequence you realize it is a spurious alignment). > (3) We identified some gene families under contraction, but we want to confirm those gene families really lost copies in our new genome. Do you think it is worth to do the genome annotation without repeat masking, so there will not be genes missing from annotation due to repeat mask? Without repeat masking you will get a lot of false alignments. If you find anything without repeat masking you will need to do heavy manual review of the alignment and perhaps even domain identification to further weed out the many false positives you are sure to get. ?Carson From carsonhh at gmail.com Fri Aug 18 09:37:38 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 18 Aug 2017 09:37:38 -0600 Subject: [maker-devel] basis of gene removed in maker re-annotation In-Reply-To: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> References: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> Message-ID: Genes are removed if they have no evidence support or are overlapped by another gene that has better evidence support (the AED score measures evidence support). If you pass in old gene models in GFF3 format (model_gff), they will always be kept, even without evidence support but can be replaced by better supported overlapping models. ?Carson > On Aug 18, 2017, at 4:46 AM, yplee wrote: > > Dear maker author, > > I am yongping li, a student from huazhong agriculture university, china. We used MAKER to re-annotation our genome annotation. There is some gene were removal in MAKER output when i input out previous annotation gff file, so what was the basis for gene removal? > > would you please provide us the details of gene remove? The reviews ask question when i submit my re-annotation paper to journal. > > > > Best regards > > > Yours Sincerely > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org From qwzhang0601 at gmail.com Mon Aug 21 10:51:34 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Mon, 21 Aug 2017 12:51:34 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: Dear Carson: I am trying to build a species specific repeat library for our new rodent species, following " http://weatherby.genetics.utah.edu/MAKER/wiki/index.php/Repeat_Library_Construction--Basic". But there are somethings not clear to us, would you please explain? Thanks (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder"*. *Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). In the file "maker_opts.ctl" #-----Repeat Masking (leave values blank to skip repeat masking) model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker Many thanks Best Quanwei 2017-08-18 11:35 GMT-04:00 Carson Holt : > Hi Quanwei, > > > (1) We are doing genome annotation for a new rodent species, we wonder > whether we should use repeat library for "Mammalia" or "rodent"? Which is > more proper, if we did not construct a species-specific repeat library for > the new genome? > > Over masking can occur, but you should really only worry about it if there > is a specific gene you are looking for or gene family and you don?t care > about false positive gene models. On a genome wide level you will find that > undermasking is almost always the greater danger. So I?d recommend using > Mammalia. Also you should always build a species specific library when > working with repeat rich organisms like mammals. > > > > (2) With some concerns as discussed above emails, we did not train a > species-specific repeat library. Since we have finished the annotation only > using the repeat library from repeatMasker and Maker2, we wonder whether it > is worth for us to firstly train a species-specific repeat library and > then do the genome annotation again? Will it (i.e., trainning a > species-specific repeat library) significantly affect the gene annotation > and downstream analysis (e.g., gene family expansion analysis, positive > selection)? > > It might be ok. Both Mammalia and rodent are already rich in related > species repeats in RepBase. But you still may have a lot of false positives > because of missed repeats. Repeats and transposable elements tend to create > false regions of high evidence homology (make it look like you are getting > evidence for a gene in the region, but when you look at the underlying > sequence you realize it is a spurious alignment). > > > > (3) We identified some gene families under contraction, but we want to > confirm those gene families really lost copies in our new genome. Do you > think it is worth to do the genome annotation without repeat masking, so > there will not be genes missing from annotation due to repeat mask? > > Without repeat masking you will get a lot of false alignments. If you find > anything without repeat masking you will need to do heavy manual review of > the alignment and perhaps even domain identification to further weed out > the many false positives you are sure to get. > > ?Carson -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 22 10:15:59 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 22 Aug 2017 10:15:59 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> Message-ID: The est2genome option takes an alignment and then just identifies the longest ORF in that alignment and turns it into a model (these models are good enough to rain with). The reason est2genoime is not recommended for the annotation step are several. 1. They are likely to be partial in many cases or include a number of merged assemblies depending on the organism. 2. They will likely only represent a fraction of the genes so relying only on est2genome models will result in low sensitivity since not everything is expected to be expressed or assembled. 3. Ab initio predictors that receive the intron/exon hints from a transcript evidence alignment should still replicate the structure of correctly assembled transcripts anyways, but they can still call genes in other regions without transcript evidence to improve sensitivity or improve structure for models with only partial transcript evidence alignment (i.e. they can complete the incomplete models). 4. If their are assembly error?s (you can expect a lot of these in a draft assembly), ab initio predictors can work around the errors to create an intron/exon structure with reasonable similar ORF that will be similar to the true ORF if not exactly correct, where alignment based methods cannot and will just produce a truncated ORF. 5. est2genome models will always have great AED scores (falsely good scores) since they are their own evidence and match themselves exactly, so spurious alignments and partial alignments always score very high even when they are bad models. By turning est2genome off, you allows the HMM scoring mechanism to act as an additional filter on those models. If you have really really good transcript evidence, it is possible for est2genome to work very well. But the likelihood of having evidence that perfect is low. So for those reasons we recommend using it only as an intermediate step. ?Carson > On Aug 19, 2017, at 10:38 AM, Tim Fallon wrote: > > Hi Carson, > > Just a follow up to this, for posterity. I was able to do what I wanted by using just the est2genome=1, and turning off protein2genome. The input to the est2genome is a Trinity de novo transcriptome assembly with strand specific libraries + assembly and jaccard clip. The results seem quite reliable, and I?m not getting the problem where tandem similar genes were getting fused anymore (the original problem with this inquiry). I expect this is due to there being enough nucleotide differences in the est2genome alignment of two similar and tandem transcripts to effectively distinguish them. > > In any event, it wasn?t clear to me that est2genome=1 alone would produce ORF/CDS predictions (for the genes), and I?ve done a lot of reading around the Maker documentation and papers. Might be worth considering making the documentation more clear in this respect in the future. I know that est2genome & protein2genome were originally intended more as an intermediate step for ab-initio gene predictor training, but in my opinion with the quality and cost-effectivness of transcript discovery RNA-Seq, it seems reasonable to ditch the ab-initio gene prediction and go entirely with a ?est2genome=1? like approach. It might be worthwhile to document what your thought process would be for reliable ab-initio free gene annotation w/ Maker. I?ll mention I haven?t looked into the PASA pipeline for this, which is the only other major publicly available gene structure annotation pipeline known to me, as the parallelization in Maker has been working quite well for me. > > Are the heuristics for this ORF prediction in est2genome=1 documented anywhere? E.g., does it only pick the longest ORF per transcript? Or if there are multiple ?good? ORFs (>200 amino acids) per transcript, will it try and split those into different genes? I ask as my current task is trying to merge the previously mentioned de novo transcriptome derived gene models from est2genome with est2genome gene models of a reference guided transcriptome assembly. Although the reference guided transcript assembly captures more genes that the Trinity assembly (by tblastn), the transcripts are notably artifactually chimeric, sometimes containing 4-5 CDSs, so the heuristics for the Maker est2genome could be pretty influential. > > All the best, > -Tim > >> On Jul 13, 2017, at 1:05 PM, Carson Holt > wrote: >> >> est2genome and protein2genome take BLAST hits, polish them with exonerate around splice sites and then turn the alignment directly into a gene model. So if the alignment is partial because the EST or mRNA-seq do not cross the entire transcript or the protein homology does not cross the entire CDS, then the resulting model will be partial. It can be end to end, but partial tends to be more common than not unless you are using a protein evidence library with limited divergence. >> >> ?Carson >> >> >> >>> On Jul 10, 2017, at 2:00 PM, Tim Fallon > wrote: >>> >>> Hi Carson, >>> >>> So far what I've noticed with just est2genome, and protein2genome, using only de novo assembled transcripts with transdecoder predicted peptides (both mapped in maker with blast evalue limit = 1e-50), the gene models (for the genes where I have enough information about the "correct" gene structure), have been full length. Is this unexpected? >>> >>> Will try Apollo. Though I'd like to avoid manual curation. Perhaps it is worth talking to the Augustus developers to see why Augustus was making the exon error in my key gene that led me to ditching it altogether. >>> >>> Agree there are varying qualities of draft assemblies. In our case, we did 100X Illumina hybrid assembly w/ 50X PacBio. The local structure so far seems to be pretty good. >>> >>> Good to know that the human and mouse assemblies even have gene errors, makes me feel better about how much time I've put in trying to get my genome annotation perfect :) >>> >>> All the best, >>> -Tim >>> >>> On Jul 10, 2017, at 3:20 PM, Carson Holt > wrote: >>> >>>> est2genome and protein2genome will almost always be partial. Also the error rate on draft assemblies is much higher than most people realize. Beyond issues already mentioned in the previous e-mail, there is also the issue that organisms are diploid, but the assembly is haploid, so variation gets squashed which also breaks ORFs (there are several examples of this in both the mature human and mouse genome assemblies). For many draft assemblies, you can expect ORF affecting errors in as much as 10-15% of your annotations. >>>> >>>> Try opening the cases with issues and manually editing them in Apollo. Possible sources of sequence guiding the annotation may become more apparent (look at mismatches in the mRNA-seq alignments relative to the assembly for example). And if not, and the region is just too complex for the predictor, then you can force the model with Apollo. >>>> >>>> ?Carson >>>> >>>> >>>>> On Jul 6, 2017, at 6:45 AM, Tim Fallon > wrote: >>>>> >>>>> Hi Carson, >>>>> >>>>> This region is definitely entirely correct at the genomic nucleotide level, no missassemblies. Would you have any strong reservations about ditching the ab-initio prediction and sticking entirely with the est2genome predictions and protein2genome predictions? Right now this is what I?m thinking, as troubleshooting the ab-initio training seems like it could be a long road. >>>>> >>>>> All the best, >>>>> -Tim >>>>> >>>>>> On Jun 26, 2017, at 6:00 PM, Carson Holt > wrote: >>>>>> >>>>>> Augustus uses an HMM with scoring bonuses for evidence match. If a difference in the assembly breaks the ORF anywhere in the transcript relative to the evidence or removes high scoring transcript start/stop sequences, then Augustus will add/skip exons or trim/extend transcripts to capture what scoring bonuses it can as best it can. So wherever you see Augustus behaving weirdly, you likely have something off in the assembly (small stretch of NN?s or single basepair duplications/deletions that affect the ORF and scoring model). So what Augustus produces is the best fit gene model to hop around assembly anomalies while still producing a canonical model. >>>>>> >>>>>> In areas like the ones I describe above, EVM refuses to produce any model. So you can experiment with the EVM options in MAKER3, but what you may find is that problem regions tend to get no models with EVM. I believe using the pred_gff trick I mentioned previously may be the easiest work around. Also make sure to prefilter mRNA-seq evidence to avoid transcript joining (trinity has a jaccard_clip option which can help). Because if you are getting transcript joining in proteins, you are almost certain to get it in transcript evidence as well. >>>>>> >>>>>> ?Carson >>>>>> >>>>>>> On Jun 22, 2017, at 10:59 PM, Tim Fallon > wrote: >>>>>>> >>>>>>> Hi Carson, >>>>>>> >>>>>>> Thanks for the response! After sending my initial email, I did notice this particular issue was warned about in the Cambell et al. 2014 Maker protocols paper. Perhaps future versions of the pipeline might have a workaround or warning for this presumably common issue. At least in my case, the genome I?m annotating has large introns, and also tandem gene clusters of homologous genes, so I?ve been unable to solve this issue entirely by changing existing parameters (e.g. split_hit), though perhaps exonerate / protein2genome direct gene annotation does handle it correctly. >>>>>>> >>>>>>> Regarding the protein2genome only being a intermediate stage, as I?ve been working towards a final annotation, I?ve actually been mostly relying on the protein2genome direct gene annotation, as although I have a trained Augustus that is presumably getting the hints from the evidence, my main target genes have been producing subtly wrong gene-models (Augustus produced splice sit off by a handful of nucleotides, leading to unintended & unsupported amino acids in the protein). I also trained SNAP, but those predictions were worse than the Augustus predictions. >>>>>>> >>>>>>> Do you have any tips for using the Evidence Modeler integration of the Maker 3.0.0 beta? That seems to be the best way to have the final gene models rely more on extrinsic evidence over my mildly incorrect ab-initio predictions. Or perhaps PASA is more appropriate for gene-models that would strictly adhere to extrinsic de novo assembled transcript / predicted ORF evidence? >>>>>>> >>>>>>> All the best, >>>>>>> -Tim >>>>>>> >>>>>>>> On Jun 23, 2017, at 12:27 AM, Carson Holt > wrote: >>>>>>>> >>>>>>>> The protein_match features are the direct BLASTX results. Because of how BLAST works, if you have neighboring paralogs, it can place HSPs in both. So the final hit ends up being to large. The protein2genome feature is then the result of exonerate polishing these blast alignments (this will usually remove false merging and bad exon order). The protein2genome=1 option on the other hand just tell maker that you want to try and convert the exonerate hits directly into gene models (only do this for training and not final annotation). One way to drop the BLASTX results may be to filter the GFF3 results to keep only protein2genome features, pass those into protein_gff, and then turn off protein= for the next run. This forces the blastx results to be dropped. You may want to set blast_depth parameters to something like 10 in maker_bopts.ctl before doing this to trim per locus evidence depth to 10 if you are using too much input data. >>>>>>>> >>>>>>>> ?Carson >>>>>>>> >>>>>>>> >>>>>>>> >>>>>>>>> On Jun 13, 2017, at 11:35 AM, Tim Fallon > wrote: >>>>>>>>> >>>>>>>>> Hi there, >>>>>>>>> >>>>>>>>> I am aligning reference proteins to an insect genome through Maker, in preparation for using the gene models from the protein alignments as evidence to train SNAP (alongside de-novo assembled RNA-Seq). I also plan on passing the protein alignments to a future Maker run as hints for SNAP / Augustus. >>>>>>>>> >>>>>>>>> I?ve noticed that the maker blastx "protein_match? feature, which I presume is a result of Maker trying to make the blastx HSPs contiguous to format as a reference for exonerate (this Maker run did have protein2genome turned on), tends to fuse tandem genes from the same gene family. See attached image. >>>>>>>>> >>>>>>>>> The red regions highlight two de novo assembled transcripts which I aligned manually, from two genes that are homologous. The top track is the blastx ?match_part? features, the bottom track is the blastx ?protein_match? features. You can see that the protein_match fuses the two genes, using ~1000 bp in an intervening region, that doesn?t have blastx HSP support in the blastx ?match_part? track. The trick seems to be that a single reference protein, has blastx matches on both the left and right gene. >>>>>>>>> >>>>>>>>> Cleary this isn?t a good gene model to train SNAP with, but would this misannotation screw up the hints passed to pretrained SNAP / Augustus? >>>>>>>>> >>>>>>>>> Is there anyway to prevent this protein_match fusing of adjacent similar genes from happening? For species that are closer, I?ve set the ?eval_blastx? to be a lot higher (1e-50), and in that case the genes don?t get fused (but, with that level of stringent search, it is more like an orthology search, rather than just annotating general protein similarity). I do have (rare) introns ~1000 bp, so I wouldn?t want to change the Maker ?split_hit? parameter to be too low. >>>>>>>>> >>>>>>>>> All the best, >>>>>>>>> -Tim >>>>>>>>> >>>>>>>>> Timothy R. Fallon >>>>>>>>> PhD candidate >>>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>>> Department of Biology >>>>>>>>> MIT >>>>>>>>> >>>>>>>>> tfallon at mit.edu >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>> _______________________________________________ >>>>>>>>> maker-devel mailing list >>>>>>>>> maker-devel at box290.bluehost.com >>>>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>>>> >>>>>>> >>>>>>> Timothy R. Fallon >>>>>>> PhD candidate >>>>>>> Laboratory of Jing-Ke Weng >>>>>>> Department of Biology >>>>>>> MIT >>>>>>> >>>>>>> tfallon at mit.edu >>>>>> >>>>> >>>>> Timothy R. Fallon >>>>> PhD candidate >>>>> Laboratory of Jing-Ke Weng >>>>> Department of Biology >>>>> MIT >>>>> >>>>> tfallon at mit.edu >>>> >> > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From tfallon at mit.edu Tue Aug 22 10:38:47 2017 From: tfallon at mit.edu (Tim Fallon) Date: Tue, 22 Aug 2017 12:38:47 -0400 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> Message-ID: <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) All the best, -Tim > On Aug 22, 2017, at 12:15 PM, Carson Holt wrote: > > The est2genome option takes an alignment and then just identifies the longest ORF in that alignment and turns it into a model (these models are good enough to rain with). The reason est2genoime is not recommended for the annotation step are several. > > 1. They are likely to be partial in many cases or include a number of merged assemblies depending on the organism. > 2. They will likely only represent a fraction of the genes so relying only on est2genome models will result in low sensitivity since not everything is expected to be expressed or assembled. > 3. Ab initio predictors that receive the intron/exon hints from a transcript evidence alignment should still replicate the structure of correctly assembled transcripts anyways, but they can still call genes in other regions without transcript evidence to improve sensitivity or improve structure for models with only partial transcript evidence alignment (i.e. they can complete the incomplete models). > 4. If their are assembly error?s (you can expect a lot of these in a draft assembly), ab initio predictors can work around the errors to create an intron/exon structure with reasonable similar ORF that will be similar to the true ORF if not exactly correct, where alignment based methods cannot and will just produce a truncated ORF. > 5. est2genome models will always have great AED scores (falsely good scores) since they are their own evidence and match themselves exactly, so spurious alignments and partial alignments always score very high even when they are bad models. By turning est2genome off, you allows the HMM scoring mechanism to act as an additional filter on those models. > > If you have really really good transcript evidence, it is possible for est2genome to work very well. But the likelihood of having evidence that perfect is low. So for those reasons we recommend using it only as an intermediate step. > > ?Carson > > > >> On Aug 19, 2017, at 10:38 AM, Tim Fallon > wrote: >> >> Hi Carson, >> >> Just a follow up to this, for posterity. I was able to do what I wanted by using just the est2genome=1, and turning off protein2genome. The input to the est2genome is a Trinity de novo transcriptome assembly with strand specific libraries + assembly and jaccard clip. The results seem quite reliable, and I?m not getting the problem where tandem similar genes were getting fused anymore (the original problem with this inquiry). I expect this is due to there being enough nucleotide differences in the est2genome alignment of two similar and tandem transcripts to effectively distinguish them. >> >> In any event, it wasn?t clear to me that est2genome=1 alone would produce ORF/CDS predictions (for the genes), and I?ve done a lot of reading around the Maker documentation and papers. Might be worth considering making the documentation more clear in this respect in the future. I know that est2genome & protein2genome were originally intended more as an intermediate step for ab-initio gene predictor training, but in my opinion with the quality and cost-effectivness of transcript discovery RNA-Seq, it seems reasonable to ditch the ab-initio gene prediction and go entirely with a ?est2genome=1? like approach. It might be worthwhile to document what your thought process would be for reliable ab-initio free gene annotation w/ Maker. I?ll mention I haven?t looked into the PASA pipeline for this, which is the only other major publicly available gene structure annotation pipeline known to me, as the parallelization in Maker has been working quite well for me. >> >> Are the heuristics for this ORF prediction in est2genome=1 documented anywhere? E.g., does it only pick the longest ORF per transcript? Or if there are multiple ?good? ORFs (>200 amino acids) per transcript, will it try and split those into different genes? I ask as my current task is trying to merge the previously mentioned de novo transcriptome derived gene models from est2genome with est2genome gene models of a reference guided transcriptome assembly. Although the reference guided transcript assembly captures more genes that the Trinity assembly (by tblastn), the transcripts are notably artifactually chimeric, sometimes containing 4-5 CDSs, so the heuristics for the Maker est2genome could be pretty influential. >> >> All the best, >> -Tim >> >>> On Jul 13, 2017, at 1:05 PM, Carson Holt > wrote: >>> >>> est2genome and protein2genome take BLAST hits, polish them with exonerate around splice sites and then turn the alignment directly into a gene model. So if the alignment is partial because the EST or mRNA-seq do not cross the entire transcript or the protein homology does not cross the entire CDS, then the resulting model will be partial. It can be end to end, but partial tends to be more common than not unless you are using a protein evidence library with limited divergence. >>> >>> ?Carson >>> >>> >>> >>>> On Jul 10, 2017, at 2:00 PM, Tim Fallon > wrote: >>>> >>>> Hi Carson, >>>> >>>> So far what I've noticed with just est2genome, and protein2genome, using only de novo assembled transcripts with transdecoder predicted peptides (both mapped in maker with blast evalue limit = 1e-50), the gene models (for the genes where I have enough information about the "correct" gene structure), have been full length. Is this unexpected? >>>> >>>> Will try Apollo. Though I'd like to avoid manual curation. Perhaps it is worth talking to the Augustus developers to see why Augustus was making the exon error in my key gene that led me to ditching it altogether. >>>> >>>> Agree there are varying qualities of draft assemblies. In our case, we did 100X Illumina hybrid assembly w/ 50X PacBio. The local structure so far seems to be pretty good. >>>> >>>> Good to know that the human and mouse assemblies even have gene errors, makes me feel better about how much time I've put in trying to get my genome annotation perfect :) >>>> >>>> All the best, >>>> -Tim >>>> >>>> On Jul 10, 2017, at 3:20 PM, Carson Holt > wrote: >>>> >>>>> est2genome and protein2genome will almost always be partial. Also the error rate on draft assemblies is much higher than most people realize. Beyond issues already mentioned in the previous e-mail, there is also the issue that organisms are diploid, but the assembly is haploid, so variation gets squashed which also breaks ORFs (there are several examples of this in both the mature human and mouse genome assemblies). For many draft assemblies, you can expect ORF affecting errors in as much as 10-15% of your annotations. >>>>> >>>>> Try opening the cases with issues and manually editing them in Apollo. Possible sources of sequence guiding the annotation may become more apparent (look at mismatches in the mRNA-seq alignments relative to the assembly for example). And if not, and the region is just too complex for the predictor, then you can force the model with Apollo. >>>>> >>>>> ?Carson >>>>> >>>>> >>>>>> On Jul 6, 2017, at 6:45 AM, Tim Fallon > wrote: >>>>>> >>>>>> Hi Carson, >>>>>> >>>>>> This region is definitely entirely correct at the genomic nucleotide level, no missassemblies. Would you have any strong reservations about ditching the ab-initio prediction and sticking entirely with the est2genome predictions and protein2genome predictions? Right now this is what I?m thinking, as troubleshooting the ab-initio training seems like it could be a long road. >>>>>> >>>>>> All the best, >>>>>> -Tim >>>>>> >>>>>>> On Jun 26, 2017, at 6:00 PM, Carson Holt > wrote: >>>>>>> >>>>>>> Augustus uses an HMM with scoring bonuses for evidence match. If a difference in the assembly breaks the ORF anywhere in the transcript relative to the evidence or removes high scoring transcript start/stop sequences, then Augustus will add/skip exons or trim/extend transcripts to capture what scoring bonuses it can as best it can. So wherever you see Augustus behaving weirdly, you likely have something off in the assembly (small stretch of NN?s or single basepair duplications/deletions that affect the ORF and scoring model). So what Augustus produces is the best fit gene model to hop around assembly anomalies while still producing a canonical model. >>>>>>> >>>>>>> In areas like the ones I describe above, EVM refuses to produce any model. So you can experiment with the EVM options in MAKER3, but what you may find is that problem regions tend to get no models with EVM. I believe using the pred_gff trick I mentioned previously may be the easiest work around. Also make sure to prefilter mRNA-seq evidence to avoid transcript joining (trinity has a jaccard_clip option which can help). Because if you are getting transcript joining in proteins, you are almost certain to get it in transcript evidence as well. >>>>>>> >>>>>>> ?Carson >>>>>>> >>>>>>>> On Jun 22, 2017, at 10:59 PM, Tim Fallon > wrote: >>>>>>>> >>>>>>>> Hi Carson, >>>>>>>> >>>>>>>> Thanks for the response! After sending my initial email, I did notice this particular issue was warned about in the Cambell et al. 2014 Maker protocols paper. Perhaps future versions of the pipeline might have a workaround or warning for this presumably common issue. At least in my case, the genome I?m annotating has large introns, and also tandem gene clusters of homologous genes, so I?ve been unable to solve this issue entirely by changing existing parameters (e.g. split_hit), though perhaps exonerate / protein2genome direct gene annotation does handle it correctly. >>>>>>>> >>>>>>>> Regarding the protein2genome only being a intermediate stage, as I?ve been working towards a final annotation, I?ve actually been mostly relying on the protein2genome direct gene annotation, as although I have a trained Augustus that is presumably getting the hints from the evidence, my main target genes have been producing subtly wrong gene-models (Augustus produced splice sit off by a handful of nucleotides, leading to unintended & unsupported amino acids in the protein). I also trained SNAP, but those predictions were worse than the Augustus predictions. >>>>>>>> >>>>>>>> Do you have any tips for using the Evidence Modeler integration of the Maker 3.0.0 beta? That seems to be the best way to have the final gene models rely more on extrinsic evidence over my mildly incorrect ab-initio predictions. Or perhaps PASA is more appropriate for gene-models that would strictly adhere to extrinsic de novo assembled transcript / predicted ORF evidence? >>>>>>>> >>>>>>>> All the best, >>>>>>>> -Tim >>>>>>>> >>>>>>>>> On Jun 23, 2017, at 12:27 AM, Carson Holt > wrote: >>>>>>>>> >>>>>>>>> The protein_match features are the direct BLASTX results. Because of how BLAST works, if you have neighboring paralogs, it can place HSPs in both. So the final hit ends up being to large. The protein2genome feature is then the result of exonerate polishing these blast alignments (this will usually remove false merging and bad exon order). The protein2genome=1 option on the other hand just tell maker that you want to try and convert the exonerate hits directly into gene models (only do this for training and not final annotation). One way to drop the BLASTX results may be to filter the GFF3 results to keep only protein2genome features, pass those into protein_gff, and then turn off protein= for the next run. This forces the blastx results to be dropped. You may want to set blast_depth parameters to something like 10 in maker_bopts.ctl before doing this to trim per locus evidence depth to 10 if you are using too much input data. >>>>>>>>> >>>>>>>>> ?Carson >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>>> On Jun 13, 2017, at 11:35 AM, Tim Fallon > wrote: >>>>>>>>>> >>>>>>>>>> Hi there, >>>>>>>>>> >>>>>>>>>> I am aligning reference proteins to an insect genome through Maker, in preparation for using the gene models from the protein alignments as evidence to train SNAP (alongside de-novo assembled RNA-Seq). I also plan on passing the protein alignments to a future Maker run as hints for SNAP / Augustus. >>>>>>>>>> >>>>>>>>>> I?ve noticed that the maker blastx "protein_match? feature, which I presume is a result of Maker trying to make the blastx HSPs contiguous to format as a reference for exonerate (this Maker run did have protein2genome turned on), tends to fuse tandem genes from the same gene family. See attached image. >>>>>>>>>> >>>>>>>>>> The red regions highlight two de novo assembled transcripts which I aligned manually, from two genes that are homologous. The top track is the blastx ?match_part? features, the bottom track is the blastx ?protein_match? features. You can see that the protein_match fuses the two genes, using ~1000 bp in an intervening region, that doesn?t have blastx HSP support in the blastx ?match_part? track. The trick seems to be that a single reference protein, has blastx matches on both the left and right gene. >>>>>>>>>> >>>>>>>>>> Cleary this isn?t a good gene model to train SNAP with, but would this misannotation screw up the hints passed to pretrained SNAP / Augustus? >>>>>>>>>> >>>>>>>>>> Is there anyway to prevent this protein_match fusing of adjacent similar genes from happening? For species that are closer, I?ve set the ?eval_blastx? to be a lot higher (1e-50), and in that case the genes don?t get fused (but, with that level of stringent search, it is more like an orthology search, rather than just annotating general protein similarity). I do have (rare) introns ~1000 bp, so I wouldn?t want to change the Maker ?split_hit? parameter to be too low. >>>>>>>>>> >>>>>>>>>> All the best, >>>>>>>>>> -Tim >>>>>>>>>> >>>>>>>>>> Timothy R. Fallon >>>>>>>>>> PhD candidate >>>>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>>>> Department of Biology >>>>>>>>>> MIT >>>>>>>>>> >>>>>>>>>> tfallon at mit.edu >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> _______________________________________________ >>>>>>>>>> maker-devel mailing list >>>>>>>>>> maker-devel at box290.bluehost.com >>>>>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>>>>> >>>>>>>> >>>>>>>> Timothy R. Fallon >>>>>>>> PhD candidate >>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>> Department of Biology >>>>>>>> MIT >>>>>>>> >>>>>>>> tfallon at mit.edu >>>>>>> >>>>>> >>>>>> Timothy R. Fallon >>>>>> PhD candidate >>>>>> Laboratory of Jing-Ke Weng >>>>>> Department of Biology >>>>>> MIT >>>>>> >>>>>> tfallon at mit.edu >>>>> >>> >> >> >> > Timothy R. Fallon PhD candidate Laboratory of Jing-Ke Weng Department of Biology MIT tfallon at mit.edu -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: smime.p7s Type: application/pkcs7-signature Size: 1853 bytes Desc: not available URL: From isabel.marcelino.im at gmail.com Wed Aug 23 10:29:57 2017 From: isabel.marcelino.im at gmail.com (Isabel Marcelino) Date: Wed, 23 Aug 2017 12:29:57 -0400 Subject: [maker-devel] Fwd: Errors with Blast engine and Fasta index In-Reply-To: References: Message-ID: ---------- Forwarded message ---------- From: Isabel Marcelino Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker-devel at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/ Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/ Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI Garanti sans virus. www.avast.com <#DAB4FAD8-2DD7-40BB-A1B8-4E2AA1F9FDF2> -------------- next part -------------- An HTML attachment was scrubbed... URL: From willett4 at email.unc.edu Wed Aug 23 10:26:05 2017 From: willett4 at email.unc.edu (Willett, Christopher S) Date: Wed, 23 Aug 2017 16:26:05 +0000 Subject: [maker-devel] question about FASTA warnings Message-ID: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Hello- I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. Thanks for your help, Best, Chris Willett here is a portion of the run log with some examples of the warnings: ------------------------------------------------------------ # LSBATCH: User input maker ------------------------------------------------------------ Successfully completed. Resource usage summary: CPU time : 59.63 sec. Total Requested Memory : 0.50 GB Delta Memory : - Max Processes : 7 Max Threads : 8 Run time : 47 sec. Turnaround time : 55 sec. The output (if any) follows: STATUS: Parsing control files... STATUS: Processing and indexing input FASTA files... STATUS: Setting up database for any GFF3 input... A data structure will be created for you at: /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore To access files for individual sequences use the datastore index: /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log STATUS: Now running MAKER... examining contents of the fasta file and run log --Next Contig-- #--------------------------------------------------------------------- Now starting the contig!! SeqID: contig-dpp-500-500 Length: 32156 #--------------------------------------------------------------------- setting up GFF3 output and fasta chunks doing repeat masking running repeat masker. #--------- command -------------# Widget::RepeatMasker: cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 #-------------------------------# doing blastx repeats formating database... #--------- command -------------# Widget::formater: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 #-------------------------------# Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. running blast search. #--------- command -------------# Widget::blastx: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner #-------------------------------# deleted:0 hits doing blastx repeats formating database... #--------- command -------------# Widget::formater: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 #-------------------------------# Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) (continues on as above but title lengths are different) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Research Associate Professor Department of Biology CB#3280 Coker Hall University of North Carolina, Chapel Hill Chapel Hill, NC, 27599-3280 Office: 2252 Genome Science Building phone: 919-843-8663 fax: 919-962-1625 http://labs.bio.unc.edu/Willett/ -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Wed Aug 23 10:57:59 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Wed, 23 Aug 2017 16:57:59 +0000 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: References: Message-ID: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? ~Daniel On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: ---------- Forwarded message ---------- From: Isabel Marcelino > Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker-devel at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI [https://ipmcdn.avast.com/images/icons/icon-envelope-tick-round-orange-animated-no-repeat-v1.gif] Garanti sans virus. www.avast.com _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Wed Aug 23 10:47:40 2017 From: dandence at gmail.com (Daniel Ence) Date: Wed, 23 Aug 2017 12:47:40 -0400 Subject: [maker-devel] question about FASTA warnings In-Reply-To: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> References: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Message-ID: Hi Chris, I haven?t seen that warning either in my usage of MAKER. My guess is that the version of Repeatmasker installed on your cluster has this warning and expects a certain format in the fasta headers. This could be checked by looking at the TE protein file that maker is using. Do you have access to that? In any case it probably isn?t an issue that needs to be fixed if the output otherwise looks good. ~Daniel > On Aug 23, 2017, at 12:26 PM, Willett, Christopher S wrote: > > Hello- > > I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. > > Thanks for your help, > > Best, > > Chris Willett > > here is a portion of the run log with some examples of the warnings: > > ------------------------------------------------------------ > # LSBATCH: User input > maker > ------------------------------------------------------------ > > Successfully completed. > > Resource usage summary: > > CPU time : 59.63 sec. > Total Requested Memory : 0.50 GB > Delta Memory : - > Max Processes : 7 > Max Threads : 8 > Run time : 47 sec. > Turnaround time : 55 sec. > > The output (if any) follows: > > STATUS: Parsing control files... > STATUS: Processing and indexing input FASTA files... > STATUS: Setting up database for any GFF3 input... > A data structure will be created for you at: > /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore > > To access files for individual sequences use the datastore index: > /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log > > STATUS: Now running MAKER... > examining contents of the fasta file and run log > > > > --Next Contig-- > > #--------------------------------------------------------------------- > Now starting the contig!! > SeqID: contig-dpp-500-500 > Length: 32156 > #--------------------------------------------------------------------- > > > setting up GFF3 output and fasta chunks > doing repeat masking > running repeat masker. > #--------- command -------------# > Widget::RepeatMasker: > cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 > #-------------------------------# > doing blastx repeats > formating database... > #--------- command -------------# > Widget::formater: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 > #-------------------------------# > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > running blast search. > #--------- command -------------# > Widget::blastx: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner > #-------------------------------# > deleted:0 hits > doing blastx repeats > formating database... > #--------- command -------------# > Widget::formater: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 > #-------------------------------# > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) > > (continues on as above but title lengths are different) > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > Research Associate Professor > Department of Biology > CB#3280 Coker Hall > University of North Carolina, Chapel Hill > Chapel Hill, NC, 27599-3280 > > Office: 2252 Genome Science Building > phone: > 919-843-8663 > fax: > 919-962-1625 > > http://labs.bio.unc.edu/Willett/ > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From isabel.marcelino.im at gmail.com Wed Aug 23 11:38:06 2017 From: isabel.marcelino.im at gmail.com (Isabel Marcelino) Date: Wed, 23 Aug 2017 10:38:06 -0700 (PDT) Subject: [maker-devel] Fwd: Errors with Blast engine and Fasta index In-Reply-To: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Message-ID: <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> Hi Daniel, Thank you for your feedback. In fact, my fasta entry is not empty (please see below). I even tried to reprocess the genome fasta file that I already processed using MAKER and it doesn't work either... Isabel (PS: I do not manage to "reply" your message but only "forward" it. I was wondering if there are any settings I should change? I participate in other google groups and I can "reply" to messages. Thanks for the help) (>NODE_1_length_465927_cov_94.9908 ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....) On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote: > > Hi Isabel, The warning is referring to an empty entry in one of the fasta > files (?Warning: Sequence contains no data?). This is probably in the > genome fasta file that you are trying to annotate. Can you check the fasta > entry ?NODE_1_length_465927_cov_94.9908?? > > ~Daniel > > > > On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: > > > ---------- Forwarded message ---------- > From: Isabel Marcelino > > Date: 23 August 2017 at 11:37 > Subject: Errors with Blast engine and Fasta index > To: maker... at googlegroups.com > > > Hello, > > I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) > running smoothly a few weeks ago and I could perform a de novo annotation > of one of my genome. In the meantime, I worked on other topics and, > yesterday, when I tried to annotate another genome, MAKER was not working. > The following message was appearing: > > BLAST engine error: Warning: Sequence contains no data > deleted:0 hits > stop here: NODE_1_length_465927_cov_94.9908 > ERROR: Fasta index error > at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 1095. > Process::MpiChunk::__ANON__() called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm > line 415 > eval {...} called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm > line 407 > Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 4224 > Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', > 'HASH(0x4cca458)', 3, 0) called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 341 > Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) > called at ../../bin/maker line 1614 > main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 > --> rank=2, hostname=SRV-WGS > ERROR: Failed while preparing masked sequence > ERROR: Chunk failed at level:3, tier_type:0 > FAILED CONTIG:NODE_1_length_465927_cov_94.9908 > > I tried to solve the problem (re-install Repeatmasker and blast, check > location of the several executables, check tmp folder, re-install MAKER, > etc) but still, I am not able to solve the problem. > Could you please help me out with this? Thank you so much. > > Cheers, > Isabel > > ************************************************* > Isabel MARCELINO, PhD > Unit? Environnement Sant? > Institut Pasteur de Guadeloupe > Morne Jolivi?re - B.P. 484 > 97183 LES ABYMES Cedex > Guadeloupe, FWI > > > > > Garanti > sans virus. www.avast.com > > _______________________________________________ > maker-devel mailing list > maker... at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 12:00:26 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:00:26 -0600 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Message-ID: It can also be that your temporary directory became full at one point or you set TMP= to a location that is not a local disk (i.e. set it to a network mounted storage location). The fasta index is based off of BerkleyDB which has issues if run of of network storage. In any case just restart, and it will probably get past the error on the retry. ?Carson > On Aug 23, 2017, at 10:57 AM, Ence,daniel wrote: > > Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? > > ~Daniel > > > >> On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: >> >> >> ---------- Forwarded message ---------- >> From: Isabel Marcelino > >> Date: 23 August 2017 at 11:37 >> Subject: Errors with Blast engine and Fasta index >> To: maker-devel at googlegroups.com >> >> >> Hello, >> >> I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. >> The following message was appearing: >> >> BLAST engine error: Warning: Sequence contains no data >> deleted:0 hits >> stop here: NODE_1_length_465927_cov_94.9908 >> ERROR: Fasta index error >> at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. >> Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 >> eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 >> Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 >> Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 >> Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 >> main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 >> --> rank=2, hostname=SRV-WGS >> ERROR: Failed while preparing masked sequence >> ERROR: Chunk failed at level:3, tier_type:0 >> FAILED CONTIG:NODE_1_length_465927_cov_94.9908 >> >> I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. >> Could you please help me out with this? Thank you so much. >> >> Cheers, >> Isabel >> >> ************************************************* >> Isabel MARCELINO, PhD >> Unit? Environnement Sant? >> Institut Pasteur de Guadeloupe >> Morne Jolivi?re - B.P. 484 >> 97183 LES ABYMES Cedex >> Guadeloupe, FWI >> >> >> >> Garanti sans virus. www.avast.com _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 11:57:30 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 11:57:30 -0600 Subject: [maker-devel] question about FASTA warnings In-Reply-To: References: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Message-ID: <725B8728-A7F7-4F60-80C7-D842240D67F9@gmail.com> They are warnings from makeblastdb. It depends on what version of BLAST you have installed. Either upgrade or downgrade to get them to go away. They are just warnings and not errors though, so you can safely ignore them. They are just really annoying. ?Carson > On Aug 23, 2017, at 10:47 AM, Daniel Ence wrote: > > Hi Chris, I haven?t seen that warning either in my usage of MAKER. My guess is that the version of Repeatmasker installed on your cluster has this warning and expects a certain format in the fasta headers. This could be checked by looking at the TE protein file that maker is using. Do you have access to that? > > In any case it probably isn?t an issue that needs to be fixed if the output otherwise looks good. > > ~Daniel > > > >> On Aug 23, 2017, at 12:26 PM, Willett, Christopher S > wrote: >> >> Hello- >> >> I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. >> >> Thanks for your help, >> >> Best, >> >> Chris Willett >> >> here is a portion of the run log with some examples of the warnings: >> >> ------------------------------------------------------------ >> # LSBATCH: User input >> maker >> ------------------------------------------------------------ >> >> Successfully completed. >> >> Resource usage summary: >> >> CPU time : 59.63 sec. >> Total Requested Memory : 0.50 GB >> Delta Memory : - >> Max Processes : 7 >> Max Threads : 8 >> Run time : 47 sec. >> Turnaround time : 55 sec. >> >> The output (if any) follows: >> >> STATUS: Parsing control files... >> STATUS: Processing and indexing input FASTA files... >> STATUS: Setting up database for any GFF3 input... >> A data structure will be created for you at: >> /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore >> >> To access files for individual sequences use the datastore index: >> /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log >> >> STATUS: Now running MAKER... >> examining contents of the fasta file and run log >> >> >> >> --Next Contig-- >> >> #--------------------------------------------------------------------- >> Now starting the contig!! >> SeqID: contig-dpp-500-500 >> Length: 32156 >> #--------------------------------------------------------------------- >> >> >> setting up GFF3 output and fasta chunks >> doing repeat masking >> running repeat masker. >> #--------- command -------------# >> Widget::RepeatMasker: >> cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 >> #-------------------------------# >> doing blastx repeats >> formating database... >> #--------- command -------------# >> Widget::formater: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 >> #-------------------------------# >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> running blast search. >> #--------- command -------------# >> Widget::blastx: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner >> #-------------------------------# >> deleted:0 hits >> doing blastx repeats >> formating database... >> #--------- command -------------# >> Widget::formater: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 >> #-------------------------------# >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) >> >> (continues on as above but title lengths are different) >> >> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ >> Research Associate Professor >> Department of Biology >> CB#3280 Coker Hall >> University of North Carolina, Chapel Hill >> Chapel Hill, NC, 27599-3280 >> >> Office: 2252 Genome Science Building >> phone: >> 919-843-8663 >> fax: >> 919-962-1625 >> >> http://labs.bio.unc.edu/Willett/ >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 12:10:44 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:10:44 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: > (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". > I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? Try Swiss-Prot. That is a well curated cross species set. > (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). > > In the file "maker_opts.ctl" > #-----Repeat Masking (leave values blank to skip repeat masking) > model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker > rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker Yes. Supply both. ?Carson -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Wed Aug 23 12:20:51 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Wed, 23 Aug 2017 18:20:51 +0000 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> Message-ID: Hi Isabel, if the issue isn?t with the fasta file itself, then I would look into the things that Carson suggested: out of memory issues on the disk where the TMP directory is located, etc. ~Daniel On Aug 23, 2017, at 1:38 PM, Isabel Marcelino > wrote: Hi Daniel, Thank you for your feedback. In fact, my fasta entry is not empty (please see below). I even tried to reprocess the genome fasta file that I already processed using MAKER and it doesn't work either... Isabel (PS: I do not manage to "reply" your message but only "forward" it. I was wondering if there are any settings I should change? I participate in other google groups and I can "reply" to messages. Thanks for the help) (>NODE_1_length_465927_cov_94.9908 ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....) On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote: Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? ~Daniel On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: ---------- Forwarded message ---------- From: Isabel Marcelino > Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker... at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI [https://lh6.googleusercontent.com/proxy/JjzEPM_1UQiAcgcIii9zH3waHJfrDmD6mwOpzjvKSWAzeFyvEmJKxjsfyB4-JKbN4o_rmMG0O6UuV95TfuAG3NaBCtKzucfHCUODobStNrGqQJzTwuEOKfxUSFySxNn_igewCYnfXbgJP-gAq2cupOvC=w5000-h5000] Garanti sans virus. www.avast.com _______________________________________________ maker-devel mailing list maker... at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 12:21:44 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:21:44 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> Message-ID: <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> > Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? We don?t have an externally editable wiki, but the mailing list is archived on google groups and is searchable. > As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). Related to this, I just got off of a conference call where we were looking at Augustus behavior, and a student did an experiment where they introduced early stop codons into 100 genes, then let Augustus predict again. 80% of the time Augustus altered splicing patterns to try and jump over the stop codon, 11% of the time it would truncate the transcript, and 9% of the time it would refuse to call anything. So when you see splicing errors, it is usually because something is affecting the ORF somewhere, so it alters splicing to extend the ORF to get the maximum scoring bonus by capturing downstream parts of features en hints > A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) MAKER only annotates tRNA?s and whatever snoscan annotates. It does not annotated any other non-coding features. ?Carson From carsonhh at gmail.com Wed Aug 23 12:25:24 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:25:24 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> Message-ID: Sorry 19,000 genes and not 100 genes in the Augustus test. ?Carson > On Aug 23, 2017, at 12:21 PM, Carson Holt wrote: > >> Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? > > We don?t have an externally editable wiki, but the mailing list is archived on google groups and is searchable. > > >> As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). > > Related to this, I just got off of a conference call where we were looking at Augustus behavior, and a student did an experiment where they introduced early stop codons into 100 genes, then let Augustus predict again. 80% of the time Augustus altered splicing patterns to try and jump over the stop codon, 11% of the time it would truncate the transcript, and 9% of the time it would refuse to call anything. So when you see splicing errors, it is usually because something is affecting the ORF somewhere, so it alters splicing to extend the ORF to get the maximum scoring bonus by capturing downstream parts of features en hints > > >> A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) > > MAKER only annotates tRNA?s and whatever snoscan annotates. It does not annotated any other non-coding features. > > ?Carson From eennadi at gmail.com Sun Aug 27 08:16:03 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Sun, 27 Aug 2017 15:16:03 +0100 Subject: [maker-devel] Maker not installing Message-ID: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 07:00:11 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 13:00:11 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: Message-ID: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 07:57:22 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 13:57:22 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Message-ID: <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? Thanks, Daniel Ence On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9 ============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 08:07:14 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 14:07:14 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Message-ID: <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: Hi Daniel The reply is emmannamekasMBP:maker emmannaemeka$ MAKER -ctl -bash: MAKER: command not found Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? Thanks, Daniel Ence On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9 ============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 07:24:58 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 14:24:58 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Message-ID: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: > Hi Emmanuel, In order for anyone to help you, you need post to the mailing > list the command and output (including errors) of the step that didn?t > work. > > Thanks, > Daniel Ence > > > On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: > > Hello all, > > I downloaded Maker and tried to install it. I succeeded in installing all > prerequisites however running maker ./build install, it showed that maker > installed. > > However trying to run maker it wouldn't run. > > Please how do I install maker to run on local computer? > > Thanks > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 08:00:04 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 15:00:04 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Message-ID: Hi Daniel The reply is emmannamekasMBP:maker emmannaemeka$ MAKER -ctl -bash: MAKER: command not found Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel wrote: > Hi, It looks like MAKER installed ok. What is the command that you used to > try to run MAKER? Can you show the result of running ?MAKER -ctl?? > > Thanks, > Daniel Ence > > > On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi wrote: > > Hi Ence, > Thanks for your reply, > > This is the step and error received > > emmannamekasMBP:src emmannaemeka$ ./build install > Installing MAKER... > Building MAKER > Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) > > The build status is > ============================================================================= > STATUS MAKER v2.31.9============================================================================== > PERL Dependencies: VERIFIED > External Programs: VERIFIED > External C Libraries: VERIFIED > MPI SUPPORT: DISABLED > MWAS Web Interface: DISABLED > MAKER PACKAGE: CONFIGURATION OK > > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: > >> Hi Emmanuel, In order for anyone to help you, you need post to the >> mailing list the command and output (including errors) of the step that >> didn?t work. >> >> Thanks, >> Daniel Ence >> >> >> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: >> >> Hello all, >> >> I downloaded Maker and tried to install it. I succeeded in installing all >> prerequisites however running maker ./build install, it showed that maker >> installed. >> >> However trying to run maker it wouldn't run. >> >> Please how do I install maker to run on local computer? >> >> Thanks >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/ >> profile/Emmanuel_Nnadi/publications >> >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 28 09:49:32 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 28 Aug 2017 09:49:32 -0600 Subject: [maker-devel] Maker not installing In-Reply-To: <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: After install the executables will be in the ?/maker/bin directory. Example (if you did the install in your home directory) ?> ~/maker/bin/maker You need to add the ?/maker/bin directory to your PATH for it to be found just by typing ?maker' Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html ?Carson > On Aug 28, 2017, at 8:07 AM, Ence,daniel wrote: > > Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? > > > >> On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: >> >> Hi Daniel >> The reply is >> emmannamekasMBP:maker emmannaemeka$ MAKER -ctl >> -bash: MAKER: command not found >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >> On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: >> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >> >> Thanks, >> Daniel Ence >> >> >>> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: >>> >>> Hi Ence, >>> Thanks for your reply, >>> >>> This is the step and error received >>> emmannamekasMBP:src emmannaemeka$ ./build install >>> Installing MAKER... >>> Building MAKER >>> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >>> >>> The build status is >>> >>> ============================================================================= >>> STATUS MAKER v2.31.9 >>> ============================================================================== >>> PERL Dependencies: VERIFIED >>> External Programs: VERIFIED >>> External C Libraries: VERIFIED >>> MPI SUPPORT: DISABLED >>> MWAS Web Interface: DISABLED >>> MAKER PACKAGE: CONFIGURATION OK >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: >>> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. >>> >>> Thanks, >>> Daniel Ence >>> >>> >>>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: >>>> >>>> Hello all, >>>> >>>> I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. >>>> >>>> However trying to run maker it wouldn't run. >>>> >>>> Please how do I install maker to run on local computer? >>>> >>>> Thanks >>>> >>>> Nnadi Nnaemeka Emmanuel >>>> Department of Microbiology, >>>> Faculty of Natural and Applied Science, >>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>> >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >> >> > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 11:32:40 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 18:32:40 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: Thanks I tried to export PATH running echo $PATH in the maker directory this returned /usr/bin:/bin:/usr/sbin:/sbin:/opt/X11/bin:/Users/emmannaemeka/Desktop/Gpm/maker/bin/maker 1. Does it mean that PATH has been exported? secondly, I tried to run the command maker -h, which maker, maker -CTL nothing returned. 2. how do i start up maker? 3. Do I need to be in maker directory to start maker? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 4:49 PM, Carson Holt wrote: > After install the executables will be in the ?/maker/bin directory. > Example (if you did the install in your home directory) ?> ~/maker/bin/maker > > You need to add the ?/maker/bin directory to your PATH for it to be found > just by typing ?maker' > > Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html > > ?Carson > > > On Aug 28, 2017, at 8:07 AM, Ence,daniel wrote: > > Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the > result of ?which maker?? > > > > On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi wrote: > > Hi Daniel > The reply is > emmannamekasMBP:maker emmannaemeka$ MAKER -ctl > -bash: MAKER: command not found > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel wrote: > >> Hi, It looks like MAKER installed ok. What is the command that you used >> to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >> >> Thanks, >> Daniel Ence >> >> >> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi wrote: >> >> Hi Ence, >> Thanks for your reply, >> >> This is the step and error received >> >> emmannamekasMBP:src emmannaemeka$ ./build install >> Installing MAKER... >> Building MAKER >> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >> >> The build status is >> ============================================================================= >> STATUS MAKER v2.31.9============================================================================== >> PERL Dependencies: VERIFIED >> External Programs: VERIFIED >> External C Libraries: VERIFIED >> MPI SUPPORT: DISABLED >> MWAS Web Interface: DISABLED >> MAKER PACKAGE: CONFIGURATION OK >> >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/ >> profile/Emmanuel_Nnadi/publications >> >> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: >> >>> Hi Emmanuel, In order for anyone to help you, you need post to the >>> mailing list the command and output (including errors) of the step that >>> didn?t work. >>> >>> Thanks, >>> Daniel Ence >>> >>> >>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: >>> >>> Hello all, >>> >>> I downloaded Maker and tried to install it. I succeeded in installing >>> all prerequisites however running maker ./build install, it showed that >>> maker installed. >>> >>> However trying to run maker it wouldn't run. >>> >>> Please how do I install maker to run on local computer? >>> >>> Thanks >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/ >>> profile/Emmanuel_Nnadi/publications >>> >>> >>> _______________________________________________ >>> maker-devel mailing list >>> maker-devel at box290.bluehost.com >>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >>> >> >> > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 28 11:36:51 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 28 Aug 2017 11:36:51 -0600 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: <8EAFE412-9EF7-4DB7-85A3-632BAC3372FD@gmail.com> Path needs to be a list of directories to search (you specified an executable location). So not this ?> /Users/emmannaemeka/Desktop/Gpm/maker/bin/maker Instead it needs to be this ?> /Users/emmannaemeka/Desktop/Gpm/maker/bin ?Carson > On Aug 28, 2017, at 11:32 AM, Emmanuel Nnadi > wrote: > > Thanks > > I tried to export PATH > > running > echo $PATH in the maker directory this returned > > /usr/bin:/bin:/usr/sbin:/sbin:/opt/X11/bin:/Users/emmannaemeka/Desktop/Gpm/maker/bin/maker > > 1. Does it mean that PATH has been exported? > > > secondly, > > I tried to run > the command maker -h, which maker, maker -CTL > > nothing returned. > > 2. how do i start up maker? > 3. Do I need to be in maker directory to start maker? > > Thanks > > > > > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications > On Mon, Aug 28, 2017 at 4:49 PM, Carson Holt > wrote: > After install the executables will be in the ?/maker/bin directory. Example (if you did the install in your home directory) ?> ~/maker/bin/maker > > You need to add the ?/maker/bin directory to your PATH for it to be found just by typing ?maker' > > Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html > > ?Carson > > >> On Aug 28, 2017, at 8:07 AM, Ence,daniel > wrote: >> >> Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? >> >> >> >>> On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: >>> >>> Hi Daniel >>> The reply is >>> emmannamekasMBP:maker emmannaemeka$ MAKER -ctl >>> -bash: MAKER: command not found >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>> On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: >>> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >>> >>> Thanks, >>> Daniel Ence >>> >>> >>>> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: >>>> >>>> Hi Ence, >>>> Thanks for your reply, >>>> >>>> This is the step and error received >>>> emmannamekasMBP:src emmannaemeka$ ./build install >>>> Installing MAKER... >>>> Building MAKER >>>> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >>>> >>>> The build status is >>>> >>>> ============================================================================= >>>> STATUS MAKER v2.31.9 >>>> ============================================================================== >>>> PERL Dependencies: VERIFIED >>>> External Programs: VERIFIED >>>> External C Libraries: VERIFIED >>>> MPI SUPPORT: DISABLED >>>> MWAS Web Interface: DISABLED >>>> MAKER PACKAGE: CONFIGURATION OK >>>> >>>> Nnadi Nnaemeka Emmanuel >>>> Department of Microbiology, >>>> Faculty of Natural and Applied Science, >>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: >>>> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. >>>> >>>> Thanks, >>>> Daniel Ence >>>> >>>> >>>>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: >>>>> >>>>> Hello all, >>>>> >>>>> I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. >>>>> >>>>> However trying to run maker it wouldn't run. >>>>> >>>>> Please how do I install maker to run on local computer? >>>>> >>>>> Thanks >>>>> >>>>> Nnadi Nnaemeka Emmanuel >>>>> Department of Microbiology, >>>>> Faculty of Natural and Applied Science, >>>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>>> >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>> >>> >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 30 08:01:02 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 30 Aug 2017 10:01:02 -0400 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: Dear Carson: Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? Thanks Best Quanwei 2017-08-23 14:10 GMT-04:00 Carson Holt : > > (1) For the predicted unknown (unclassified) repeat sequences (those in > Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were > searched against a transposase database (derived from RepeatMaske > r) and sequences matching transposase were > considered as transposons belonging to the relevant superfamily". > I wonder how to do this search. Annotate the "unknown" repeat sequences > using the Repeatmaker? Then what to do, if for an "unknown" repeat > sequence, only part of the sequence match the known repeat elements. > > > You can use RepBase match I guess, but I would not be overly worried about > classification. MAKER won?t use any classification info you give it. > > > (2) To exclude gene fragments, I need map the predicted repeat sequences > against a protein database, and then run the package "ProExcluder"*. * > Right? I wonder how to get such protein database. Since I am working on > a new rodent species, can I use all the rodent proteins from Uniprot (both > Swiss-Prot and TrEMBL)? > > > Try Swiss-Prot. That is a well curated cross species set. > > > (3) After I generate the species specific repeat library, do I still need > to select a model organism for RepBase masking (as shown below). > > In the file "maker_opts.ctl" > #-----Repeat Masking (leave values blank to skip repeat masking) > model_org=Mammalia #select a model organism for RepBase masking in > RepeatMasker > rmlib=myRepeat.fa #provide an organism specific repeat library in fasta > format for RepeatMasker > > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 30 08:21:15 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 30 Aug 2017 10:21:15 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> Message-ID: Dear Daniel: Thank you! I am running it on an unmasked genome. Just want to make sure it is the correct way. Have a nice day! Best Quanwei 2017-08-30 10:19 GMT-04:00 Daniel Ence : > Hi Quanwei, > > I think you should run it on an unmasked genome. I don?t think that > redundancy between repeat libraries will be an issue. > > Thanks, > Daniel > > > > On Aug 30, 2017, at 10:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the > species specific repeat library. I wonder whether I need to remove the > masked the regions by existing repeatMasker library, before I run > repeatModeler? I think there may be some redundancy if I run repeatModeler > directly on the genome and then use both existing repeatMasker library and > the repeatModeler library to mask the genome. Does it matter, if there is > such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt : > >> >> (1) For the predicted unknown (unclassified) repeat sequences (those in >> Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were >> searched against a transposase database (derived from RepeatMaske >> r) and sequences matching transposase were >> considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences >> using the Repeatmaker? Then what to do, if for an "unknown" repeat >> sequence, only part of the sequence match the known repeat elements. >> >> >> You can use RepBase match I guess, but I would not be overly worried >> about classification. MAKER won?t use any classification info you give it. >> >> >> (2) To exclude gene fragments, I need map the predicted repeat sequences >> against a protein database, and then run the package "ProExcluder"*. * >> Right? I wonder how to get such protein database. Since I am working on >> a new rodent species, can I use all the rodent proteins from Uniprot (both >> Swiss-Prot and TrEMBL)? >> >> >> Try Swiss-Prot. That is a well curated cross species set. >> >> >> (3) After I generate the species specific repeat library, do I still need >> to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in >> RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta >> format for RepeatMasker >> >> >> Yes. Supply both. >> >> >> ?Carson >> > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From lcampbell at ebi.ac.uk Wed Aug 30 03:41:48 2017 From: lcampbell at ebi.ac.uk (Lahcen Campbell) Date: Wed, 30 Aug 2017 10:41:48 +0100 Subject: [maker-devel] Processing contig output - MPI job fail Message-ID: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> Hello folks, Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) /............/ /clustering transcripts into genes for annotations// //Processing transcripts into genes// //adding statistics to annotations// //Calculating annotation quality statistics// //choosing best annotation set// //Choosing best annotations// //processing chunk output// //processing contig output/ However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. *_The following error output was captured_*/*_:_* / Calculating annotation quality statistics choosing best annotation set Choosing best annotations processing chunk output processing contig output [proxy:0:0 at loom7.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:0 at loom7.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:0 at loom7.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:4 at loom6.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [mpiexec at loom7.ebi.ac.uk] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting [mpiexec at loom7.ebi.ac.uk] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. Any hints or insight on this would be greatly appreciated. Thank you in advance, Lahcen EBI-Hinxton, UK. -------------- next part -------------- An HTML attachment was scrubbed... URL: From lahcencampbell at gmail.com Wed Aug 30 03:44:03 2017 From: lahcencampbell at gmail.com (lahcen campbell) Date: Wed, 30 Aug 2017 10:44:03 +0100 Subject: [maker-devel] Processing contig output - MPI job fail Message-ID: *REPOSTED UNDER CORRECTED SUBSCRIBED MEMBER EMAIL ACCOUNT.* Hello folks, Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) *............* *clustering transcripts into genes for annotations* *Processing transcripts into genes* *adding statistics to annotations* *Calculating annotation quality statistics* *choosing best annotation set* *Choosing best annotations* *processing chunk output* *processing contig output* However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. *The following error output was captured* *: * Calculating annotation quality statistics choosing best annotation set Choosing best annotations processing chunk output processing contig output [proxy:0:0 at loom7.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:0 at loom7.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:0 at loom7.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:4 at loom6.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [mpiexec at loom7.ebi.ac.uk] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting [mpiexec at loom7.ebi.ac.uk] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. Any hints or insight on this would be greatly appreciated. Thank you in advance, Lahcen EBI-Hinxton, UK. -- ========================================== > Dr. Lahcen Campbell < > Contact: lahcencampbell at gmail.com < > https://www.ebi.ac.uk/about/people/lahcen-campbell < ========================================== -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Wed Aug 30 08:19:13 2017 From: dandence at gmail.com (Daniel Ence) Date: Wed, 30 Aug 2017 10:19:13 -0400 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> Hi Quanwei, I think you should run it on an unmasked genome. I don?t think that redundancy between repeat libraries will be an issue. Thanks, Daniel > On Aug 30, 2017, at 10:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt >: > >> (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. > > You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > > >> (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? > > Try Swiss-Prot. That is a well curated cross species set. > > >> (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 30 08:53:48 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 30 Aug 2017 08:53:48 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: You don?t need to worry about redundancy. ?Carson > On Aug 30, 2017, at 8:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt >: > >> (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. > > You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > > >> (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? > > Try Swiss-Prot. That is a well curated cross species set. > > >> (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 30 08:55:02 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 30 Aug 2017 08:55:02 -0600 Subject: [maker-devel] Processing contig output - MPI job fail In-Reply-To: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> References: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> Message-ID: MAKER will start up where it left off as long as the settings are identical between runs. ?Carson > On Aug 30, 2017, at 3:41 AM, Lahcen Campbell wrote: > > Hello folks, > Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. > I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) > ............ > > clustering transcripts into genes for annotations > Processing transcripts into genes > adding statistics to annotations > Calculating annotation quality statistics > choosing best annotation set > Choosing best annotations > processing chunk output > processing contig output > > However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. > The following error output was captured: > > Calculating annotation quality statistics > choosing best annotation set > Choosing best annotations > processing chunk output > processing contig output > > [proxy:0:0 at loom7.ebi.ac.uk ] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:0 at loom7.ebi.ac.uk ] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:0 at loom7.ebi.ac.uk ] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:4 at loom6.ebi.ac.uk ] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:4 at loom6.ebi.ac.uk ] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:4 at loom6.ebi.ac.uk ] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [mpiexec at loom7.ebi.ac.uk ] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting > [mpiexec at loom7.ebi.ac.uk ] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion > [mpiexec at loom7.ebi.ac.uk ] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion > [mpiexec at loom7.ebi.ac.uk ] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion > > Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. > > Any hints or insight on this would be greatly appreciated. > > Thank you in advance, > > Lahcen > > EBI-Hinxton, UK. > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Tue Aug 1 07:32:44 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Tue, 1 Aug 2017 09:32:44 -0400 Subject: [maker-devel] Pseudogene identification In-Reply-To: References: Message-ID: Hi Carson: I took a look at the description about the pipe line of pseudogene identification. In my understanding it will use the annotated (predicted by Maker2) protein coding genes as input (i.e., query sequences), search in the intergenic spaces (so annotated genes will not be checked) and find the regions where show certain level of similarity to the annotated genes. If my understanding is correct, I think it is not what I want to do get. Based on the annotated coding genes from Maker2, we found some genes are under expansion in the new species. We want to check and make sure all the gene copies in the expanded gene family really function (to make sure they are not pseudogenes). Do you think the pseudogene identification pipe line of Maker2 can be helpful for my goal? Or do you have any suggestions on this? Many thanks Best Quanwei 2017-07-31 19:54 GMT-04:00 Carson Holt : > The MAKER-P fork was merged back into standard MAKER with version 2.29 > (roughly 3 years ago - a separate download no longer exists). This is > because MAKER-P?s functionality is almost entirely in accessory scripts and > written protocols. The ?/maker/bin/maker called by both MAKER2 and MAKER-P > is actually the same script. So no need to rerun, because if you are using > version 2.29 or later, you already ran it. > > Pseudogene calling is therefore handled by accessory scripts and protocols > you can find here ?> http://shiulab.plantbiology.msu.edu/wiki/ > index.php/Protocol:Pseudogene > > The other MAKER-P protocols can be found here ?> > http://www.yandell-lab.org/software/maker-p.html > > --Carson > > > > On Jul 31, 2017, at 5:02 PM, Quanwei Zhang wrote: > > Hello: > > We used Maker2 to annotate a new rodent genome. By using the annotated > genes we did gene family expansion analysis, and found several gene > families under expansion in the new rodent genome. But we want to check > whether some annotated genes are Pseudogenes, which lead to the expansion. > Do you have any suggestions on this? > > We found the Maker-P can annotate Pseudogene, but we are not sure whether > it is worth to repeat our annotation with Maker-P. Besides, we are not sure > whether the default parameters of Maker-P are good for a rodent species. > What's more, in my understanding the Maker-P will identify Pseudogenes in > the intergenic spaces (which I think the annotated coding genes will be not > be tested and checked). > > Do you have any suggestions to solve our problem? We do not want to > identify Pseudogene on the genome wide, but only want to check those genes > showing expansion (to make sure all those gene copies really function). > > Many thanks > > Best > Quanwei > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From nathan.ricks at gmail.com Tue Aug 1 15:51:25 2017 From: nathan.ricks at gmail.com (Nathan Ricks) Date: Tue, 1 Aug 2017 15:51:25 -0600 Subject: [maker-devel] Output of fasta_merge Message-ID: When I run the command fasta_merge it produces a number of different files: .all.maker.model_gff%3Amaker.proteins.fasta .all.maker.non_overlapping_ab_initio.proteins.fasta .all.maker.snap_masked.proteins.fasta .all.maker.proteins.fasta I was wondering what the difference between these files is Thank you for your time -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 1 15:58:36 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 1 Aug 2017 15:58:36 -0600 Subject: [maker-devel] Output of fasta_merge In-Reply-To: References: Message-ID: <3348C5BF-8342-4E2B-88BF-1AF4558D4169@gmail.com> From the list archives ?> https://groups.google.com/forum/#!searchin/maker-devel/output$20files%7Csort:relevance/maker-devel/43hN_LDQv6c/SWpyYejGiqcJ Also described in ?/maker/README under the "MAKER OUTPUT" section. ?Carson > On Aug 1, 2017, at 3:51 PM, Nathan Ricks wrote: > > When I run the command fasta_merge it produces a number of different files: > .all.maker.model_gff%3Amaker.proteins.fasta > .all.maker.non_overlapping_ab_initio.proteins.fasta > .all.maker.snap_masked.proteins.fasta > .all.maker.proteins.fasta > > I was wondering what the difference between these files is > Thank you for your time > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From nathan.ricks at gmail.com Wed Aug 2 15:33:35 2017 From: nathan.ricks at gmail.com (Nathan Ricks) Date: Wed, 2 Aug 2017 15:33:35 -0600 Subject: [maker-devel] (no subject) Message-ID: As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ -------------- next part -------------- An HTML attachment was scrubbed... URL: From cjfields at illinois.edu Thu Aug 3 09:14:06 2017 From: cjfields at illinois.edu (Fields, Christopher J) Date: Thu, 3 Aug 2017 15:14:06 +0000 Subject: [maker-devel] (no subject) In-Reply-To: References: Message-ID: If you have a fairly recent version of Bioperl (now at 1.7.1) this should not be an issue within bioperl (note this isn?t a bug per se, just that the default universal codon table has rare codons so we simply added a ?strict? alternative table). Also, based on that thread Carson also added a workaround in MAKER explicitly setting a ?strict? codon table that should be in 3.00. chris From: maker-devel on behalf of Nathan Ricks Date: Wednesday, August 2, 2017 at 9:54 PM To: "maker-devel at yandell-lab.org" Subject: [maker-devel] (no subject) As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Thu Aug 3 09:27:51 2017 From: carsonhh at gmail.com (Carson Holt) Date: Thu, 3 Aug 2017 09:27:51 -0600 Subject: [maker-devel] (no subject) In-Reply-To: References: Message-ID: <29E5FB26-0670-4EF1-A5E5-CB10EDC228BD@gmail.com> Correct. Current MAKER 2.31.9 AND 3.00 beta have the strict codon table workaround for BioPerl. MAKER?s default behavior is to use the same ORF given to it be the predictor and alter start codon if MAKER itself is able to add extra sequence that can extend the ORF during the UTR addition phase and find a start codon. But if you set alway_complete=1 in the options, it will walk upstream and downstream to find start/stop codons in the surrounding sequence even if it has to add sequence to the exons. Thanks, Carson > On Aug 3, 2017, at 9:14 AM, Fields, Christopher J wrote: > > If you have a fairly recent version of Bioperl (now at 1.7.1) this should not be an issue within bioperl (note this isn?t a bug per se, just that the default universal codon table has rare codons so we simply added a ?strict? alternative table). > > Also, based on that thread Carson also added a workaround in MAKER explicitly setting a ?strict? codon table that should be in 3.00. > > chris > > From: maker-devel > on behalf of Nathan Ricks > > Date: Wednesday, August 2, 2017 at 9:54 PM > To: "maker-devel at yandell-lab.org " > > Subject: [maker-devel] (no subject) > > As I have been submitting my genome sequences to NCBI, I've come to realise that about 1/10 of the transcripts generated have an incorrect start codon. When I look at the genes manually, they usually have a start codon 3 or 6 base pairs away. What could be causing this? > I read about a previous issue where there was a mistake in Bioperl and the fix was implemented many version ago. I have maker version 3.00 > > https://groups.google.com/forum/#!searchin/maker-devel/start$20codon|sort:relevance/maker-devel/S0j1fJ4LjVY/5ugSG01kKkUJ _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From jltan at mmu.edu.my Tue Aug 8 01:33:01 2017 From: jltan at mmu.edu.my (jltan at mmu.edu.my) Date: Tue, 8 Aug 2017 15:33:01 +0800 Subject: [maker-devel] Problem with MAKER installation Message-ID: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> Hi, I am installing MAKER to annotate a fungus genome. However, I experienced issue with "Argument "2.53_01" isn't numeric in numeric ge (>=) at /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . I aware that the issue arise because of the "_" in the "2.53_01" however I have no idea on how to solve it. Would you mind to give advice on this matter? Thank you. Best regards, Dr. Joon Liang Tan PhD, Bsc (Hons) Lecturer (Bioinformatics Programme) Faculty of Information Science and Technology (FIST) Multimedia University 75450 Melaka Malaysia Phone: +60 62524813 From patrick_michael.chiuco at upd.edu.ph Thu Aug 10 05:35:47 2017 From: patrick_michael.chiuco at upd.edu.ph (Patrick Michael Chiuco) Date: Thu, 10 Aug 2017 19:35:47 +0800 Subject: [maker-devel] split_fasta script In-Reply-To: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> References: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> Message-ID: <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> Hi! Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline [1] we're currently using. Thanks! Patrick Links: ------ [1] https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1426-6 -------------- next part -------------- An HTML attachment was scrubbed... URL: From zachary.pcohen at gmail.com Fri Aug 11 12:43:58 2017 From: zachary.pcohen at gmail.com (Zach Cohen) Date: Fri, 11 Aug 2017 18:43:58 +0000 Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Hello All, I'm receiving a RepeatMasker on some (not all) of my scaffolds. *Widget::RepeatMasker:* *cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2* *#-------------------------------#* *ERROR: RepeatMasker failed* *--> rank=NA, hostname=82853d8df2a5* *ERROR: Failed while doing repeat masking* *ERROR: Chunk failed at level:0, tier_type:1* FAILED CONTIG:scaffold2852_size18614 *ERROR: Chunk failed at level:2, tier_type:0* *FAILED CONTIG:scaffold2852_size18614* *examining contents of the fasta file and run log* I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! Best, Z -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Fri Aug 11 23:53:49 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 11 Aug 2017 23:53:49 -0600 Subject: [maker-devel] split_fasta script In-Reply-To: <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> References: <24fa28b51dd0cae1c7f52e34a17c2768@smicro00.upd.edu.ph> <56824384580b99132afdba6167d0d0b0@smicro00.upd.edu.ph> Message-ID: <10D08630-4EA1-40EC-9939-0717E7F9BF25@gmail.com> split_fasta was deprecated quite a while ago (2010) and replaced by fasta_tool. I was able to find an old copy in the subversion repository, I can?t guarantee it will work as expected though with how much other libraries in maker have changed since then. ?Carson > On Aug 10, 2017, at 5:35 AM, Patrick Michael Chiuco wrote: > > > Hi! > > Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline we're currently using. Thanks! > > Patrick > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: split_fasta Type: application/octet-stream Size: 1405 bytes Desc: not available URL: -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Sat Aug 12 00:00:24 2017 From: carsonhh at gmail.com (Carson Holt) Date: Sat, 12 Aug 2017 00:00:24 -0600 Subject: [maker-devel] Problem with MAKER installation In-Reply-To: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> References: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel@mlkstf.mmu.edu.my> Message-ID: <71E16226-8E3D-4F68-9877-5D26B33B936D@gmail.com> You may need to reinstall your forks and forks::shared modules. If you use CPAN, you can use the ?force? option to do this. Also if forks is broken, other modules may be as well, so you may get another error in another module after the reinstall (then you will have to reinstall that module). This can possibly be caused by a processor version issue if this is a cluster with mixed architectures (old vs new Intel chips or AMD vs Intel), or it can be due to a system update breaking dynamically linked C libraries. ?Carson > On Aug 8, 2017, at 1:33 AM, jltan at mmu.edu.my wrote: > > Hi, > > I am installing MAKER to annotate a fungus genome. However, I experienced > issue with > "Argument "2.53_01" isn't numeric in numeric ge (>=) at > /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . > > I aware that the issue arise because of the "_" in the "2.53_01" however I > have no idea on how to solve it. > > Would you mind to give advice on this matter? > > Thank you. > > > > Best regards, > > Dr. Joon Liang Tan > PhD, Bsc (Hons) > Lecturer (Bioinformatics Programme) > Faculty of Information Science and Technology (FIST) > Multimedia University > 75450 Melaka > Malaysia > Phone: +60 62524813 > > > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org From carsonhh at gmail.com Mon Aug 14 11:30:33 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 14 Aug 2017 11:30:33 -0600 Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly In-Reply-To: References: Message-ID: If running under MPI, you can get messages from multiple processes (slightly out of order), in which case the more descript cause of the error may be further upstream in the STDERR log. If running without MPI, and the error you see is matched with the Widget::RepeatMasker command used, then you can simply copy it and run it outside of MAKER. If there are installation issues with your RepeatMasker copy then the cause will become more apparent. i.e. Run the command by itself ?> /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 ?Carson > On Aug 11, 2017, at 12:43 PM, Zach Cohen wrote: > > Hello All, > I'm receiving a RepeatMasker on some (not all) of my scaffolds. > Widget::RepeatMasker: > > cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 > > #-------------------------------# > > ERROR: RepeatMasker failed > > --> rank=NA, hostname=82853d8df2a5 > > ERROR: Failed while doing repeat masking > > ERROR: Chunk failed at level:0, tier_type:1 > > FAILED CONTIG:scaffold2852_size18614 > > ERROR: Chunk failed at level:2, tier_type:0 > > FAILED CONTIG:scaffold2852_size18614 > > examining contents of the fasta file and run log > > > > I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! > > Best, > > Z > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Mon Aug 14 12:59:16 2017 From: chzelin at gmail.com (zl c) Date: Mon, 14 Aug 2017 14:59:16 -0400 Subject: [maker-devel] maker MPI problem Message-ID: Hello, I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? CMD: export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so export OMPI_MCA_mpi_warn_on_fork=0 mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] Ph.D. NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: run05.mpi.o47346077 Type: application/octet-stream Size: 60803 bytes Desc: not available URL: From chzelin at gmail.com Mon Aug 14 13:11:01 2017 From: chzelin at gmail.com (zl c) Date: Mon, 14 Aug 2017 15:11:01 -0400 Subject: [maker-devel] maker problem large number of files Message-ID: Hello, Besides, Maker produces large number of temporary files. Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 14 13:18:22 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 14 Aug 2017 13:18:22 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: Message-ID: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> This is rather vague ?> ?crashed the computer cluster? Do you have a specific error? ?Carson > On Aug 14, 2017, at 12:59 PM, zl c wrote: > > Hello, > > > I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? > > > CMD: > > export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so > > export OMPI_MCA_mpi_warn_on_fork=0 > > mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta > > > Thanks, > > Zelin Chen > > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] Ph.D. > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From alyce.fowler at bayer.com Mon Aug 14 13:20:55 2017 From: alyce.fowler at bayer.com (Alyce Fowler) Date: Mon, 14 Aug 2017 19:20:55 +0000 Subject: [maker-devel] unsubscribe Message-ID: -----Original Message----- From: maker-devel [mailto:maker-devel-bounces at yandell-lab.org] On Behalf Of maker-devel-request at yandell-lab.org Sent: Monday, August 14, 2017 1:31 PM To: maker-devel at yandell-lab.org Subject: maker-devel Digest, Vol 111, Issue 3 Send maker-devel mailing list submissions to maker-devel at yandell-lab.org To subscribe or unsubscribe via the World Wide Web, visit http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org or, via email, send a message with subject or body 'help' to maker-devel-request at yandell-lab.org You can reach the person managing the list at maker-devel-owner at yandell-lab.org When replying, please edit your Subject line so it is more specific than "Re: Contents of maker-devel digest..." Today's Topics: 1. Problem with MAKER installation (jltan at mmu.edu.my) 2. split_fasta script (Patrick Michael Chiuco) 3. Inconsistent RepeatMasker error on draft assembly (Zach Cohen) 4. Re: split_fasta script (Carson Holt) 5. Re: Problem with MAKER installation (Carson Holt) 6. Re: Inconsistent RepeatMasker error on draft assembly (Carson Holt) ---------------------------------------------------------------------- Message: 1 Date: Tue, 8 Aug 2017 15:33:01 +0800 From: jltan at mmu.edu.my To: maker-devel at yandell-lab.org Subject: [maker-devel] Problem with MAKER installation Message-ID: <9195bfedc7cb1147cf1df917d59ccb8b.squirrel at mlkstf.mmu.edu.my> Content-Type: text/plain;charset=iso-8859-1 Hi, I am installing MAKER to annotate a fungus genome. However, I experienced issue with "Argument "2.53_01" isn't numeric in numeric ge (>=) at /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . I aware that the issue arise because of the "_" in the "2.53_01" however I have no idea on how to solve it. Would you mind to give advice on this matter? Thank you. Best regards, Dr. Joon Liang Tan PhD, Bsc (Hons) Lecturer (Bioinformatics Programme) Faculty of Information Science and Technology (FIST) Multimedia University 75450 Melaka Malaysia Phone: +60 62524813 ------------------------------ Message: 2 Date: Thu, 10 Aug 2017 19:35:47 +0800 From: Patrick Michael Chiuco To: maker-devel at yandell-lab.org Subject: [maker-devel] split_fasta script Message-ID: <56824384580b99132afdba6167d0d0b0 at smicro00.upd.edu.ph> Content-Type: text/plain; charset="utf-8" Hi! Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline [1] we're currently using. Thanks! Patrick Links: ------ [1] https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1426-6 -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 3 Date: Fri, 11 Aug 2017 18:43:58 +0000 From: Zach Cohen To: maker-devel at yandell-lab.org Subject: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Content-Type: text/plain; charset="utf-8" Hello All, I'm receiving a RepeatMasker on some (not all) of my scaffolds. *Widget::RepeatMasker:* *cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2* *#-------------------------------#* *ERROR: RepeatMasker failed* *--> rank=NA, hostname=82853d8df2a5* *ERROR: Failed while doing repeat masking* *ERROR: Chunk failed at level:0, tier_type:1* FAILED CONTIG:scaffold2852_size18614 *ERROR: Chunk failed at level:2, tier_type:0* *FAILED CONTIG:scaffold2852_size18614* *examining contents of the fasta file and run log* I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! Best, Z -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 4 Date: Fri, 11 Aug 2017 23:53:49 -0600 From: Carson Holt To: Patrick Michael Chiuco Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] split_fasta script Message-ID: <10D08630-4EA1-40EC-9939-0717E7F9BF25 at gmail.com> Content-Type: text/plain; charset="utf-8" split_fasta was deprecated quite a while ago (2010) and replaced by fasta_tool. I was able to find an old copy in the subversion repository, I can?t guarantee it will work as expected though with how much other libraries in maker have changed since then. ?Carson > On Aug 10, 2017, at 5:35 AM, Patrick Michael Chiuco wrote: > > > Hi! > > Good day! Is there anyway to download a previous version of Maker (<= v2.31.0) or get deprecated accessory scripts? One of the accessory scripts included in the previous versions (split_fasta) is a dependency of an annotation pipeline we're currently using. Thanks! > > Patrick > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: split_fasta Type: application/octet-stream Size: 1405 bytes Desc: not available URL: -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Message: 5 Date: Sat, 12 Aug 2017 00:00:24 -0600 From: Carson Holt To: jltan at mmu.edu.my Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] Problem with MAKER installation Message-ID: <71E16226-8E3D-4F68-9877-5D26B33B936D at gmail.com> Content-Type: text/plain; charset=utf-8 You may need to reinstall your forks and forks::shared modules. If you use CPAN, you can use the ?force? option to do this. Also if forks is broken, other modules may be as well, so you may get another error in another module after the reinstall (then you will have to reinstall that module). This can possibly be caused by a processor version issue if this is a cluster with mixed architectures (old vs new Intel chips or AMD vs Intel), or it can be due to a system update breaking dynamically linked C libraries. ?Carson > On Aug 8, 2017, at 1:33 AM, jltan at mmu.edu.my wrote: > > Hi, > > I am installing MAKER to annotate a fungus genome. However, I experienced > issue with > "Argument "2.53_01" isn't numeric in numeric ge (>=) at > /usr/local/lib/x86_64-linux-gnu/perl/5.22.1/forks.pm line 1570." . > > I aware that the issue arise because of the "_" in the "2.53_01" however I > have no idea on how to solve it. > > Would you mind to give advice on this matter? > > Thank you. > > > > Best regards, > > Dr. Joon Liang Tan > PhD, Bsc (Hons) > Lecturer (Bioinformatics Programme) > Faculty of Information Science and Technology (FIST) > Multimedia University > 75450 Melaka > Malaysia > Phone: +60 62524813 > > > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org ------------------------------ Message: 6 Date: Mon, 14 Aug 2017 11:30:33 -0600 From: Carson Holt To: Zach Cohen Cc: maker-devel at yandell-lab.org Subject: Re: [maker-devel] Inconsistent RepeatMasker error on draft assembly Message-ID: Content-Type: text/plain; charset="utf-8" If running under MPI, you can get messages from multiple processes (slightly out of order), in which case the more descript cause of the error may be further upstream in the STDERR log. If running without MPI, and the error you see is matched with the Widget::RepeatMasker command used, then you can simply copy it and run it outside of MAKER. If there are installation issues with your RepeatMasker copy then the cause will become more apparent. i.e. Run the command by itself ?> /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 ?Carson > On Aug 11, 2017, at 12:43 PM, Zach Cohen wrote: > > Hello All, > I'm receiving a RepeatMasker on some (not all) of my scaffolds. > Widget::RepeatMasker: > > cd /tmp/maker_7hGhhm; /scratch/exe/RepeatMasker/RepeatMasker /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0/scaffold2852_size18614.0.all.rb -species all -dir /scratch/bin/or_test3.maker.output/or_test3_datastore/E3/2F/scaffold2852_size18614//theVoid.scaffold2852_size18614/0 -pa 2 > > #-------------------------------# > > ERROR: RepeatMasker failed > > --> rank=NA, hostname=82853d8df2a5 > > ERROR: Failed while doing repeat masking > > ERROR: Chunk failed at level:0, tier_type:1 > > FAILED CONTIG:scaffold2852_size18614 > > ERROR: Chunk failed at level:2, tier_type:0 > > FAILED CONTIG:scaffold2852_size18614 > > examining contents of the fasta file and run log > > > > I'm not sure if there is an issue with the widget itself, as this doesn't come up for all the scaffolds and the example data seemed to run fine, or a problem with these particular scaffolds. Thanks for any assistance you can provide! > > Best, > > Z > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: ------------------------------ Subject: Digest Footer _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org ------------------------------ End of maker-devel Digest, Vol 111, Issue 3 ******************************************* ________________________________________________________________________ The information contained in this e-mail is for the exclusive use of the intended recipient(s) and may be confidential, proprietary, and/or legally privileged. Inadvertent disclosure of this message does not constitute a waiver of any privilege. If you receive this message in error, please do not directly or indirectly use, print, copy, forward, or disclose any part of this message. Please also delete this e-mail and all copies and notify the sender. Thank you. ________________________________________________________________________ From cjfields at illinois.edu Mon Aug 14 19:23:07 2017 From: cjfields at illinois.edu (Fields, Christopher J) Date: Tue, 15 Aug 2017 01:23:07 +0000 Subject: [maker-devel] maker MPI problem In-Reply-To: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: Carson, It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. chris From: maker-devel on behalf of Carson Holt Date: Monday, August 14, 2017 at 2:18 PM To: zl c Cc: "maker-devel at yandell-lab.org" Subject: Re: [maker-devel] maker MPI problem This is rather vague ?> ?crashed the computer cluster? Do you have a specific error? ?Carson On Aug 14, 2017, at 12:59 PM, zl c > wrote: Hello, I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? CMD: export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so export OMPI_MCA_mpi_warn_on_fork=0 mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta Thanks, Zelin Chen -------------------------------------------- Zelin Chen [chzelin at gmail.com] Ph.D. NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 08:33:37 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 08:33:37 -0600 Subject: [maker-devel] Fwd: maker MPI problem References: Message-ID: <4D7D32B5-58F4-401D-83EC-A1B38E0DCF09@gmail.com> Just forwarding this to the list. --Carson > From: Carson Holt > Date: August 14, 2017 at 2:00:11 PM MDT > To: zl c > Subject: Re: [maker-devel] maker MPI problem > > Yes. You can delete them. > > Also I notice this library being mentioned in the segfault ?> libpthread.so > > MAKER doesn?t use pthreads, so I?m surprised it?s showing up in an error. You could try installing a separate version of perl without pthread support and running MAKER with that (pthreads is optional for perl). It may remove an OpenMPI/perl incompatibility happening on your system. > > ?Carson > > >> On Aug 14, 2017, at 1:50 PM, zl c wrote: >> >> Maker dies. >> >> I've set LD_PRELOAD before install. >> >> I'll try the option. >> >> Can I remove the .NFS files before rerunning? >> >> Thanks, >> Zelin >> >> >> >>> On Mon, Aug 14, 2017 at 3:35 PM, Carson Holt wrote: >>> Is the issue that your cluster dies or that MAKER dies? (i.e. I want to know if this is an issue with your cluster or just an issue running MAKER) >>> >>> I see in the file that you are getting segfaults which should not crash the cluster but would kill maker. They would indicate either an installation problem, or just a command configuration option. >>> >>> You may need to recompile while the LD_PRELOAD value is set (it must be set during MAKER install and whenever you run with OpenMPI). Or you may still have the native infiniband communication active (causes segfaults with system calls). >>> >>> You can try this (to do ip over infiiniband instead, worls only if ib0 exists or set it to eth0 if eth0 exists) ?> '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0' >>> >>> That would replace the '-mca btl ^openib' >>> >>> Also make sure you can run maker on a single node under MPI before trying to work across nodes, then try on two nodes for your first test. >>> >>> The NFSLock files are file locks that are not cleaned up on a hard failure. >>> >>> ?Carson >>> >>> >>> >>> >>> >>>> On Aug 14, 2017, at 1:22 PM, zl c wrote: >>>> >>>> It's in the attached file. >>>> >>>> Beside, I see there are lots of .NFS... files.like: >>>> .NFSLock..NFSLock.genomedb.NFSLock.share.tmp.2247.26272.7466.34069868502337 >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>>> On Mon, Aug 14, 2017 at 3:18 PM, Carson Holt wrote: >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> Do you have a specific error? >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>>> >>>>>> Hello, >>>>>> >>>>>> >>>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>>> >>>>>> >>>>>> CMD: >>>>>> >>>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>>> >>>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>>> >>>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>>> >>>>>> >>>>>> Thanks, >>>>>> >>>>>> Zelin Chen >>>>>> >>>>>> >>>>>> -------------------------------------------- >>>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>>> >>>>>> NIH/NHGRI >>>>>> Building 50, Room 5531 >>>>>> 50 SOUTH DR, MSC 8004 >>>>>> BETHESDA, MD 20892-8004 >>>>>> _______________________________________________ >>>>>> maker-devel mailing list >>>>>> maker-devel at box290.bluehost.com >>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>> >>>> >>>> >>> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 08:39:35 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 08:39:35 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? --Carson Sent from my iPhone > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > Configuring MAKER with MPI support > Installing MAKER... > Configuring MAKER with MPI support > Subroutine dl_load_flags redefined at (eval 125) line 8. > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J wrote: >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >> >> >> >> chris >> >> >> >> From: maker-devel on behalf of Carson Holt >> Date: Monday, August 14, 2017 at 2:18 PM >> To: zl c >> Cc: "maker-devel at yandell-lab.org" >> Subject: Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Mon Aug 14 13:21:21 2017 From: dandence at gmail.com (Daniel Ence) Date: Mon, 14 Aug 2017 15:21:21 -0400 Subject: [maker-devel] maker problem large number of files In-Reply-To: References: Message-ID: <12B2834F-CC76-45BA-981B-4712982C9482@gmail.com> Hi Zelin, The large number of temporary files is part of the normal behavior for maker. After MAKER has finished, the only output files you really need are the fasta files of the annotated protein and transcript sequences and the gff file. The full maker output facilitates rerunning in the case of failure or trying out different parameters, which is sometimes a good reason for keeping the full output. ~Daniel > On Aug 14, 2017, at 3:11 PM, zl c wrote: > > Hello, > > Besides, Maker produces large number of temporary files. > > Thanks, > Zelin Chen > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 08:27:21 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 10:27:21 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> Message-ID: When I installed by './Build install', I got following some messages: Configuring MAKER with MPI support Installing MAKER... Configuring MAKER with MPI support Subroutine dl_load_flags redefined at (eval 125) line 8. Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. I'm not sure whether it's correctly installed. Thanks, -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < cjfields at illinois.edu> wrote: > Carson, > > > > It was attached to the initial message (named ?run05.mpi.o47346077?). It > looks like a Perl issue with threads, though I don?t see why this would > crash a cluster. The fact there is a log file would suggest it just ended > the job. > > > > chris > > > > *From: *maker-devel on behalf of > Carson Holt > *Date: *Monday, August 14, 2017 at 2:18 PM > *To: *zl c > *Cc: *"maker-devel at yandell-lab.org" > *Subject: *Re: [maker-devel] maker MPI problem > > > > This is rather vague ?> ?crashed the computer cluster? > > > > Do you have a specific error? > > > > ?Carson > > > > > > > > On Aug 14, 2017, at 12:59 PM, zl c wrote: > > > > Hello, > > > > I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I > attached the log file. Could you help me to solve the problem? > > > > CMD: > > export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so > > export OMPI_MCA_mpi_warn_on_fork=0 > > mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g > genome.fasta > > > > Thanks, > > Zelin Chen > > > > -------------------------------------------- > > Zelin Chen [chzelin at gmail.com] Ph.D. > > > > NIH/NHGRI > > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 09:30:48 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 11:30:48 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: The other option doesn't work. I reinstall it with a perl without multiple threads. Now it's building the blast database. -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > You may need to delete the .../maker/perl directory before doing the > reinstall if not doing a brand new installation. Otherwise you can ignore > the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for > MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > > Configuring MAKER with MPI support > > Installing MAKER... > > Configuring MAKER with MPI support > > Subroutine dl_load_flags redefined at (eval 125) line 8. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at > (eval 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) > line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < > cjfields at illinois.edu> wrote: > >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It >> looks like a Perl issue with threads, though I don?t see why this would >> crash a cluster. The fact there is a log file would suggest it just ended >> the job. >> >> >> >> chris >> >> >> >> *From: *maker-devel on behalf of >> Carson Holt >> *Date: *Monday, August 14, 2017 at 2:18 PM >> *To: *zl c >> *Cc: *"maker-devel at yandell-lab.org" >> *Subject: *Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I >> attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >> genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 09:34:32 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 11:34:32 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: Here are some latest message: [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > You may need to delete the .../maker/perl directory before doing the > reinstall if not doing a brand new installation. Otherwise you can ignore > the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for > MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c wrote: > > When I installed by './Build install', I got following some messages: > > Configuring MAKER with MPI support > > Installing MAKER... > > Configuring MAKER with MPI support > > Subroutine dl_load_flags redefined at (eval 125) line 8. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at > (eval 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval > 125) line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) > line 9. > > Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) > line 9. > > I'm not sure whether it's correctly installed. > > Thanks, > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < > cjfields at illinois.edu> wrote: > >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It >> looks like a Perl issue with threads, though I don?t see why this would >> crash a cluster. The fact there is a log file would suggest it just ended >> the job. >> >> >> >> chris >> >> >> >> *From: *maker-devel on behalf of >> Carson Holt >> *Date: *Monday, August 14, 2017 at 2:18 PM >> *To: *zl c >> *Cc: *"maker-devel at yandell-lab.org" >> *Subject: *Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I >> attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >> genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 09:47:04 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 09:47:04 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> Message-ID: <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Did it die or did you just get a warning? Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. #add if MPI not using all CPU given --oversubscribe --bind-to none #workaround for infinaband (use instead of --mca ^openib) --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 #add to stop certain other warnings --mca orte_base_help_aggregate 0 #stop fork warnings --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 ?Carson > On Aug 15, 2017, at 9:34 AM, zl c wrote: > > Here are some latest message: > > [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork > [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > > > On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: > You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. > > Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 8:27 AM, zl c > wrote: > >> When I installed by './Build install', I got following some messages: >> Configuring MAKER with MPI support >> Installing MAKER... >> Configuring MAKER with MPI support >> Subroutine dl_load_flags redefined at (eval 125) line 8. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >> >> I'm not sure whether it's correctly installed. >> >> Thanks, >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >> Carson, >> >> >> >> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >> >> >> >> chris >> >> >> >> From: maker-devel > on behalf of Carson Holt > >> Date: Monday, August 14, 2017 at 2:18 PM >> To: zl c > >> Cc: "maker-devel at yandell-lab.org " > >> Subject: Re: [maker-devel] maker MPI problem >> >> >> >> This is rather vague ?> ?crashed the computer cluster? >> >> >> >> Do you have a specific error? >> >> >> >> ?Carson >> >> >> >> >> >> >> >> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >> >> >> >> Hello, >> >> >> >> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >> >> >> >> CMD: >> >> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >> >> export OMPI_MCA_mpi_warn_on_fork=0 >> >> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >> >> >> >> Thanks, >> >> Zelin Chen >> >> >> >> -------------------------------------------- >> >> Zelin Chen [chzelin at gmail.com ] Ph.D. >> >> >> >> NIH/NHGRI >> >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 14:50:05 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 14:50:05 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Message-ID: <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? --Carson Sent from my iPhone > On Aug 15, 2017, at 2:47 PM, zl c wrote: > > Hi Carson, Christopher, Daniel, > > Thank you for your kind help. > > Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? > > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: >>>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>>> >>>>> When I installed by './Build install', I got following some messages: >>>>> Configuring MAKER with MPI support >>>>> Installing MAKER... >>>>> Configuring MAKER with MPI support >>>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>>> >>>>> I'm not sure whether it's correctly installed. >>>>> >>>>> Thanks, >>>>> >>>>> -------------------------------------------- >>>>> Zelin Chen [chzelin at gmail.com] >>>>> >>>>> NIH/NHGRI >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J wrote: >>>>>> Carson, >>>>>> >>>>>> >>>>>> >>>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>>>> >>>>>> >>>>>> >>>>>> chris >>>>>> >>>>>> >>>>>> >>>>>> From: maker-devel on behalf of Carson Holt >>>>>> Date: Monday, August 14, 2017 at 2:18 PM >>>>>> To: zl c >>>>>> Cc: "maker-devel at yandell-lab.org" >>>>>> Subject: Re: [maker-devel] maker MPI problem >>>>>> >>>>>> >>>>>> >>>>>> This is rather vague ?> ?crashed the computer cluster? >>>>>> >>>>>> >>>>>> >>>>>> Do you have a specific error? >>>>>> >>>>>> >>>>>> >>>>>> ?Carson >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>>> >>>>>> >>>>>> >>>>>> Hello, >>>>>> >>>>>> >>>>>> >>>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>>> >>>>>> >>>>>> >>>>>> CMD: >>>>>> >>>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>>> >>>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>>> >>>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>>> >>>>>> >>>>>> >>>>>> Thanks, >>>>>> >>>>>> Zelin Chen >>>>>> >>>>>> >>>>>> >>>>>> -------------------------------------------- >>>>>> >>>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>>> >>>>>> >>>>>> >>>>>> NIH/NHGRI >>>>>> >>>>>> Building 50, Room 5531 >>>>>> 50 SOUTH DR, MSC 8004 >>>>>> BETHESDA, MD 20892-8004 >>>>>> >>>>>> _______________________________________________ >>>>>> maker-devel mailing list >>>>>> maker-devel at box290.bluehost.com >>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>> >>>>>> >>>>>> >>>>> >>> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 14:47:14 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 16:47:14 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> Message-ID: Hi Carson, Christopher, Daniel, Thank you for your kind help. Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? Zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: > Did it die or did you just get a warning? > > Here is a list of flags to add that suppress warnings and other issues > with OpenMPI. You can add them all or one at a time depending on issues you > get. > > #add if MPI not using all CPU given > --oversubscribe --bind-to none > > #workaround for infinaband (use instead of --mca ^openib) > --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 > > #add to stop certain other warnings > --mca orte_base_help_aggregate 0 > > #stop fork warnings > --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 > > ?Carson > > > > On Aug 15, 2017, at 9:34 AM, zl c wrote: > > Here are some latest message: > > [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt > / opal_init:warn-fork > [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see > all help / error messages > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > > On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: > >> You may need to delete the .../maker/perl directory before doing the >> reinstall if not doing a brand new installation. Otherwise you can ignore >> the subroutine redefined warnings during compile. >> >> Have you been able to test the alternate flags on the command line for >> MPI? How about an alternate perl without threads? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 8:27 AM, zl c wrote: >> >> When I installed by './Build install', I got following some messages: >> Configuring MAKER with MPI support >> Installing MAKER... >> Configuring MAKER with MPI support >> Subroutine dl_load_flags redefined at (eval 125) line 8. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >> (eval 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >> 125) line 9. >> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) >> line 9. >> >> I'm not sure whether it's correctly installed. >> >> Thanks, >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >> cjfields at illinois.edu> wrote: >> >>> Carson, >>> >>> >>> >>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>> It looks like a Perl issue with threads, though I don?t see why this would >>> crash a cluster. The fact there is a log file would suggest it just ended >>> the job. >>> >>> >>> >>> chris >>> >>> >>> >>> *From: *maker-devel on behalf of >>> Carson Holt >>> *Date: *Monday, August 14, 2017 at 2:18 PM >>> *To: *zl c >>> *Cc: *"maker-devel at yandell-lab.org" >>> *Subject: *Re: [maker-devel] maker MPI problem >>> >>> >>> >>> This is rather vague ?> ?crashed the computer cluster? >>> >>> >>> >>> Do you have a specific error? >>> >>> >>> >>> ?Carson >>> >>> >>> >>> >>> >>> >>> >>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>> >>> >>> >>> Hello, >>> >>> >>> >>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. >>> I attached the log file. Could you help me to solve the problem? >>> >>> >>> >>> CMD: >>> >>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>> >>> export OMPI_MCA_mpi_warn_on_fork=0 >>> >>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>> genome.fasta >>> >>> >>> >>> Thanks, >>> >>> Zelin Chen >>> >>> >>> >>> -------------------------------------------- >>> >>> Zelin Chen [chzelin at gmail.com] Ph.D. >>> >>> >>> >>> NIH/NHGRI >>> >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> _______________________________________________ >>> maker-devel mailing list >>> maker-devel at box290.bluehost.com >>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >>> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 15 15:13:04 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 15 Aug 2017 15:13:04 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: Some notes: First, the mpiexec command still needs the --mca parameters (either '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0?). Otherwise if you have infiniband on the nodes it will try and use OpenFabrics compatible libraries which will kill code doing system calls (like MAKER does). Second, try using a higher count than 2 in your batch. One process is always sacrificed by maker to act only for message management among processes, so with -n 2, you have one process working and one managing data. So only one contig will run at a time. If you set it to a higher number the issue will go away. The message manger process starts to get saturated at ~200 CPUs, so anything above that processor count becomes less beneficial to the job. Thanks, Carson > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt > wrote: > What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 2:47 PM, zl c > wrote: > >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt > wrote: >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >>> On Aug 15, 2017, at 9:34 AM, zl c > wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com ] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: >>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>> >>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>> >>> --Carson >>> >>> Sent from my iPhone >>> >>> On Aug 15, 2017, at 8:27 AM, zl c > wrote: >>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com ] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >>>> Carson, >>>> >>>> >>>> >>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>> >>>> >>>> >>>> chris >>>> >>>> >>>> >>>> From: maker-devel > on behalf of Carson Holt > >>>> Date: Monday, August 14, 2017 at 2:18 PM >>>> To: zl c > >>>> Cc: "maker-devel at yandell-lab.org " > >>>> Subject: Re: [maker-devel] maker MPI problem >>>> >>>> >>>> >>>> This is rather vague ?> ?crashed the computer cluster? >>>> >>>> >>>> >>>> Do you have a specific error? >>>> >>>> >>>> >>>> ?Carson >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >>>> >>>> >>>> >>>> Hello, >>>> >>>> >>>> >>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>> >>>> >>>> >>>> CMD: >>>> >>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>> >>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>> >>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>> >>>> >>>> >>>> Thanks, >>>> >>>> Zelin Chen >>>> >>>> >>>> >>>> -------------------------------------------- >>>> >>>> Zelin Chen [chzelin at gmail.com ] Ph.D. >>>> >>>> >>>> >>>> NIH/NHGRI >>>> >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>>> >>> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 15:05:18 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 17:05:18 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: I submit a job: sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh CMD in run06.maker.mpi.sh mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta Another question: How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. Thanks, zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > What is your command line? Are you running interactively or as a submitted > batch? If it's a batch job what options did you give it? > > --Carson > > Sent from my iPhone > > On Aug 15, 2017, at 2:47 PM, zl c wrote: > > Hi Carson, Christopher, Daniel, > > Thank you for your kind help. > > Now it works without any other options on one nodes and 4 CPUs. I set the > number of task to 2, but there's only one contigs in running. Should it be > two contigs running at the same time? > > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: > >> Did it die or did you just get a warning? >> >> Here is a list of flags to add that suppress warnings and other issues >> with OpenMPI. You can add them all or one at a time depending on issues you >> get. >> >> #add if MPI not using all CPU given >> --oversubscribe --bind-to none >> >> #workaround for infinaband (use instead of --mca ^openib) >> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >> >> #add to stop certain other warnings >> --mca orte_base_help_aggregate 0 >> >> #stop fork warnings >> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >> >> ?Carson >> >> >> >> On Aug 15, 2017, at 9:34 AM, zl c wrote: >> >> Here are some latest message: >> >> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt >> / opal_init:warn-fork >> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >> all help / error messages >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> >> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt wrote: >> >>> You may need to delete the .../maker/perl directory before doing the >>> reinstall if not doing a brand new installation. Otherwise you can ignore >>> the subroutine redefined warnings during compile. >>> >>> Have you been able to test the alternate flags on the command line for >>> MPI? How about an alternate perl without threads? >>> >>> --Carson >>> >>> Sent from my iPhone >>> >>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>> >>> When I installed by './Build install', I got following some messages: >>> Configuring MAKER with MPI support >>> Installing MAKER... >>> Configuring MAKER with MPI support >>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>> (eval 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>> 125) line 9. >>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) >>> line 9. >>> >>> I'm not sure whether it's correctly installed. >>> >>> Thanks, >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> NIH/NHGRI >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>> cjfields at illinois.edu> wrote: >>> >>>> Carson, >>>> >>>> >>>> >>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>> It looks like a Perl issue with threads, though I don?t see why this would >>>> crash a cluster. The fact there is a log file would suggest it just ended >>>> the job. >>>> >>>> >>>> >>>> chris >>>> >>>> >>>> >>>> *From: *maker-devel on behalf of >>>> Carson Holt >>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>> *To: *zl c >>>> *Cc: *"maker-devel at yandell-lab.org" >>>> *Subject: *Re: [maker-devel] maker MPI problem >>>> >>>> >>>> >>>> This is rather vague ?> ?crashed the computer cluster? >>>> >>>> >>>> >>>> Do you have a specific error? >>>> >>>> >>>> >>>> ?Carson >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>> >>>> >>>> >>>> Hello, >>>> >>>> >>>> >>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. >>>> I attached the log file. Could you help me to solve the problem? >>>> >>>> >>>> >>>> CMD: >>>> >>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>> >>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>> >>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>> genome.fasta >>>> >>>> >>>> >>>> Thanks, >>>> >>>> Zelin Chen >>>> >>>> >>>> >>>> -------------------------------------------- >>>> >>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>> >>>> >>>> >>>> NIH/NHGRI >>>> >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>>> >>> >>> >> >> > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Tue Aug 15 15:17:20 2017 From: chzelin at gmail.com (zl c) Date: Tue, 15 Aug 2017 17:17:20 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: This is a test run, so I use only 2 tasks. I'll try more tasks and your options. Thanks, Zelin On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either > '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include > ib0?). Otherwise if you have infiniband on the nodes it will try and use > OpenFabrics compatible libraries which will kill code doing system calls > (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is > always sacrificed by maker to act only for message management among > processes, so with -n 2, you have one process working and one managing > data. So only one contig will run at a time. If you set it to a higher > number the issue will go away. The message manger process starts to get > saturated at ~200 CPUs, so anything above that processor count becomes less > beneficial to the job. > > Thanks, > Carson > > > > > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 > --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A > run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and > large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > >> What is your command line? Are you running interactively or as a >> submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c wrote: >> >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set >> the number of task to 2, but there's only one contigs in running. Should it >> be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues >>> with OpenMPI. You can add them all or one at a time depending on issues you >>> get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message >>> help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >>> all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt >>> wrote: >>> >>>> You may need to delete the .../maker/perl directory before doing the >>>> reinstall if not doing a brand new installation. Otherwise you can ignore >>>> the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for >>>> MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval >>>> 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>>> cjfields at illinois.edu> wrote: >>>> >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>>> It looks like a Perl issue with threads, though I don?t see why this would >>>>> crash a cluster. The fact there is a log file would suggest it just ended >>>>> the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> *From: *maker-devel on behalf >>>>> of Carson Holt >>>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>>> *To: *zl c >>>>> *Cc: *"maker-devel at yandell-lab.org" >>>>> *Subject: *Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer >>>>> cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>>> genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yand >>>>> ell-lab.org >>>>> >>>>> >>>>> >>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 16 14:00:44 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 16 Aug 2017 16:00:44 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> Message-ID: Dear Carson and Daniel: Thank you for your explanation about the details of repeat masking. But we still have some concerns, would you please give us some suggestions? Thanks (1) We are doing genome annotation for a new rodent species, we wonder whether we should use repeat library for "Mammalia" or "rodent"? Which is more proper, if we did not construct a species-specific repeat library for the new genome? #-----Repeat Masking (leave values blank to skip repeat masking) model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker repeat_protein=/gs/gsfs0/hpc01/apps/MAKER/2.31.9/data/te_proteins.fasta #provide a fasta file of transposable element proteins for RepeatRunner (2) With some concerns as discussed above emails, we did not train a species-specific repeat library. Since we have finished the annotation only using the repeat library from repeatMasker and Maker2, we wonder whether it is worth for us to firstly train a species-specific repeat library and then do the genome annotation again? Will it (i.e., trainning a species-specific repeat library) significantly affect the gene annotation and downstream analysis (e.g., gene family expansion analysis, positive selection)? (3) We identified some gene families under contraction, but we want to confirm those gene families really lost copies in our new genome. Do you think it is worth to do the genome annotation without repeat masking, so there will not be genes missing from annotation due to repeat mask? Many thanks. Best Quanwei 2017-07-31 13:02 GMT-04:00 Carson Holt : > Please note that the unmask option Dan is talking about is a feature to > run both masked and unmasked raw predictions in the first round of > prediction (it does not affect alignemnt of the second round of > predictiopn). It tends to increase the false positive rate but can be a > quick test when you believe you are missing a gene because of overmasking > from a user created library and protein/EST evidence is overly sparse (so > the gene cannot be recovered through evidence alignment and the second > round of unmasked prediction). > > ?Carson > > On Jul 31, 2017, at 10:53 AM, Daniel Ence wrote: > > Hi Quanwei, Running maker on the unmasked genome will probably give you > more genes, but won?t be helpful in the end. Maker soft-masks repeats, > which prevents blast alignments from being seeded in the masked regions, > but still allows them to extend into those regions. This solves the problem > missing exons mentioned in the text you sent. There?s an option in the > control file to run the ab-inition programs on the unmasked sequence > (?unmask?) which is set to false (0) by default. > > Hope this helps, > Daniel Ence > > > On Jul 31, 2017, at 12:42 PM, Quanwei Zhang wrote: > > Hello: > > We are using the Maker2 pipeline to annotating a new genome. We just read > something about the repeat masking from repeatMasker's documents. It > suggests to leave low complexity region unmasked and to do gene annotation > using both masked and unmasked genome. I wonder what your opinion and > suggestions on this? Many thanks > > > The paragraph below is from http://www.binfo.ncku.edu.tw/ > RM/webrepeatmaskerhelp.html > Use in association with gene prediction programs > > Predicting genes from a masked sequence faces several problems. First, > one should not mask low complexity regions, e.g. to avoid masking > trinucleotide repeats in coding regions. But even with only interspersed > repeats masked, gene prediction programs may fail to identify exons > correctly. As mentioned above, sometimes tail ends of coding regions may > have originated from transposable elements. Even if no coding regions have > been masked, splice sites may be compromised; e.g. the polypyrimidine > region that is part of the acceptor splice site may be contained within a > repeat. > > Thus, I generally recommend to run a gene prediction program on unmasked > DNA (as well) and compare the predicted genes and exons with the > RepeatMasker output. Some gene prediction program allow you to force > certain exons out of the predictions (e.g. often the old ORFs of LINE1 > elements and endogenous retroviruses are included in genes). Work is also > in progress at several sites to incorporate RepeatMasker into gene > prediction programs, in which cases matches to repeats are weighted in > along with the other parameters used. > > Best > > Quanwei > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From chzelin at gmail.com Thu Aug 17 07:39:29 2017 From: chzelin at gmail.com (zl c) Date: Thu, 17 Aug 2017 09:39:29 -0400 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: I use '--mca btl ^openib' and it runs on multiple nodes. It works and I see some sequences is done for the test run. Then I make another run using the large nr database and use local space on the computer cluster, which fails. Submit CMD: sbatch --gres=lscratch:100 --time=168:00:00 --partition=multinode --constraint=x2680 --mem-per-cpu=64g --ntasks=8 --ntasks-per-core=1 --job-name run05.mpi -o log.mpi.00/run05.mpi.o%A run05.mpi.sh Error message: #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_BLLXNq/rna%2Efasta.mpi.10.21 -query /lscratch/47455932/maker_BLLXNq/50/tig00017383_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_ canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/ goldfish.arrow.renamed_datastore/5A/65/tig00017383_ arrow//theVoid.tig00017383_arrow/0/tig00017383_arrow.0. rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.21.tblastx #-------------------------------# Thread 1 terminated abnormally: can't open /lscratch/47455932/mpiavG_z: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. --> rank=37, hostname=cn4120 FATAL: Thread terminated, causing all processes to fail --> rank=37, hostname=cn4120 ------------------------------------------------------- Primary job terminated normally, but 1 process returned a non-zero exit code.. Per user-direction, the job has been aborted. ------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received running blast search. #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_Zsg_Gg/rna%2Efasta.mpi.10.8 -query /lscratch/47455932/maker_Zsg_Gg/62/tig00001111_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_ canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/ goldfish.arrow.renamed_datastore/B8/A5/tig00001111_ arrow//theVoid.tig00001111_arrow/0/tig00001111_arrow.0. rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.8.tblastx #-------------------------------# Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached -------------------------------------------------------------------------- An MPI communication peer process has unexpectedly disconnected. This usually indicates a failure in the peer process (e.g., a crash or otherwise exiting without calling MPI_FINALIZE first). Although this local MPI process will likely now behave unpredictably (it may even hang or crash), the root cause of this problem is the failure of the peer -- that is what you need to investigate. For example, there may be a core file that you can examine. More generally: such peer hangups are frequently caused by application bugs or other external events. Local host: cn4130 Local PID: 18831 Peer host: cn3683 -------------------------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received SIGTERM received formating database... #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype prot -in /lscratch/47455932/maker_rNzO3X/27/blastprep/protein2%2Efasta.mpi.10.25 #-------------------------------# SIGTERM received SIGTERM received SIGTERM received SIGTERM received ... SIGTERM received SIGTERM received SIGTERM received Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached ... [cn3683:36010] 59 more processes have sent help message help-mpi-btl-tcp.txt / peer hung up [cn3683:36010] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages -------------------------------------------------------------------------- mpiexec detected that one or more processes exited with non-zero status, thus causing the job to be terminated. The first process to do so was: Process name: [[352,1],37] Exit code: 255 -------------------------------------------------------------------------- I rebuild the mpi_blast and rerun it again, also get the error: #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_k6a7Hy/32/blastprep/rna%2Efasta.mpi.10.3 #-------------------------------# Thread 1 terminated abnormally: can't open /lscratch/47559740/mpiS84Ju: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. --> rank=27, hostname=cn4115 FATAL: Thread terminated, causing all processes to fail --> rank=27, hostname=cn4115 deleted:276 hits doing tblastx of alt-ESTs formating database... #--------- command -------------# Widget::formater: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_nCKTgE/2/blastprep/rna%2Efasta.mpi.10.11 #-------------------------------# running blast search. #--------- command -------------# Widget::tblastx: /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47559740/maker_0kWZTA/rna%2Efasta.mpi.10.20 -query /lscratch/47559740/maker_0kWZTA/35/tig00027947_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/86/7F/tig00027947_arrow//theVoid.tig00027947_arrow/0/tig00027947_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.20.tblastx #-------------------------------# ------------------------------------------------------- Primary job terminated normally, but 1 process returned a non-zero exit code.. Per user-direction, the job has been aborted. ------------------------------------------------------- SIGTERM received SIGTERM received SIGTERM received Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Perl exited with active threads: 1 running and unjoined 0 finished and unjoined 0 running and detached Thanks, Zelin -------------------------------------------- Zelin Chen [chzelin at gmail.com] NIH/NHGRI Building 50, Room 5531 50 SOUTH DR, MSC 8004 BETHESDA, MD 20892-8004 On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either > '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include > ib0?). Otherwise if you have infiniband on the nodes it will try and use > OpenFabrics compatible libraries which will kill code doing system calls > (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is > always sacrificed by maker to act only for message management among > processes, so with -n 2, you have one process working and one managing > data. So only one contig will run at a time. If you set it to a higher > number the issue will go away. The message manger process starts to get > saturated at ~200 CPUs, so anything above that processor count becomes less > beneficial to the job. > > Thanks, > Carson > > > > > On Aug 15, 2017, at 3:05 PM, zl c wrote: > > I submit a job: > sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 > --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A > run06.maker.mpi.sh > > CMD in run06.maker.mpi.sh > mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta > > Another question: > How much temporary space and memory should I use for a ~10Mb sequences and > large database like nr and uniref90. > > Thanks, > zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com] > > > On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt wrote: > >> What is your command line? Are you running interactively or as a >> submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c wrote: >> >> Hi Carson, Christopher, Daniel, >> >> Thank you for your kind help. >> >> Now it works without any other options on one nodes and 4 CPUs. I set >> the number of task to 2, but there's only one contigs in running. Should it >> be two contigs running at the same time? >> >> Zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com] >> >> >> NIH/NHGRI >> Building 50, Room 5531 >> 50 SOUTH DR, MSC 8004 >> BETHESDA, MD 20892-8004 >> >> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt wrote: >> >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues >>> with OpenMPI. You can add them all or one at a time depending on issues you >>> get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>> On Aug 15, 2017, at 9:34 AM, zl c wrote: >>> >>> Here are some latest message: >>> >>> [cn3360:57176] 1 more process has sent help message >>> help-opal-runtime.txt / opal_init:warn-fork >>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see >>> all help / error messages >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com] >>> >>> >>> >>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt >>> wrote: >>> >>>> You may need to delete the .../maker/perl directory before doing the >>>> reinstall if not doing a brand new installation. Otherwise you can ignore >>>> the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for >>>> MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c wrote: >>>> >>>> When I installed by './Build install', I got following some messages: >>>> Configuring MAKER with MPI support >>>> Installing MAKER... >>>> Configuring MAKER with MPI support >>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at >>>> (eval 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval >>>> 125) line 9. >>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval >>>> 125) line 9. >>>> >>>> I'm not sure whether it's correctly installed. >>>> >>>> Thanks, >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com] >>>> >>>> NIH/NHGRI >>>> Building 50, Room 5531 >>>> 50 SOUTH DR, MSC 8004 >>>> BETHESDA, MD 20892-8004 >>>> >>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J < >>>> cjfields at illinois.edu> wrote: >>>> >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). >>>>> It looks like a Perl issue with threads, though I don?t see why this would >>>>> crash a cluster. The fact there is a log file would suggest it just ended >>>>> the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> *From: *maker-devel on behalf >>>>> of Carson Holt >>>>> *Date: *Monday, August 14, 2017 at 2:18 PM >>>>> *To: *zl c >>>>> *Cc: *"maker-devel at yandell-lab.org" >>>>> *Subject: *Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer >>>>> cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g >>>>> genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yand >>>>> ell-lab.org >>>>> >>>>> >>>>> >>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Thu Aug 17 09:36:20 2017 From: carsonhh at gmail.com (Carson Holt) Date: Thu, 17 Aug 2017 09:36:20 -0600 Subject: [maker-devel] maker MPI problem In-Reply-To: References: <2169EC81-B192-4146-8755-E034A5010EC5@gmail.com> <891F1A5D-2CFD-48CC-92AB-77B0CE086DD7@gmail.com> <8D2E283C-F045-4F01-B773-D2FD0D7D23EE@gmail.com> <9547C6F1-B4BA-4BDA-9BCC-F02D6C188389@gmail.com> Message-ID: This is the causal error ?> can't open /lscratch/47455932/mpiavG_z It kills one process and causes everything else to die in an ugly way. There are several possible causes: 1. /lscratch/47455932/ is not actually locally mounted. It may be a virtual directory created at run time that exists on the network but not as a true locally mounted disk. If this is the case, there can be a slight IO delay under heavy IO load (common on NFS) that can cause directories and files to appear to not exist. This is one of the reasons TMP= must be sent to a true locally mounted disk. The IO load MAKER can produce can swamp network mounted disks creating strange errors. 2. /lscratch/47455932/ may only exist on the head node and not other nodes for the job. True local temporary storage is not available across nodes. It is only available on the node it is attached to. So if you are creating the location as part of your job, it may only exist on the head node and not the other nodes. Usually this value is set to /tmp because each machine should have it?s own independent /tmp location. 3. /lscratch/47455932/ exists on all nodes, but is full on one of them. ?Carson ?Carson > On Aug 17, 2017, at 7:39 AM, zl c wrote: > > I use '--mca btl ^openib' and it runs on multiple nodes. It works and I see some sequences is done for the test run. > > Then I make another run using the large nr database and use local space on the computer cluster, which fails. > Submit CMD: > sbatch --gres=lscratch:100 --time=168:00:00 --partition=multinode --constraint=x2680 --mem-per-cpu=64g --ntasks=8 --ntasks-per-core=1 --job-name run05.mpi -o log.mpi.00/run05.mpi.o%A run05.mpi.sh > Error message: > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_BLLXNq/rna%2Efasta.mpi.10.21 -query /lscratch/47455932/maker_BLLXNq/50/tig00017383_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/5A/65/tig00017383_arrow//theVoid.tig00017383_arrow/0/tig00017383_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.21.tblastx > #-------------------------------# > Thread 1 terminated abnormally: can't open /lscratch/47455932/mpiavG_z: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. > --> rank=37, hostname=cn4120 > FATAL: Thread terminated, causing all processes to fail > --> rank=37, hostname=cn4120 > ------------------------------------------------------- > Primary job terminated normally, but 1 process returned > a non-zero exit code.. Per user-direction, the job has been aborted. > ------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > running blast search. > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47455932/maker_Zsg_Gg/rna%2Efasta.mpi.10.8 -query /lscratch/47455932/maker_Zsg_Gg/62/tig00001111_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/B8/A5/tig00001111_arrow//theVoid.tig00001111_arrow/0/tig00001111_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.8.tblastx > #-------------------------------# > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > -------------------------------------------------------------------------- > An MPI communication peer process has unexpectedly disconnected. This > usually indicates a failure in the peer process (e.g., a crash or > otherwise exiting without calling MPI_FINALIZE first). > > Although this local MPI process will likely now behave unpredictably > (it may even hang or crash), the root cause of this problem is the > failure of the peer -- that is what you need to investigate. For > example, there may be a core file that you can examine. More > generally: such peer hangups are frequently caused by application bugs > or other external events. > > Local host: cn4130 > Local PID: 18831 > Peer host: cn3683 > -------------------------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > formating database... > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype prot -in /lscratch/47455932/maker_rNzO3X/27/blastprep/protein2%2Efasta.mpi.10.25 > #-------------------------------# > SIGTERM received > SIGTERM received > SIGTERM received > SIGTERM received > ... > SIGTERM received > SIGTERM received > SIGTERM received > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > > ... > [cn3683:36010] 59 more processes have sent help message help-mpi-btl-tcp.txt / peer hung up > [cn3683:36010] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages > -------------------------------------------------------------------------- > mpiexec detected that one or more processes exited with non-zero status, thus causing > the job to be terminated. The first process to do so was: > > Process name: [[352,1],37] > Exit code: 255 > -------------------------------------------------------------------------- > > > I rebuild the mpi_blast and rerun it again, also get the error: > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_k6a7Hy/32/blastprep/rna%2Efasta.mpi.10.3 > #-------------------------------# > Thread 1 terminated abnormally: can't open /lscratch/47559740/mpiS84Ju: No such file or directory at /home/chenz11/program/maker_mpi/bin/maker line 1460 thread 1. > --> rank=27, hostname=cn4115 > FATAL: Thread terminated, causing all processes to fail > --> rank=27, hostname=cn4115 > deleted:276 hits > doing tblastx of alt-ESTs > formating database... > #--------- command -------------# > Widget::formater: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/makeblastdb -dbtype nucl -in /lscratch/47559740/maker_nCKTgE/2/blastprep/rna%2Efasta.mpi.10.11 > #-------------------------------# > running blast search. > #--------- command -------------# > Widget::tblastx: > /usr/local/apps/blast/ncbi-blast-2.5.0+/bin/tblastx -db /lscratch/47559740/maker_0kWZTA/rna%2Efasta.mpi.10.20 -query /lscratch/47559740/maker_0kWZTA/35/tig00027947_arrow.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-10 -dbsize 1000 -searchsp 500000000 -num_threads 1 -lcase_masking -seg yes -soft_masking true -show_gis -out /gpfs/gsfs6/users/chenz11/goldfish/11549472/sergey_canu70x/arrow/maker5/goldfish.arrow.renamed.maker.output/goldfish.arrow.renamed_datastore/86/7F/tig00027947_arrow//theVoid.tig00027947_arrow/0/tig00027947_arrow.0.rna%2Efasta.tblastx.temp_dir/rna%2Efasta.mpi.10.20.tblastx > #-------------------------------# > ------------------------------------------------------- > Primary job terminated normally, but 1 process returned > a non-zero exit code.. Per user-direction, the job has been aborted. > ------------------------------------------------------- > SIGTERM received > SIGTERM received > SIGTERM received > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > Perl exited with active threads: > 1 running and unjoined > 0 finished and unjoined > 0 running and detached > > Thanks, > Zelin > > -------------------------------------------- > Zelin Chen [chzelin at gmail.com ] > > NIH/NHGRI > Building 50, Room 5531 > 50 SOUTH DR, MSC 8004 > BETHESDA, MD 20892-8004 > > On Tue, Aug 15, 2017 at 5:13 PM, Carson Holt > wrote: > Some notes: > > First, the mpiexec command still needs the --mca parameters (either '--mca btl ^openib' or '--mca btl vader,tcp,self --mca btl_tcp_if_include ib0?). Otherwise if you have infiniband on the nodes it will try and use OpenFabrics compatible libraries which will kill code doing system calls (like MAKER does). > > Second, try using a higher count than 2 in your batch. One process is always sacrificed by maker to act only for message management among processes, so with -n 2, you have one process working and one managing data. So only one contig will run at a time. If you set it to a higher number the issue will go away. The message manger process starts to get saturated at ~200 CPUs, so anything above that processor count becomes less beneficial to the job. > > Thanks, > Carson > > > > >> On Aug 15, 2017, at 3:05 PM, zl c > wrote: >> >> I submit a job: >> sbatch --gres=lscratch:100 --time=8:00:00 --mem-per-cpu=8g -N 1-1 --ntasks=2 --ntasks-per-core=1 --job-name run06.mpi -o log/run06.mpi.o%A run06.maker.mpi.sh >> >> CMD in run06.maker.mpi.sh >> mpiexec -n $SLURM_NTASKS maker -c 1 -base genome -g genome.fasta >> >> Another question: >> How much temporary space and memory should I use for a ~10Mb sequences and large database like nr and uniref90. >> >> Thanks, >> zelin >> >> -------------------------------------------- >> Zelin Chen [chzelin at gmail.com ] >> >> >> On Tue, Aug 15, 2017 at 4:50 PM, Carson Holt > wrote: >> What is your command line? Are you running interactively or as a submitted batch? If it's a batch job what options did you give it? >> >> --Carson >> >> Sent from my iPhone >> >> On Aug 15, 2017, at 2:47 PM, zl c > wrote: >> >>> Hi Carson, Christopher, Daniel, >>> >>> Thank you for your kind help. >>> >>> Now it works without any other options on one nodes and 4 CPUs. I set the number of task to 2, but there's only one contigs in running. Should it be two contigs running at the same time? >>> >>> Zelin >>> >>> -------------------------------------------- >>> Zelin Chen [chzelin at gmail.com ] >>> >>> >>> NIH/NHGRI >>> Building 50, Room 5531 >>> 50 SOUTH DR, MSC 8004 >>> BETHESDA, MD 20892-8004 >>> >>> On Tue, Aug 15, 2017 at 11:47 AM, Carson Holt > wrote: >>> Did it die or did you just get a warning? >>> >>> Here is a list of flags to add that suppress warnings and other issues with OpenMPI. You can add them all or one at a time depending on issues you get. >>> >>> #add if MPI not using all CPU given >>> --oversubscribe --bind-to none >>> >>> #workaround for infinaband (use instead of --mca ^openib) >>> --mca btl vader,tcp,self --mca btl_tcp_if_include ib0 >>> >>> #add to stop certain other warnings >>> --mca orte_base_help_aggregate 0 >>> >>> #stop fork warnings >>> --mca btl_openib_want_fork_support 1 --mca mpi_warn_on_fork 0 >>> >>> ?Carson >>> >>> >>> >>>> On Aug 15, 2017, at 9:34 AM, zl c > wrote: >>>> >>>> Here are some latest message: >>>> >>>> [cn3360:57176] 1 more process has sent help message help-opal-runtime.txt / opal_init:warn-fork >>>> [cn3360:57176] Set MCA parameter "orte_base_help_aggregate" to 0 to see all help / error messages >>>> >>>> -------------------------------------------- >>>> Zelin Chen [chzelin at gmail.com ] >>>> >>>> >>>> >>>> On Tue, Aug 15, 2017 at 10:39 AM, Carson Holt > wrote: >>>> You may need to delete the .../maker/perl directory before doing the reinstall if not doing a brand new installation. Otherwise you can ignore the subroutine redefined warnings during compile. >>>> >>>> Have you been able to test the alternate flags on the command line for MPI? How about an alternate perl without threads? >>>> >>>> --Carson >>>> >>>> Sent from my iPhone >>>> >>>> On Aug 15, 2017, at 8:27 AM, zl c > wrote: >>>> >>>>> When I installed by './Build install', I got following some messages: >>>>> Configuring MAKER with MPI support >>>>> Installing MAKER... >>>>> Configuring MAKER with MPI support >>>>> Subroutine dl_load_flags redefined at (eval 125) line 8. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_SOURCE redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_ANY_TAG redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_SUCCESS redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Init redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Finalize redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_rank redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Comm_size redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Send redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::C_MPI_Recv redefined at (eval 125) line 9. >>>>> Subroutine Parallel::Application::MPI::_comment redefined at (eval 125) line 9. >>>>> >>>>> I'm not sure whether it's correctly installed. >>>>> >>>>> Thanks, >>>>> >>>>> -------------------------------------------- >>>>> Zelin Chen [chzelin at gmail.com ] >>>>> >>>>> NIH/NHGRI >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> On Mon, Aug 14, 2017 at 9:23 PM, Fields, Christopher J > wrote: >>>>> Carson, >>>>> >>>>> >>>>> >>>>> It was attached to the initial message (named ?run05.mpi.o47346077?). It looks like a Perl issue with threads, though I don?t see why this would crash a cluster. The fact there is a log file would suggest it just ended the job. >>>>> >>>>> >>>>> >>>>> chris >>>>> >>>>> >>>>> >>>>> From: maker-devel > on behalf of Carson Holt > >>>>> Date: Monday, August 14, 2017 at 2:18 PM >>>>> To: zl c > >>>>> Cc: "maker-devel at yandell-lab.org " > >>>>> Subject: Re: [maker-devel] maker MPI problem >>>>> >>>>> >>>>> >>>>> This is rather vague ?> ?crashed the computer cluster? >>>>> >>>>> >>>>> >>>>> Do you have a specific error? >>>>> >>>>> >>>>> >>>>> ?Carson >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> On Aug 14, 2017, at 12:59 PM, zl c > wrote: >>>>> >>>>> >>>>> >>>>> Hello, >>>>> >>>>> >>>>> >>>>> I ran maker 3.0 with openmpi 2.0.2 and it crashed the computer cluster. I attached the log file. Could you help me to solve the problem? >>>>> >>>>> >>>>> >>>>> CMD: >>>>> >>>>> export LD_PRELOAD=/usr/local/OpenMPI/2.0.2/gcc-6.3.0/lib/libmpi.so >>>>> >>>>> export OMPI_MCA_mpi_warn_on_fork=0 >>>>> >>>>> mpiexec -mca btl ^openib -n $SLURM_NTASKS maker -c 1 ?base genome -g genome.fasta >>>>> >>>>> >>>>> >>>>> Thanks, >>>>> >>>>> Zelin Chen >>>>> >>>>> >>>>> >>>>> -------------------------------------------- >>>>> >>>>> Zelin Chen [chzelin at gmail.com ] Ph.D. >>>>> >>>>> >>>>> >>>>> NIH/NHGRI >>>>> >>>>> Building 50, Room 5531 >>>>> 50 SOUTH DR, MSC 8004 >>>>> BETHESDA, MD 20892-8004 >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>> >>>>> >>>>> >>>> >>> >>> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From yplee614 at 163.com Fri Aug 18 04:46:08 2017 From: yplee614 at 163.com (yplee) Date: Fri, 18 Aug 2017 18:46:08 +0800 Subject: [maker-devel] basis of gene removed in maker re-annotation Message-ID: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> Dear maker author, I am yongping li, a student from huazhong agriculture university, china. We used MAKER to re-annotation our genome annotation. There is some gene were removal in MAKER output when i input out previous annotation gff file, so what was the basis for gene removal? would you please provide us the details of gene remove? The reviews ask question when i submit my re-annotation paper to journal. Best regards Yours Sincerely From carsonhh at gmail.com Fri Aug 18 09:35:48 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 18 Aug 2017 09:35:48 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> Message-ID: <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Hi Quanwei, > (1) We are doing genome annotation for a new rodent species, we wonder whether we should use repeat library for "Mammalia" or "rodent"? Which is more proper, if we did not construct a species-specific repeat library for the new genome? Over masking can occur, but you should really only worry about it if there is a specific gene you are looking for or gene family and you don?t care about false positive gene models. On a genome wide level you will find that undermasking is almost always the greater danger. So I?d recommend using Mammalia. Also you should always build a species specific library when working with repeat rich organisms like mammals. > (2) With some concerns as discussed above emails, we did not train a species-specific repeat library. Since we have finished the annotation only using the repeat library from repeatMasker and Maker2, we wonder whether it is worth for us to firstly train a species-specific repeat library and then do the genome annotation again? Will it (i.e., trainning a species-specific repeat library) significantly affect the gene annotation and downstream analysis (e.g., gene family expansion analysis, positive selection)? It might be ok. Both Mammalia and rodent are already rich in related species repeats in RepBase. But you still may have a lot of false positives because of missed repeats. Repeats and transposable elements tend to create false regions of high evidence homology (make it look like you are getting evidence for a gene in the region, but when you look at the underlying sequence you realize it is a spurious alignment). > (3) We identified some gene families under contraction, but we want to confirm those gene families really lost copies in our new genome. Do you think it is worth to do the genome annotation without repeat masking, so there will not be genes missing from annotation due to repeat mask? Without repeat masking you will get a lot of false alignments. If you find anything without repeat masking you will need to do heavy manual review of the alignment and perhaps even domain identification to further weed out the many false positives you are sure to get. ?Carson From carsonhh at gmail.com Fri Aug 18 09:37:38 2017 From: carsonhh at gmail.com (Carson Holt) Date: Fri, 18 Aug 2017 09:37:38 -0600 Subject: [maker-devel] basis of gene removed in maker re-annotation In-Reply-To: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> References: <526D3D91-0762-4DE3-BE27-C10AC5BC7BCF@163.com> Message-ID: Genes are removed if they have no evidence support or are overlapped by another gene that has better evidence support (the AED score measures evidence support). If you pass in old gene models in GFF3 format (model_gff), they will always be kept, even without evidence support but can be replaced by better supported overlapping models. ?Carson > On Aug 18, 2017, at 4:46 AM, yplee wrote: > > Dear maker author, > > I am yongping li, a student from huazhong agriculture university, china. We used MAKER to re-annotation our genome annotation. There is some gene were removal in MAKER output when i input out previous annotation gff file, so what was the basis for gene removal? > > would you please provide us the details of gene remove? The reviews ask question when i submit my re-annotation paper to journal. > > > > Best regards > > > Yours Sincerely > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org From qwzhang0601 at gmail.com Mon Aug 21 10:51:34 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Mon, 21 Aug 2017 12:51:34 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: Dear Carson: I am trying to build a species specific repeat library for our new rodent species, following " http://weatherby.genetics.utah.edu/MAKER/wiki/index.php/Repeat_Library_Construction--Basic". But there are somethings not clear to us, would you please explain? Thanks (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder"*. *Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). In the file "maker_opts.ctl" #-----Repeat Masking (leave values blank to skip repeat masking) model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker Many thanks Best Quanwei 2017-08-18 11:35 GMT-04:00 Carson Holt : > Hi Quanwei, > > > (1) We are doing genome annotation for a new rodent species, we wonder > whether we should use repeat library for "Mammalia" or "rodent"? Which is > more proper, if we did not construct a species-specific repeat library for > the new genome? > > Over masking can occur, but you should really only worry about it if there > is a specific gene you are looking for or gene family and you don?t care > about false positive gene models. On a genome wide level you will find that > undermasking is almost always the greater danger. So I?d recommend using > Mammalia. Also you should always build a species specific library when > working with repeat rich organisms like mammals. > > > > (2) With some concerns as discussed above emails, we did not train a > species-specific repeat library. Since we have finished the annotation only > using the repeat library from repeatMasker and Maker2, we wonder whether it > is worth for us to firstly train a species-specific repeat library and > then do the genome annotation again? Will it (i.e., trainning a > species-specific repeat library) significantly affect the gene annotation > and downstream analysis (e.g., gene family expansion analysis, positive > selection)? > > It might be ok. Both Mammalia and rodent are already rich in related > species repeats in RepBase. But you still may have a lot of false positives > because of missed repeats. Repeats and transposable elements tend to create > false regions of high evidence homology (make it look like you are getting > evidence for a gene in the region, but when you look at the underlying > sequence you realize it is a spurious alignment). > > > > (3) We identified some gene families under contraction, but we want to > confirm those gene families really lost copies in our new genome. Do you > think it is worth to do the genome annotation without repeat masking, so > there will not be genes missing from annotation due to repeat mask? > > Without repeat masking you will get a lot of false alignments. If you find > anything without repeat masking you will need to do heavy manual review of > the alignment and perhaps even domain identification to further weed out > the many false positives you are sure to get. > > ?Carson -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Tue Aug 22 10:15:59 2017 From: carsonhh at gmail.com (Carson Holt) Date: Tue, 22 Aug 2017 10:15:59 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> Message-ID: The est2genome option takes an alignment and then just identifies the longest ORF in that alignment and turns it into a model (these models are good enough to rain with). The reason est2genoime is not recommended for the annotation step are several. 1. They are likely to be partial in many cases or include a number of merged assemblies depending on the organism. 2. They will likely only represent a fraction of the genes so relying only on est2genome models will result in low sensitivity since not everything is expected to be expressed or assembled. 3. Ab initio predictors that receive the intron/exon hints from a transcript evidence alignment should still replicate the structure of correctly assembled transcripts anyways, but they can still call genes in other regions without transcript evidence to improve sensitivity or improve structure for models with only partial transcript evidence alignment (i.e. they can complete the incomplete models). 4. If their are assembly error?s (you can expect a lot of these in a draft assembly), ab initio predictors can work around the errors to create an intron/exon structure with reasonable similar ORF that will be similar to the true ORF if not exactly correct, where alignment based methods cannot and will just produce a truncated ORF. 5. est2genome models will always have great AED scores (falsely good scores) since they are their own evidence and match themselves exactly, so spurious alignments and partial alignments always score very high even when they are bad models. By turning est2genome off, you allows the HMM scoring mechanism to act as an additional filter on those models. If you have really really good transcript evidence, it is possible for est2genome to work very well. But the likelihood of having evidence that perfect is low. So for those reasons we recommend using it only as an intermediate step. ?Carson > On Aug 19, 2017, at 10:38 AM, Tim Fallon wrote: > > Hi Carson, > > Just a follow up to this, for posterity. I was able to do what I wanted by using just the est2genome=1, and turning off protein2genome. The input to the est2genome is a Trinity de novo transcriptome assembly with strand specific libraries + assembly and jaccard clip. The results seem quite reliable, and I?m not getting the problem where tandem similar genes were getting fused anymore (the original problem with this inquiry). I expect this is due to there being enough nucleotide differences in the est2genome alignment of two similar and tandem transcripts to effectively distinguish them. > > In any event, it wasn?t clear to me that est2genome=1 alone would produce ORF/CDS predictions (for the genes), and I?ve done a lot of reading around the Maker documentation and papers. Might be worth considering making the documentation more clear in this respect in the future. I know that est2genome & protein2genome were originally intended more as an intermediate step for ab-initio gene predictor training, but in my opinion with the quality and cost-effectivness of transcript discovery RNA-Seq, it seems reasonable to ditch the ab-initio gene prediction and go entirely with a ?est2genome=1? like approach. It might be worthwhile to document what your thought process would be for reliable ab-initio free gene annotation w/ Maker. I?ll mention I haven?t looked into the PASA pipeline for this, which is the only other major publicly available gene structure annotation pipeline known to me, as the parallelization in Maker has been working quite well for me. > > Are the heuristics for this ORF prediction in est2genome=1 documented anywhere? E.g., does it only pick the longest ORF per transcript? Or if there are multiple ?good? ORFs (>200 amino acids) per transcript, will it try and split those into different genes? I ask as my current task is trying to merge the previously mentioned de novo transcriptome derived gene models from est2genome with est2genome gene models of a reference guided transcriptome assembly. Although the reference guided transcript assembly captures more genes that the Trinity assembly (by tblastn), the transcripts are notably artifactually chimeric, sometimes containing 4-5 CDSs, so the heuristics for the Maker est2genome could be pretty influential. > > All the best, > -Tim > >> On Jul 13, 2017, at 1:05 PM, Carson Holt > wrote: >> >> est2genome and protein2genome take BLAST hits, polish them with exonerate around splice sites and then turn the alignment directly into a gene model. So if the alignment is partial because the EST or mRNA-seq do not cross the entire transcript or the protein homology does not cross the entire CDS, then the resulting model will be partial. It can be end to end, but partial tends to be more common than not unless you are using a protein evidence library with limited divergence. >> >> ?Carson >> >> >> >>> On Jul 10, 2017, at 2:00 PM, Tim Fallon > wrote: >>> >>> Hi Carson, >>> >>> So far what I've noticed with just est2genome, and protein2genome, using only de novo assembled transcripts with transdecoder predicted peptides (both mapped in maker with blast evalue limit = 1e-50), the gene models (for the genes where I have enough information about the "correct" gene structure), have been full length. Is this unexpected? >>> >>> Will try Apollo. Though I'd like to avoid manual curation. Perhaps it is worth talking to the Augustus developers to see why Augustus was making the exon error in my key gene that led me to ditching it altogether. >>> >>> Agree there are varying qualities of draft assemblies. In our case, we did 100X Illumina hybrid assembly w/ 50X PacBio. The local structure so far seems to be pretty good. >>> >>> Good to know that the human and mouse assemblies even have gene errors, makes me feel better about how much time I've put in trying to get my genome annotation perfect :) >>> >>> All the best, >>> -Tim >>> >>> On Jul 10, 2017, at 3:20 PM, Carson Holt > wrote: >>> >>>> est2genome and protein2genome will almost always be partial. Also the error rate on draft assemblies is much higher than most people realize. Beyond issues already mentioned in the previous e-mail, there is also the issue that organisms are diploid, but the assembly is haploid, so variation gets squashed which also breaks ORFs (there are several examples of this in both the mature human and mouse genome assemblies). For many draft assemblies, you can expect ORF affecting errors in as much as 10-15% of your annotations. >>>> >>>> Try opening the cases with issues and manually editing them in Apollo. Possible sources of sequence guiding the annotation may become more apparent (look at mismatches in the mRNA-seq alignments relative to the assembly for example). And if not, and the region is just too complex for the predictor, then you can force the model with Apollo. >>>> >>>> ?Carson >>>> >>>> >>>>> On Jul 6, 2017, at 6:45 AM, Tim Fallon > wrote: >>>>> >>>>> Hi Carson, >>>>> >>>>> This region is definitely entirely correct at the genomic nucleotide level, no missassemblies. Would you have any strong reservations about ditching the ab-initio prediction and sticking entirely with the est2genome predictions and protein2genome predictions? Right now this is what I?m thinking, as troubleshooting the ab-initio training seems like it could be a long road. >>>>> >>>>> All the best, >>>>> -Tim >>>>> >>>>>> On Jun 26, 2017, at 6:00 PM, Carson Holt > wrote: >>>>>> >>>>>> Augustus uses an HMM with scoring bonuses for evidence match. If a difference in the assembly breaks the ORF anywhere in the transcript relative to the evidence or removes high scoring transcript start/stop sequences, then Augustus will add/skip exons or trim/extend transcripts to capture what scoring bonuses it can as best it can. So wherever you see Augustus behaving weirdly, you likely have something off in the assembly (small stretch of NN?s or single basepair duplications/deletions that affect the ORF and scoring model). So what Augustus produces is the best fit gene model to hop around assembly anomalies while still producing a canonical model. >>>>>> >>>>>> In areas like the ones I describe above, EVM refuses to produce any model. So you can experiment with the EVM options in MAKER3, but what you may find is that problem regions tend to get no models with EVM. I believe using the pred_gff trick I mentioned previously may be the easiest work around. Also make sure to prefilter mRNA-seq evidence to avoid transcript joining (trinity has a jaccard_clip option which can help). Because if you are getting transcript joining in proteins, you are almost certain to get it in transcript evidence as well. >>>>>> >>>>>> ?Carson >>>>>> >>>>>>> On Jun 22, 2017, at 10:59 PM, Tim Fallon > wrote: >>>>>>> >>>>>>> Hi Carson, >>>>>>> >>>>>>> Thanks for the response! After sending my initial email, I did notice this particular issue was warned about in the Cambell et al. 2014 Maker protocols paper. Perhaps future versions of the pipeline might have a workaround or warning for this presumably common issue. At least in my case, the genome I?m annotating has large introns, and also tandem gene clusters of homologous genes, so I?ve been unable to solve this issue entirely by changing existing parameters (e.g. split_hit), though perhaps exonerate / protein2genome direct gene annotation does handle it correctly. >>>>>>> >>>>>>> Regarding the protein2genome only being a intermediate stage, as I?ve been working towards a final annotation, I?ve actually been mostly relying on the protein2genome direct gene annotation, as although I have a trained Augustus that is presumably getting the hints from the evidence, my main target genes have been producing subtly wrong gene-models (Augustus produced splice sit off by a handful of nucleotides, leading to unintended & unsupported amino acids in the protein). I also trained SNAP, but those predictions were worse than the Augustus predictions. >>>>>>> >>>>>>> Do you have any tips for using the Evidence Modeler integration of the Maker 3.0.0 beta? That seems to be the best way to have the final gene models rely more on extrinsic evidence over my mildly incorrect ab-initio predictions. Or perhaps PASA is more appropriate for gene-models that would strictly adhere to extrinsic de novo assembled transcript / predicted ORF evidence? >>>>>>> >>>>>>> All the best, >>>>>>> -Tim >>>>>>> >>>>>>>> On Jun 23, 2017, at 12:27 AM, Carson Holt > wrote: >>>>>>>> >>>>>>>> The protein_match features are the direct BLASTX results. Because of how BLAST works, if you have neighboring paralogs, it can place HSPs in both. So the final hit ends up being to large. The protein2genome feature is then the result of exonerate polishing these blast alignments (this will usually remove false merging and bad exon order). The protein2genome=1 option on the other hand just tell maker that you want to try and convert the exonerate hits directly into gene models (only do this for training and not final annotation). One way to drop the BLASTX results may be to filter the GFF3 results to keep only protein2genome features, pass those into protein_gff, and then turn off protein= for the next run. This forces the blastx results to be dropped. You may want to set blast_depth parameters to something like 10 in maker_bopts.ctl before doing this to trim per locus evidence depth to 10 if you are using too much input data. >>>>>>>> >>>>>>>> ?Carson >>>>>>>> >>>>>>>> >>>>>>>> >>>>>>>>> On Jun 13, 2017, at 11:35 AM, Tim Fallon > wrote: >>>>>>>>> >>>>>>>>> Hi there, >>>>>>>>> >>>>>>>>> I am aligning reference proteins to an insect genome through Maker, in preparation for using the gene models from the protein alignments as evidence to train SNAP (alongside de-novo assembled RNA-Seq). I also plan on passing the protein alignments to a future Maker run as hints for SNAP / Augustus. >>>>>>>>> >>>>>>>>> I?ve noticed that the maker blastx "protein_match? feature, which I presume is a result of Maker trying to make the blastx HSPs contiguous to format as a reference for exonerate (this Maker run did have protein2genome turned on), tends to fuse tandem genes from the same gene family. See attached image. >>>>>>>>> >>>>>>>>> The red regions highlight two de novo assembled transcripts which I aligned manually, from two genes that are homologous. The top track is the blastx ?match_part? features, the bottom track is the blastx ?protein_match? features. You can see that the protein_match fuses the two genes, using ~1000 bp in an intervening region, that doesn?t have blastx HSP support in the blastx ?match_part? track. The trick seems to be that a single reference protein, has blastx matches on both the left and right gene. >>>>>>>>> >>>>>>>>> Cleary this isn?t a good gene model to train SNAP with, but would this misannotation screw up the hints passed to pretrained SNAP / Augustus? >>>>>>>>> >>>>>>>>> Is there anyway to prevent this protein_match fusing of adjacent similar genes from happening? For species that are closer, I?ve set the ?eval_blastx? to be a lot higher (1e-50), and in that case the genes don?t get fused (but, with that level of stringent search, it is more like an orthology search, rather than just annotating general protein similarity). I do have (rare) introns ~1000 bp, so I wouldn?t want to change the Maker ?split_hit? parameter to be too low. >>>>>>>>> >>>>>>>>> All the best, >>>>>>>>> -Tim >>>>>>>>> >>>>>>>>> Timothy R. Fallon >>>>>>>>> PhD candidate >>>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>>> Department of Biology >>>>>>>>> MIT >>>>>>>>> >>>>>>>>> tfallon at mit.edu >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>> _______________________________________________ >>>>>>>>> maker-devel mailing list >>>>>>>>> maker-devel at box290.bluehost.com >>>>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>>>> >>>>>>> >>>>>>> Timothy R. Fallon >>>>>>> PhD candidate >>>>>>> Laboratory of Jing-Ke Weng >>>>>>> Department of Biology >>>>>>> MIT >>>>>>> >>>>>>> tfallon at mit.edu >>>>>> >>>>> >>>>> Timothy R. Fallon >>>>> PhD candidate >>>>> Laboratory of Jing-Ke Weng >>>>> Department of Biology >>>>> MIT >>>>> >>>>> tfallon at mit.edu >>>> >> > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From tfallon at mit.edu Tue Aug 22 10:38:47 2017 From: tfallon at mit.edu (Tim Fallon) Date: Tue, 22 Aug 2017 12:38:47 -0400 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> Message-ID: <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) All the best, -Tim > On Aug 22, 2017, at 12:15 PM, Carson Holt wrote: > > The est2genome option takes an alignment and then just identifies the longest ORF in that alignment and turns it into a model (these models are good enough to rain with). The reason est2genoime is not recommended for the annotation step are several. > > 1. They are likely to be partial in many cases or include a number of merged assemblies depending on the organism. > 2. They will likely only represent a fraction of the genes so relying only on est2genome models will result in low sensitivity since not everything is expected to be expressed or assembled. > 3. Ab initio predictors that receive the intron/exon hints from a transcript evidence alignment should still replicate the structure of correctly assembled transcripts anyways, but they can still call genes in other regions without transcript evidence to improve sensitivity or improve structure for models with only partial transcript evidence alignment (i.e. they can complete the incomplete models). > 4. If their are assembly error?s (you can expect a lot of these in a draft assembly), ab initio predictors can work around the errors to create an intron/exon structure with reasonable similar ORF that will be similar to the true ORF if not exactly correct, where alignment based methods cannot and will just produce a truncated ORF. > 5. est2genome models will always have great AED scores (falsely good scores) since they are their own evidence and match themselves exactly, so spurious alignments and partial alignments always score very high even when they are bad models. By turning est2genome off, you allows the HMM scoring mechanism to act as an additional filter on those models. > > If you have really really good transcript evidence, it is possible for est2genome to work very well. But the likelihood of having evidence that perfect is low. So for those reasons we recommend using it only as an intermediate step. > > ?Carson > > > >> On Aug 19, 2017, at 10:38 AM, Tim Fallon > wrote: >> >> Hi Carson, >> >> Just a follow up to this, for posterity. I was able to do what I wanted by using just the est2genome=1, and turning off protein2genome. The input to the est2genome is a Trinity de novo transcriptome assembly with strand specific libraries + assembly and jaccard clip. The results seem quite reliable, and I?m not getting the problem where tandem similar genes were getting fused anymore (the original problem with this inquiry). I expect this is due to there being enough nucleotide differences in the est2genome alignment of two similar and tandem transcripts to effectively distinguish them. >> >> In any event, it wasn?t clear to me that est2genome=1 alone would produce ORF/CDS predictions (for the genes), and I?ve done a lot of reading around the Maker documentation and papers. Might be worth considering making the documentation more clear in this respect in the future. I know that est2genome & protein2genome were originally intended more as an intermediate step for ab-initio gene predictor training, but in my opinion with the quality and cost-effectivness of transcript discovery RNA-Seq, it seems reasonable to ditch the ab-initio gene prediction and go entirely with a ?est2genome=1? like approach. It might be worthwhile to document what your thought process would be for reliable ab-initio free gene annotation w/ Maker. I?ll mention I haven?t looked into the PASA pipeline for this, which is the only other major publicly available gene structure annotation pipeline known to me, as the parallelization in Maker has been working quite well for me. >> >> Are the heuristics for this ORF prediction in est2genome=1 documented anywhere? E.g., does it only pick the longest ORF per transcript? Or if there are multiple ?good? ORFs (>200 amino acids) per transcript, will it try and split those into different genes? I ask as my current task is trying to merge the previously mentioned de novo transcriptome derived gene models from est2genome with est2genome gene models of a reference guided transcriptome assembly. Although the reference guided transcript assembly captures more genes that the Trinity assembly (by tblastn), the transcripts are notably artifactually chimeric, sometimes containing 4-5 CDSs, so the heuristics for the Maker est2genome could be pretty influential. >> >> All the best, >> -Tim >> >>> On Jul 13, 2017, at 1:05 PM, Carson Holt > wrote: >>> >>> est2genome and protein2genome take BLAST hits, polish them with exonerate around splice sites and then turn the alignment directly into a gene model. So if the alignment is partial because the EST or mRNA-seq do not cross the entire transcript or the protein homology does not cross the entire CDS, then the resulting model will be partial. It can be end to end, but partial tends to be more common than not unless you are using a protein evidence library with limited divergence. >>> >>> ?Carson >>> >>> >>> >>>> On Jul 10, 2017, at 2:00 PM, Tim Fallon > wrote: >>>> >>>> Hi Carson, >>>> >>>> So far what I've noticed with just est2genome, and protein2genome, using only de novo assembled transcripts with transdecoder predicted peptides (both mapped in maker with blast evalue limit = 1e-50), the gene models (for the genes where I have enough information about the "correct" gene structure), have been full length. Is this unexpected? >>>> >>>> Will try Apollo. Though I'd like to avoid manual curation. Perhaps it is worth talking to the Augustus developers to see why Augustus was making the exon error in my key gene that led me to ditching it altogether. >>>> >>>> Agree there are varying qualities of draft assemblies. In our case, we did 100X Illumina hybrid assembly w/ 50X PacBio. The local structure so far seems to be pretty good. >>>> >>>> Good to know that the human and mouse assemblies even have gene errors, makes me feel better about how much time I've put in trying to get my genome annotation perfect :) >>>> >>>> All the best, >>>> -Tim >>>> >>>> On Jul 10, 2017, at 3:20 PM, Carson Holt > wrote: >>>> >>>>> est2genome and protein2genome will almost always be partial. Also the error rate on draft assemblies is much higher than most people realize. Beyond issues already mentioned in the previous e-mail, there is also the issue that organisms are diploid, but the assembly is haploid, so variation gets squashed which also breaks ORFs (there are several examples of this in both the mature human and mouse genome assemblies). For many draft assemblies, you can expect ORF affecting errors in as much as 10-15% of your annotations. >>>>> >>>>> Try opening the cases with issues and manually editing them in Apollo. Possible sources of sequence guiding the annotation may become more apparent (look at mismatches in the mRNA-seq alignments relative to the assembly for example). And if not, and the region is just too complex for the predictor, then you can force the model with Apollo. >>>>> >>>>> ?Carson >>>>> >>>>> >>>>>> On Jul 6, 2017, at 6:45 AM, Tim Fallon > wrote: >>>>>> >>>>>> Hi Carson, >>>>>> >>>>>> This region is definitely entirely correct at the genomic nucleotide level, no missassemblies. Would you have any strong reservations about ditching the ab-initio prediction and sticking entirely with the est2genome predictions and protein2genome predictions? Right now this is what I?m thinking, as troubleshooting the ab-initio training seems like it could be a long road. >>>>>> >>>>>> All the best, >>>>>> -Tim >>>>>> >>>>>>> On Jun 26, 2017, at 6:00 PM, Carson Holt > wrote: >>>>>>> >>>>>>> Augustus uses an HMM with scoring bonuses for evidence match. If a difference in the assembly breaks the ORF anywhere in the transcript relative to the evidence or removes high scoring transcript start/stop sequences, then Augustus will add/skip exons or trim/extend transcripts to capture what scoring bonuses it can as best it can. So wherever you see Augustus behaving weirdly, you likely have something off in the assembly (small stretch of NN?s or single basepair duplications/deletions that affect the ORF and scoring model). So what Augustus produces is the best fit gene model to hop around assembly anomalies while still producing a canonical model. >>>>>>> >>>>>>> In areas like the ones I describe above, EVM refuses to produce any model. So you can experiment with the EVM options in MAKER3, but what you may find is that problem regions tend to get no models with EVM. I believe using the pred_gff trick I mentioned previously may be the easiest work around. Also make sure to prefilter mRNA-seq evidence to avoid transcript joining (trinity has a jaccard_clip option which can help). Because if you are getting transcript joining in proteins, you are almost certain to get it in transcript evidence as well. >>>>>>> >>>>>>> ?Carson >>>>>>> >>>>>>>> On Jun 22, 2017, at 10:59 PM, Tim Fallon > wrote: >>>>>>>> >>>>>>>> Hi Carson, >>>>>>>> >>>>>>>> Thanks for the response! After sending my initial email, I did notice this particular issue was warned about in the Cambell et al. 2014 Maker protocols paper. Perhaps future versions of the pipeline might have a workaround or warning for this presumably common issue. At least in my case, the genome I?m annotating has large introns, and also tandem gene clusters of homologous genes, so I?ve been unable to solve this issue entirely by changing existing parameters (e.g. split_hit), though perhaps exonerate / protein2genome direct gene annotation does handle it correctly. >>>>>>>> >>>>>>>> Regarding the protein2genome only being a intermediate stage, as I?ve been working towards a final annotation, I?ve actually been mostly relying on the protein2genome direct gene annotation, as although I have a trained Augustus that is presumably getting the hints from the evidence, my main target genes have been producing subtly wrong gene-models (Augustus produced splice sit off by a handful of nucleotides, leading to unintended & unsupported amino acids in the protein). I also trained SNAP, but those predictions were worse than the Augustus predictions. >>>>>>>> >>>>>>>> Do you have any tips for using the Evidence Modeler integration of the Maker 3.0.0 beta? That seems to be the best way to have the final gene models rely more on extrinsic evidence over my mildly incorrect ab-initio predictions. Or perhaps PASA is more appropriate for gene-models that would strictly adhere to extrinsic de novo assembled transcript / predicted ORF evidence? >>>>>>>> >>>>>>>> All the best, >>>>>>>> -Tim >>>>>>>> >>>>>>>>> On Jun 23, 2017, at 12:27 AM, Carson Holt > wrote: >>>>>>>>> >>>>>>>>> The protein_match features are the direct BLASTX results. Because of how BLAST works, if you have neighboring paralogs, it can place HSPs in both. So the final hit ends up being to large. The protein2genome feature is then the result of exonerate polishing these blast alignments (this will usually remove false merging and bad exon order). The protein2genome=1 option on the other hand just tell maker that you want to try and convert the exonerate hits directly into gene models (only do this for training and not final annotation). One way to drop the BLASTX results may be to filter the GFF3 results to keep only protein2genome features, pass those into protein_gff, and then turn off protein= for the next run. This forces the blastx results to be dropped. You may want to set blast_depth parameters to something like 10 in maker_bopts.ctl before doing this to trim per locus evidence depth to 10 if you are using too much input data. >>>>>>>>> >>>>>>>>> ?Carson >>>>>>>>> >>>>>>>>> >>>>>>>>> >>>>>>>>>> On Jun 13, 2017, at 11:35 AM, Tim Fallon > wrote: >>>>>>>>>> >>>>>>>>>> Hi there, >>>>>>>>>> >>>>>>>>>> I am aligning reference proteins to an insect genome through Maker, in preparation for using the gene models from the protein alignments as evidence to train SNAP (alongside de-novo assembled RNA-Seq). I also plan on passing the protein alignments to a future Maker run as hints for SNAP / Augustus. >>>>>>>>>> >>>>>>>>>> I?ve noticed that the maker blastx "protein_match? feature, which I presume is a result of Maker trying to make the blastx HSPs contiguous to format as a reference for exonerate (this Maker run did have protein2genome turned on), tends to fuse tandem genes from the same gene family. See attached image. >>>>>>>>>> >>>>>>>>>> The red regions highlight two de novo assembled transcripts which I aligned manually, from two genes that are homologous. The top track is the blastx ?match_part? features, the bottom track is the blastx ?protein_match? features. You can see that the protein_match fuses the two genes, using ~1000 bp in an intervening region, that doesn?t have blastx HSP support in the blastx ?match_part? track. The trick seems to be that a single reference protein, has blastx matches on both the left and right gene. >>>>>>>>>> >>>>>>>>>> Cleary this isn?t a good gene model to train SNAP with, but would this misannotation screw up the hints passed to pretrained SNAP / Augustus? >>>>>>>>>> >>>>>>>>>> Is there anyway to prevent this protein_match fusing of adjacent similar genes from happening? For species that are closer, I?ve set the ?eval_blastx? to be a lot higher (1e-50), and in that case the genes don?t get fused (but, with that level of stringent search, it is more like an orthology search, rather than just annotating general protein similarity). I do have (rare) introns ~1000 bp, so I wouldn?t want to change the Maker ?split_hit? parameter to be too low. >>>>>>>>>> >>>>>>>>>> All the best, >>>>>>>>>> -Tim >>>>>>>>>> >>>>>>>>>> Timothy R. Fallon >>>>>>>>>> PhD candidate >>>>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>>>> Department of Biology >>>>>>>>>> MIT >>>>>>>>>> >>>>>>>>>> tfallon at mit.edu >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> >>>>>>>>>> _______________________________________________ >>>>>>>>>> maker-devel mailing list >>>>>>>>>> maker-devel at box290.bluehost.com >>>>>>>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>>>>>>> >>>>>>>> >>>>>>>> Timothy R. Fallon >>>>>>>> PhD candidate >>>>>>>> Laboratory of Jing-Ke Weng >>>>>>>> Department of Biology >>>>>>>> MIT >>>>>>>> >>>>>>>> tfallon at mit.edu >>>>>>> >>>>>> >>>>>> Timothy R. Fallon >>>>>> PhD candidate >>>>>> Laboratory of Jing-Ke Weng >>>>>> Department of Biology >>>>>> MIT >>>>>> >>>>>> tfallon at mit.edu >>>>> >>> >> >> >> > Timothy R. Fallon PhD candidate Laboratory of Jing-Ke Weng Department of Biology MIT tfallon at mit.edu -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- A non-text attachment was scrubbed... Name: smime.p7s Type: application/pkcs7-signature Size: 1853 bytes Desc: not available URL: From isabel.marcelino.im at gmail.com Wed Aug 23 10:29:57 2017 From: isabel.marcelino.im at gmail.com (Isabel Marcelino) Date: Wed, 23 Aug 2017 12:29:57 -0400 Subject: [maker-devel] Fwd: Errors with Blast engine and Fasta index In-Reply-To: References: Message-ID: ---------- Forwarded message ---------- From: Isabel Marcelino Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker-devel at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/ Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_ tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/ Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI Garanti sans virus. www.avast.com <#DAB4FAD8-2DD7-40BB-A1B8-4E2AA1F9FDF2> -------------- next part -------------- An HTML attachment was scrubbed... URL: From willett4 at email.unc.edu Wed Aug 23 10:26:05 2017 From: willett4 at email.unc.edu (Willett, Christopher S) Date: Wed, 23 Aug 2017 16:26:05 +0000 Subject: [maker-devel] question about FASTA warnings Message-ID: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Hello- I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. Thanks for your help, Best, Chris Willett here is a portion of the run log with some examples of the warnings: ------------------------------------------------------------ # LSBATCH: User input maker ------------------------------------------------------------ Successfully completed. Resource usage summary: CPU time : 59.63 sec. Total Requested Memory : 0.50 GB Delta Memory : - Max Processes : 7 Max Threads : 8 Run time : 47 sec. Turnaround time : 55 sec. The output (if any) follows: STATUS: Parsing control files... STATUS: Processing and indexing input FASTA files... STATUS: Setting up database for any GFF3 input... A data structure will be created for you at: /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore To access files for individual sequences use the datastore index: /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log STATUS: Now running MAKER... examining contents of the fasta file and run log --Next Contig-- #--------------------------------------------------------------------- Now starting the contig!! SeqID: contig-dpp-500-500 Length: 32156 #--------------------------------------------------------------------- setting up GFF3 output and fasta chunks doing repeat masking running repeat masker. #--------- command -------------# Widget::RepeatMasker: cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 #-------------------------------# doing blastx repeats formating database... #--------- command -------------# Widget::formater: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 #-------------------------------# Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. running blast search. #--------- command -------------# Widget::blastx: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner #-------------------------------# deleted:0 hits doing blastx repeats formating database... #--------- command -------------# Widget::formater: /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 #-------------------------------# Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) (continues on as above but title lengths are different) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Research Associate Professor Department of Biology CB#3280 Coker Hall University of North Carolina, Chapel Hill Chapel Hill, NC, 27599-3280 Office: 2252 Genome Science Building phone: 919-843-8663 fax: 919-962-1625 http://labs.bio.unc.edu/Willett/ -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Wed Aug 23 10:57:59 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Wed, 23 Aug 2017 16:57:59 +0000 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: References: Message-ID: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? ~Daniel On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: ---------- Forwarded message ---------- From: Isabel Marcelino > Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker-devel at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI [https://ipmcdn.avast.com/images/icons/icon-envelope-tick-round-orange-animated-no-repeat-v1.gif] Garanti sans virus. www.avast.com _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Wed Aug 23 10:47:40 2017 From: dandence at gmail.com (Daniel Ence) Date: Wed, 23 Aug 2017 12:47:40 -0400 Subject: [maker-devel] question about FASTA warnings In-Reply-To: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> References: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Message-ID: Hi Chris, I haven?t seen that warning either in my usage of MAKER. My guess is that the version of Repeatmasker installed on your cluster has this warning and expects a certain format in the fasta headers. This could be checked by looking at the TE protein file that maker is using. Do you have access to that? In any case it probably isn?t an issue that needs to be fixed if the output otherwise looks good. ~Daniel > On Aug 23, 2017, at 12:26 PM, Willett, Christopher S wrote: > > Hello- > > I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. > > Thanks for your help, > > Best, > > Chris Willett > > here is a portion of the run log with some examples of the warnings: > > ------------------------------------------------------------ > # LSBATCH: User input > maker > ------------------------------------------------------------ > > Successfully completed. > > Resource usage summary: > > CPU time : 59.63 sec. > Total Requested Memory : 0.50 GB > Delta Memory : - > Max Processes : 7 > Max Threads : 8 > Run time : 47 sec. > Turnaround time : 55 sec. > > The output (if any) follows: > > STATUS: Parsing control files... > STATUS: Processing and indexing input FASTA files... > STATUS: Setting up database for any GFF3 input... > A data structure will be created for you at: > /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore > > To access files for individual sequences use the datastore index: > /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log > > STATUS: Now running MAKER... > examining contents of the fasta file and run log > > > > --Next Contig-- > > #--------------------------------------------------------------------- > Now starting the contig!! > SeqID: contig-dpp-500-500 > Length: 32156 > #--------------------------------------------------------------------- > > > setting up GFF3 output and fasta chunks > doing repeat masking > running repeat masker. > #--------- command -------------# > Widget::RepeatMasker: > cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 > #-------------------------------# > doing blastx repeats > formating database... > #--------- command -------------# > Widget::formater: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 > #-------------------------------# > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > running blast search. > #--------- command -------------# > Widget::blastx: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner > #-------------------------------# > deleted:0 hits > doing blastx repeats > formating database... > #--------- command -------------# > Widget::formater: > /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 > #-------------------------------# > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. > Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) > > (continues on as above but title lengths are different) > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > Research Associate Professor > Department of Biology > CB#3280 Coker Hall > University of North Carolina, Chapel Hill > Chapel Hill, NC, 27599-3280 > > Office: 2252 Genome Science Building > phone: > 919-843-8663 > fax: > 919-962-1625 > > http://labs.bio.unc.edu/Willett/ > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From isabel.marcelino.im at gmail.com Wed Aug 23 11:38:06 2017 From: isabel.marcelino.im at gmail.com (Isabel Marcelino) Date: Wed, 23 Aug 2017 10:38:06 -0700 (PDT) Subject: [maker-devel] Fwd: Errors with Blast engine and Fasta index In-Reply-To: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Message-ID: <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> Hi Daniel, Thank you for your feedback. In fact, my fasta entry is not empty (please see below). I even tried to reprocess the genome fasta file that I already processed using MAKER and it doesn't work either... Isabel (PS: I do not manage to "reply" your message but only "forward" it. I was wondering if there are any settings I should change? I participate in other google groups and I can "reply" to messages. Thanks for the help) (>NODE_1_length_465927_cov_94.9908 ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....) On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote: > > Hi Isabel, The warning is referring to an empty entry in one of the fasta > files (?Warning: Sequence contains no data?). This is probably in the > genome fasta file that you are trying to annotate. Can you check the fasta > entry ?NODE_1_length_465927_cov_94.9908?? > > ~Daniel > > > > On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: > > > ---------- Forwarded message ---------- > From: Isabel Marcelino > > Date: 23 August 2017 at 11:37 > Subject: Errors with Blast engine and Fasta index > To: maker... at googlegroups.com > > > Hello, > > I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) > running smoothly a few weeks ago and I could perform a de novo annotation > of one of my genome. In the meantime, I worked on other topics and, > yesterday, when I tried to annotate another genome, MAKER was not working. > The following message was appearing: > > BLAST engine error: Warning: Sequence contains no data > deleted:0 hits > stop here: NODE_1_length_465927_cov_94.9908 > ERROR: Fasta index error > at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 1095. > Process::MpiChunk::__ANON__() called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm > line 415 > eval {...} called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm > line 407 > Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 4224 > Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', > 'HASH(0x4cca458)', 3, 0) called at > /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm > line 341 > Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) > called at ../../bin/maker line 1614 > main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 > --> rank=2, hostname=SRV-WGS > ERROR: Failed while preparing masked sequence > ERROR: Chunk failed at level:3, tier_type:0 > FAILED CONTIG:NODE_1_length_465927_cov_94.9908 > > I tried to solve the problem (re-install Repeatmasker and blast, check > location of the several executables, check tmp folder, re-install MAKER, > etc) but still, I am not able to solve the problem. > Could you please help me out with this? Thank you so much. > > Cheers, > Isabel > > ************************************************* > Isabel MARCELINO, PhD > Unit? Environnement Sant? > Institut Pasteur de Guadeloupe > Morne Jolivi?re - B.P. 484 > 97183 LES ABYMES Cedex > Guadeloupe, FWI > > > > > Garanti > sans virus. www.avast.com > > _______________________________________________ > maker-devel mailing list > maker... at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 12:00:26 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:00:26 -0600 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> Message-ID: It can also be that your temporary directory became full at one point or you set TMP= to a location that is not a local disk (i.e. set it to a network mounted storage location). The fasta index is based off of BerkleyDB which has issues if run of of network storage. In any case just restart, and it will probably get past the error on the retry. ?Carson > On Aug 23, 2017, at 10:57 AM, Ence,daniel wrote: > > Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? > > ~Daniel > > > >> On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: >> >> >> ---------- Forwarded message ---------- >> From: Isabel Marcelino > >> Date: 23 August 2017 at 11:37 >> Subject: Errors with Blast engine and Fasta index >> To: maker-devel at googlegroups.com >> >> >> Hello, >> >> I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. >> The following message was appearing: >> >> BLAST engine error: Warning: Sequence contains no data >> deleted:0 hits >> stop here: NODE_1_length_465927_cov_94.9908 >> ERROR: Fasta index error >> at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. >> Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 >> eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 >> Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 >> Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 >> Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 >> main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 >> --> rank=2, hostname=SRV-WGS >> ERROR: Failed while preparing masked sequence >> ERROR: Chunk failed at level:3, tier_type:0 >> FAILED CONTIG:NODE_1_length_465927_cov_94.9908 >> >> I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. >> Could you please help me out with this? Thank you so much. >> >> Cheers, >> Isabel >> >> ************************************************* >> Isabel MARCELINO, PhD >> Unit? Environnement Sant? >> Institut Pasteur de Guadeloupe >> Morne Jolivi?re - B.P. 484 >> 97183 LES ABYMES Cedex >> Guadeloupe, FWI >> >> >> >> Garanti sans virus. www.avast.com _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 11:57:30 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 11:57:30 -0600 Subject: [maker-devel] question about FASTA warnings In-Reply-To: References: <8DBDBB41-8B97-45D6-ADDC-1D7A4998935A@ad.unc.edu> Message-ID: <725B8728-A7F7-4F60-80C7-D842240D67F9@gmail.com> They are warnings from makeblastdb. It depends on what version of BLAST you have installed. Either upgrade or downgrade to get them to go away. They are just warnings and not errors though, so you can safely ignore them. They are just really annoying. ?Carson > On Aug 23, 2017, at 10:47 AM, Daniel Ence wrote: > > Hi Chris, I haven?t seen that warning either in my usage of MAKER. My guess is that the version of Repeatmasker installed on your cluster has this warning and expects a certain format in the fasta headers. This could be checked by looking at the TE protein file that maker is using. Do you have access to that? > > In any case it probably isn?t an issue that needs to be fixed if the output otherwise looks good. > > ~Daniel > > > >> On Aug 23, 2017, at 12:26 PM, Willett, Christopher S > wrote: >> >> Hello- >> >> I have been using MAKER to annotate the genome of a copepod species on a cluster at my university and I had one question about a warning that keeps coming up (and I didn?t see this problem discussed in the archives of the google group). This warning is happening even when I am running the test files so perhaps it is an issue with the installation on our server. It looks like it is a problem with the default TE protein file that maker is generating that spits out a bunch of warnings for each contig (see below). It appears that the program is running fine otherwise and the output looks good. I was wondering if this is a problem that I have to address or if I can go ahead and just use the results and ignore this warning? I am using MAKER 2.31.8. >> >> Thanks for your help, >> >> Best, >> >> Chris Willett >> >> here is a portion of the run log with some examples of the warnings: >> >> ------------------------------------------------------------ >> # LSBATCH: User input >> maker >> ------------------------------------------------------------ >> >> Successfully completed. >> >> Resource usage summary: >> >> CPU time : 59.63 sec. >> Total Requested Memory : 0.50 GB >> Delta Memory : - >> Max Processes : 7 >> Max Threads : 8 >> Run time : 47 sec. >> Turnaround time : 55 sec. >> >> The output (if any) follows: >> >> STATUS: Parsing control files... >> STATUS: Processing and indexing input FASTA files... >> STATUS: Setting up database for any GFF3 input... >> A data structure will be created for you at: >> /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore >> >> To access files for individual sequences use the datastore index: >> /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_master_datastore_index.log >> >> STATUS: Now running MAKER... >> examining contents of the fasta file and run log >> >> >> >> --Next Contig-- >> >> #--------------------------------------------------------------------- >> Now starting the contig!! >> SeqID: contig-dpp-500-500 >> Length: 32156 >> #--------------------------------------------------------------------- >> >> >> setting up GFF3 output and fasta chunks >> doing repeat masking >> running repeat masker. >> #--------- command -------------# >> Widget::RepeatMasker: >> cd /tmp/maker_U9T1oG; /nas02/apps/repeatmasker-4.0.5/RepeatMasker/RepeatMasker /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.all.rb -species all -dir /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0 -pa 1 >> #-------------------------------# >> doing blastx repeats >> formating database... >> #--------- command -------------# >> Widget::formater: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.0 >> #-------------------------------# >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 3121 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1667 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1158 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 2237 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 1038 characters (max is 1000) >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> running blast search. >> #--------- command -------------# >> Widget::blastx: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/blastx -db /tmp/maker_U9T1oG/te_proteins%2Efasta.mpi.10.0 -query /tmp/maker_U9T1oG/0/contig-dpp-500-500.0 -num_alignments 10000 -num_descriptions 10000 -evalue 1e-06 -dbsize 300 -searchsp 500000000 -num_threads 1 -seg yes -soft_masking true -lcase_masking -show_gis -out /proj/willetlb/users/cwillett/MAKER_analyses/data_test/dpp_contig.maker.output/dpp_contig_datastore/05/1F/contig-dpp-500-500//theVoid.contig-dpp-500-500/0/contig-dpp-500-500.0.te_proteins%2Efasta.repeatrunner.temp_dir/te_proteins%2Efasta.mpi.10.0.repeatrunner >> #-------------------------------# >> deleted:0 hits >> doing blastx repeats >> formating database... >> #--------- command -------------# >> Widget::formater: >> /nas02/apps/repeatmasker-4.0.5/rmblast-2.2.28/bin/makeblastdb -dbtype prot -in /tmp/maker_U9T1oG/0/blastprep/te_proteins%2Efasta.mpi.10.1 >> #-------------------------------# >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Ignoring FASTA modifier(s) found because the input was not expected to have any. >> Error: (1431.1) FASTA-Reader: Warning: FASTA-Reader: Title is very long: 4311 characters (max is 1000) >> >> (continues on as above but title lengths are different) >> >> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ >> Research Associate Professor >> Department of Biology >> CB#3280 Coker Hall >> University of North Carolina, Chapel Hill >> Chapel Hill, NC, 27599-3280 >> >> Office: 2252 Genome Science Building >> phone: >> 919-843-8663 >> fax: >> 919-962-1625 >> >> http://labs.bio.unc.edu/Willett/ >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 12:10:44 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:10:44 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: > (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". > I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? Try Swiss-Prot. That is a well curated cross species set. > (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). > > In the file "maker_opts.ctl" > #-----Repeat Masking (leave values blank to skip repeat masking) > model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker > rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker Yes. Supply both. ?Carson -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Wed Aug 23 12:20:51 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Wed, 23 Aug 2017 18:20:51 +0000 Subject: [maker-devel] Errors with Blast engine and Fasta index In-Reply-To: <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> References: <17014910-3C0F-4EE2-A5F3-5A943DB99623@mail.ufl.edu> <053af0d6-86f2-4358-ae74-feba12e15b1a@googlegroups.com> Message-ID: Hi Isabel, if the issue isn?t with the fasta file itself, then I would look into the things that Carson suggested: out of memory issues on the disk where the TMP directory is located, etc. ~Daniel On Aug 23, 2017, at 1:38 PM, Isabel Marcelino > wrote: Hi Daniel, Thank you for your feedback. In fact, my fasta entry is not empty (please see below). I even tried to reprocess the genome fasta file that I already processed using MAKER and it doesn't work either... Isabel (PS: I do not manage to "reply" your message but only "forward" it. I was wondering if there are any settings I should change? I participate in other google groups and I can "reply" to messages. Thanks for the help) (>NODE_1_length_465927_cov_94.9908 ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....) On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote: Hi Isabel, The warning is referring to an empty entry in one of the fasta files (?Warning: Sequence contains no data?). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry ?NODE_1_length_465927_cov_94.9908?? ~Daniel On Aug 23, 2017, at 12:29 PM, Isabel Marcelino > wrote: ---------- Forwarded message ---------- From: Isabel Marcelino > Date: 23 August 2017 at 11:37 Subject: Errors with Blast engine and Fasta index To: maker... at googlegroups.com Hello, I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working. The following message was appearing: BLAST engine error: Warning: Sequence contains no data deleted:0 hits stop here: NODE_1_length_465927_cov_94.9908 ERROR: Fasta index error at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095. Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415 eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407 Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224 Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341 Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614 main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999 --> rank=2, hostname=SRV-WGS ERROR: Failed while preparing masked sequence ERROR: Chunk failed at level:3, tier_type:0 FAILED CONTIG:NODE_1_length_465927_cov_94.9908 I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem. Could you please help me out with this? Thank you so much. Cheers, Isabel ************************************************* Isabel MARCELINO, PhD Unit? Environnement Sant? Institut Pasteur de Guadeloupe Morne Jolivi?re - B.P. 484 97183 LES ABYMES Cedex Guadeloupe, FWI [https://lh6.googleusercontent.com/proxy/JjzEPM_1UQiAcgcIii9zH3waHJfrDmD6mwOpzjvKSWAzeFyvEmJKxjsfyB4-JKbN4o_rmMG0O6UuV95TfuAG3NaBCtKzucfHCUODobStNrGqQJzTwuEOKfxUSFySxNn_igewCYnfXbgJP-gAq2cupOvC=w5000-h5000] Garanti sans virus. www.avast.com _______________________________________________ maker-devel mailing list maker... at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 23 12:21:44 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:21:44 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> Message-ID: <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> > Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? We don?t have an externally editable wiki, but the mailing list is archived on google groups and is searchable. > As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). Related to this, I just got off of a conference call where we were looking at Augustus behavior, and a student did an experiment where they introduced early stop codons into 100 genes, then let Augustus predict again. 80% of the time Augustus altered splicing patterns to try and jump over the stop codon, 11% of the time it would truncate the transcript, and 9% of the time it would refuse to call anything. So when you see splicing errors, it is usually because something is affecting the ORF somewhere, so it alters splicing to extend the ORF to get the maximum scoring bonus by capturing downstream parts of features en hints > A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) MAKER only annotates tRNA?s and whatever snoscan annotates. It does not annotated any other non-coding features. ?Carson From carsonhh at gmail.com Wed Aug 23 12:25:24 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 23 Aug 2017 12:25:24 -0600 Subject: [maker-devel] Maker protein match & tandem similar genes In-Reply-To: <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> References: <6AE52D93-3F7D-4389-BE7B-BD3033F3F316@mit.edu> <6DBD3F6E-C2DA-47AB-AF6B-DEA396789C79@gmail.com> <7164F2B4-FD8A-466F-B7CA-A1BEEF98223F@mit.edu> <4D5E9712-E95B-4687-8706-2AB445191C89@gmail.com> <507F9A79-B510-4333-92BD-F2215B3D59CB@mit.edu> <64B0C02B-A5B4-4936-986F-7CDC51740C33@gmail.com> <9B15EBB1-7CCC-4C7C-9C5B-7CC2A647D899@mit.edu> <9481986B-F9D5-4159-B407-3B04C2C3831E@mit.edu> <190BC573-5911-494B-AE0F-FE0794FD471A@gmail.com> Message-ID: Sorry 19,000 genes and not 100 genes in the Augustus test. ?Carson > On Aug 23, 2017, at 12:21 PM, Carson Holt wrote: > >> Thanks Carson, I appreciate your insights. Has been interesting to learn about the the whole genome annotation process. Makes me realize that is is really not a solved area, but I?m glad that maker exists and is easy enough to use for someone who isn?t an expert in it. Is there somewhere I could put your response on the Maker documentation wiki? > > We don?t have an externally editable wiki, but the mailing list is archived on google groups and is searchable. > > >> As I was mentioning earlier in the thread, the ab-initio predictor (augustus) was making errors sublte errors (splice donor site being ~12 nt downstream than supported), despite being trained (I trained through BUSCO, for ease), and having an aligned transcript ?hint? which had the correct structure. I believe the maker configuration was correct. Beyond troubleshooting the augustus training, which seems a bit complicated, and doing manual curation / fixing of the gene models (which seems to be a bandaid over my potentially misconfigured augustus training?), going with a purely est2genome=1 approach seems to be a nice way to do it. Better in my opinion to have a known unknown (obvious errors, fragmented genes that are supported by transcript evidence), that unknown unknowns (subtle errors in exon-exon junctions from augustus). > > Related to this, I just got off of a conference call where we were looking at Augustus behavior, and a student did an experiment where they introduced early stop codons into 100 genes, then let Augustus predict again. 80% of the time Augustus altered splicing patterns to try and jump over the stop codon, 11% of the time it would truncate the transcript, and 9% of the time it would refuse to call anything. So when you see splicing errors, it is usually because something is affecting the ORF somewhere, so it alters splicing to extend the ORF to get the maximum scoring bonus by capturing downstream parts of features en hints > > >> A quick question: Could you confirm / deny that Maker doesn?t annotate non-coding RNA genes? E.g. I?ve picked up some rRNAs and ncRNAs in my de novo transcriptome, but my understanding is that est2genome and the ab-inition approach requires that an ORF be present, hence no non-coding RNA genes (beyond the tRNAs and whatnot that can be specifically included) > > MAKER only annotates tRNA?s and whatever snoscan annotates. It does not annotated any other non-coding features. > > ?Carson From eennadi at gmail.com Sun Aug 27 08:16:03 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Sun, 27 Aug 2017 15:16:03 +0100 Subject: [maker-devel] Maker not installing Message-ID: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 07:00:11 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 13:00:11 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: Message-ID: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 07:57:22 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 13:57:22 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Message-ID: <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? Thanks, Daniel Ence On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9 ============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From d.ence at ufl.edu Mon Aug 28 08:07:14 2017 From: d.ence at ufl.edu (Ence,daniel) Date: Mon, 28 Aug 2017 14:07:14 +0000 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Message-ID: <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: Hi Daniel The reply is emmannamekasMBP:maker emmannaemeka$ MAKER -ctl -bash: MAKER: command not found Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? Thanks, Daniel Ence On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9 ============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. Thanks, Daniel Ence On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: Hello all, I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. However trying to run maker it wouldn't run. Please how do I install maker to run on local computer? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications _______________________________________________ maker-devel mailing list maker-devel at box290.bluehost.com http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 07:24:58 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 14:24:58 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> Message-ID: Hi Ence, Thanks for your reply, This is the step and error received emmannamekasMBP:src emmannaemeka$ ./build install Installing MAKER... Building MAKER Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) The build status is ============================================================================= STATUS MAKER v2.31.9============================================================================== PERL Dependencies: VERIFIED External Programs: VERIFIED External C Libraries: VERIFIED MPI SUPPORT: DISABLED MWAS Web Interface: DISABLED MAKER PACKAGE: CONFIGURATION OK Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: > Hi Emmanuel, In order for anyone to help you, you need post to the mailing > list the command and output (including errors) of the step that didn?t > work. > > Thanks, > Daniel Ence > > > On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: > > Hello all, > > I downloaded Maker and tried to install it. I succeeded in installing all > prerequisites however running maker ./build install, it showed that maker > installed. > > However trying to run maker it wouldn't run. > > Please how do I install maker to run on local computer? > > Thanks > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 08:00:04 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 15:00:04 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> Message-ID: Hi Daniel The reply is emmannamekasMBP:maker emmannaemeka$ MAKER -ctl -bash: MAKER: command not found Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel wrote: > Hi, It looks like MAKER installed ok. What is the command that you used to > try to run MAKER? Can you show the result of running ?MAKER -ctl?? > > Thanks, > Daniel Ence > > > On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi wrote: > > Hi Ence, > Thanks for your reply, > > This is the step and error received > > emmannamekasMBP:src emmannaemeka$ ./build install > Installing MAKER... > Building MAKER > Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) > > The build status is > ============================================================================= > STATUS MAKER v2.31.9============================================================================== > PERL Dependencies: VERIFIED > External Programs: VERIFIED > External C Libraries: VERIFIED > MPI SUPPORT: DISABLED > MWAS Web Interface: DISABLED > MAKER PACKAGE: CONFIGURATION OK > > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: > >> Hi Emmanuel, In order for anyone to help you, you need post to the >> mailing list the command and output (including errors) of the step that >> didn?t work. >> >> Thanks, >> Daniel Ence >> >> >> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: >> >> Hello all, >> >> I downloaded Maker and tried to install it. I succeeded in installing all >> prerequisites however running maker ./build install, it showed that maker >> installed. >> >> However trying to run maker it wouldn't run. >> >> Please how do I install maker to run on local computer? >> >> Thanks >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/ >> profile/Emmanuel_Nnadi/publications >> >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >> >> >> > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 28 09:49:32 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 28 Aug 2017 09:49:32 -0600 Subject: [maker-devel] Maker not installing In-Reply-To: <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: After install the executables will be in the ?/maker/bin directory. Example (if you did the install in your home directory) ?> ~/maker/bin/maker You need to add the ?/maker/bin directory to your PATH for it to be found just by typing ?maker' Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html ?Carson > On Aug 28, 2017, at 8:07 AM, Ence,daniel wrote: > > Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? > > > >> On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: >> >> Hi Daniel >> The reply is >> emmannamekasMBP:maker emmannaemeka$ MAKER -ctl >> -bash: MAKER: command not found >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >> On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: >> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >> >> Thanks, >> Daniel Ence >> >> >>> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: >>> >>> Hi Ence, >>> Thanks for your reply, >>> >>> This is the step and error received >>> emmannamekasMBP:src emmannaemeka$ ./build install >>> Installing MAKER... >>> Building MAKER >>> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >>> >>> The build status is >>> >>> ============================================================================= >>> STATUS MAKER v2.31.9 >>> ============================================================================== >>> PERL Dependencies: VERIFIED >>> External Programs: VERIFIED >>> External C Libraries: VERIFIED >>> MPI SUPPORT: DISABLED >>> MWAS Web Interface: DISABLED >>> MAKER PACKAGE: CONFIGURATION OK >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: >>> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. >>> >>> Thanks, >>> Daniel Ence >>> >>> >>>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: >>>> >>>> Hello all, >>>> >>>> I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. >>>> >>>> However trying to run maker it wouldn't run. >>>> >>>> Please how do I install maker to run on local computer? >>>> >>>> Thanks >>>> >>>> Nnadi Nnaemeka Emmanuel >>>> Department of Microbiology, >>>> Faculty of Natural and Applied Science, >>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>> >>>> >>>> _______________________________________________ >>>> maker-devel mailing list >>>> maker-devel at box290.bluehost.com >>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >> >> > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: From eennadi at gmail.com Mon Aug 28 11:32:40 2017 From: eennadi at gmail.com (Emmanuel Nnadi) Date: Mon, 28 Aug 2017 18:32:40 +0100 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: Thanks I tried to export PATH running echo $PATH in the maker directory this returned /usr/bin:/bin:/usr/sbin:/sbin:/opt/X11/bin:/Users/emmannaemeka/Desktop/Gpm/maker/bin/maker 1. Does it mean that PATH has been exported? secondly, I tried to run the command maker -h, which maker, maker -CTL nothing returned. 2. how do i start up maker? 3. Do I need to be in maker directory to start maker? Thanks Nnadi Nnaemeka Emmanuel Department of Microbiology, Faculty of Natural and Applied Science, Plateau State University, Bokkos, Plateau State, Nigeria. Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications On Mon, Aug 28, 2017 at 4:49 PM, Carson Holt wrote: > After install the executables will be in the ?/maker/bin directory. > Example (if you did the install in your home directory) ?> ~/maker/bin/maker > > You need to add the ?/maker/bin directory to your PATH for it to be found > just by typing ?maker' > > Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html > > ?Carson > > > On Aug 28, 2017, at 8:07 AM, Ence,daniel wrote: > > Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the > result of ?which maker?? > > > > On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi wrote: > > Hi Daniel > The reply is > emmannamekasMBP:maker emmannaemeka$ MAKER -ctl > -bash: MAKER: command not found > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/ > publications > > On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel wrote: > >> Hi, It looks like MAKER installed ok. What is the command that you used >> to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >> >> Thanks, >> Daniel Ence >> >> >> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi wrote: >> >> Hi Ence, >> Thanks for your reply, >> >> This is the step and error received >> >> emmannamekasMBP:src emmannaemeka$ ./build install >> Installing MAKER... >> Building MAKER >> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >> >> The build status is >> ============================================================================= >> STATUS MAKER v2.31.9============================================================================== >> PERL Dependencies: VERIFIED >> External Programs: VERIFIED >> External C Libraries: VERIFIED >> MPI SUPPORT: DISABLED >> MWAS Web Interface: DISABLED >> MAKER PACKAGE: CONFIGURATION OK >> >> >> Nnadi Nnaemeka Emmanuel >> Department of Microbiology, >> Faculty of Natural and Applied Science, >> Plateau State University, Bokkos, Plateau State, Nigeria. >> Publications: https://www.researchgate.net/ >> profile/Emmanuel_Nnadi/publications >> >> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel wrote: >> >>> Hi Emmanuel, In order for anyone to help you, you need post to the >>> mailing list the command and output (including errors) of the step that >>> didn?t work. >>> >>> Thanks, >>> Daniel Ence >>> >>> >>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi wrote: >>> >>> Hello all, >>> >>> I downloaded Maker and tried to install it. I succeeded in installing >>> all prerequisites however running maker ./build install, it showed that >>> maker installed. >>> >>> However trying to run maker it wouldn't run. >>> >>> Please how do I install maker to run on local computer? >>> >>> Thanks >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/ >>> profile/Emmanuel_Nnadi/publications >>> >>> >>> _______________________________________________ >>> maker-devel mailing list >>> maker-devel at box290.bluehost.com >>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>> >>> >>> >> >> > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Mon Aug 28 11:36:51 2017 From: carsonhh at gmail.com (Carson Holt) Date: Mon, 28 Aug 2017 11:36:51 -0600 Subject: [maker-devel] Maker not installing In-Reply-To: References: <8576F599-08C0-455A-B0D7-8A1110C6F18F@mail.ufl.edu> <113031DF-E733-4EEF-BDB7-405C15F0CA24@mail.ufl.edu> <546610AC-0B7B-4D02-BBF3-E847B95D7F0D@mail.ufl.edu> Message-ID: <8EAFE412-9EF7-4DB7-85A3-632BAC3372FD@gmail.com> Path needs to be a list of directories to search (you specified an executable location). So not this ?> /Users/emmannaemeka/Desktop/Gpm/maker/bin/maker Instead it needs to be this ?> /Users/emmannaemeka/Desktop/Gpm/maker/bin ?Carson > On Aug 28, 2017, at 11:32 AM, Emmanuel Nnadi > wrote: > > Thanks > > I tried to export PATH > > running > echo $PATH in the maker directory this returned > > /usr/bin:/bin:/usr/sbin:/sbin:/opt/X11/bin:/Users/emmannaemeka/Desktop/Gpm/maker/bin/maker > > 1. Does it mean that PATH has been exported? > > > secondly, > > I tried to run > the command maker -h, which maker, maker -CTL > > nothing returned. > > 2. how do i start up maker? > 3. Do I need to be in maker directory to start maker? > > Thanks > > > > > > Nnadi Nnaemeka Emmanuel > Department of Microbiology, > Faculty of Natural and Applied Science, > Plateau State University, Bokkos, Plateau State, Nigeria. > Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications > On Mon, Aug 28, 2017 at 4:49 PM, Carson Holt > wrote: > After install the executables will be in the ?/maker/bin directory. Example (if you did the install in your home directory) ?> ~/maker/bin/maker > > You need to add the ?/maker/bin directory to your PATH for it to be found just by typing ?maker' > > Explanation of the Linux PATH ?> http://www.linfo.org/path_env_var.html > > ?Carson > > >> On Aug 28, 2017, at 8:07 AM, Ence,daniel > wrote: >> >> Sorry I should have typed ?maker -CTL?. If that doesn?t work, what is the result of ?which maker?? >> >> >> >>> On Aug 28, 2017, at 10:00 AM, Emmanuel Nnadi > wrote: >>> >>> Hi Daniel >>> The reply is >>> emmannamekasMBP:maker emmannaemeka$ MAKER -ctl >>> -bash: MAKER: command not found >>> >>> Nnadi Nnaemeka Emmanuel >>> Department of Microbiology, >>> Faculty of Natural and Applied Science, >>> Plateau State University, Bokkos, Plateau State, Nigeria. >>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>> On Mon, Aug 28, 2017 at 2:57 PM, Ence,daniel > wrote: >>> Hi, It looks like MAKER installed ok. What is the command that you used to try to run MAKER? Can you show the result of running ?MAKER -ctl?? >>> >>> Thanks, >>> Daniel Ence >>> >>> >>>> On Aug 28, 2017, at 9:24 AM, Emmanuel Nnadi > wrote: >>>> >>>> Hi Ence, >>>> Thanks for your reply, >>>> >>>> This is the step and error received >>>> emmannamekasMBP:src emmannaemeka$ ./build install >>>> Installing MAKER... >>>> Building MAKER >>>> Skip /Users/emmannaemeka/desktop/Gpm/maker/src/../perl/config-darwin-thread-multi-2level-5.018002 (unchanged) >>>> >>>> The build status is >>>> >>>> ============================================================================= >>>> STATUS MAKER v2.31.9 >>>> ============================================================================== >>>> PERL Dependencies: VERIFIED >>>> External Programs: VERIFIED >>>> External C Libraries: VERIFIED >>>> MPI SUPPORT: DISABLED >>>> MWAS Web Interface: DISABLED >>>> MAKER PACKAGE: CONFIGURATION OK >>>> >>>> Nnadi Nnaemeka Emmanuel >>>> Department of Microbiology, >>>> Faculty of Natural and Applied Science, >>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>> On Mon, Aug 28, 2017 at 2:00 PM, Ence,daniel > wrote: >>>> Hi Emmanuel, In order for anyone to help you, you need post to the mailing list the command and output (including errors) of the step that didn?t work. >>>> >>>> Thanks, >>>> Daniel Ence >>>> >>>> >>>>> On Aug 27, 2017, at 10:16 AM, Emmanuel Nnadi > wrote: >>>>> >>>>> Hello all, >>>>> >>>>> I downloaded Maker and tried to install it. I succeeded in installing all prerequisites however running maker ./build install, it showed that maker installed. >>>>> >>>>> However trying to run maker it wouldn't run. >>>>> >>>>> Please how do I install maker to run on local computer? >>>>> >>>>> Thanks >>>>> >>>>> Nnadi Nnaemeka Emmanuel >>>>> Department of Microbiology, >>>>> Faculty of Natural and Applied Science, >>>>> Plateau State University, Bokkos, Plateau State, Nigeria. >>>>> Publications: https://www.researchgate.net/profile/Emmanuel_Nnadi/publications >>>>> >>>>> >>>>> _______________________________________________ >>>>> maker-devel mailing list >>>>> maker-devel at box290.bluehost.com >>>>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org >>>> >>>> >>> >>> >> >> _______________________________________________ >> maker-devel mailing list >> maker-devel at box290.bluehost.com >> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 30 08:01:02 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 30 Aug 2017 10:01:02 -0400 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: Dear Carson: Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? Thanks Best Quanwei 2017-08-23 14:10 GMT-04:00 Carson Holt : > > (1) For the predicted unknown (unclassified) repeat sequences (those in > Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were > searched against a transposase database (derived from RepeatMaske > r) and sequences matching transposase were > considered as transposons belonging to the relevant superfamily". > I wonder how to do this search. Annotate the "unknown" repeat sequences > using the Repeatmaker? Then what to do, if for an "unknown" repeat > sequence, only part of the sequence match the known repeat elements. > > > You can use RepBase match I guess, but I would not be overly worried about > classification. MAKER won?t use any classification info you give it. > > > (2) To exclude gene fragments, I need map the predicted repeat sequences > against a protein database, and then run the package "ProExcluder"*. * > Right? I wonder how to get such protein database. Since I am working on > a new rodent species, can I use all the rodent proteins from Uniprot (both > Swiss-Prot and TrEMBL)? > > > Try Swiss-Prot. That is a well curated cross species set. > > > (3) After I generate the species specific repeat library, do I still need > to select a model organism for RepBase masking (as shown below). > > In the file "maker_opts.ctl" > #-----Repeat Masking (leave values blank to skip repeat masking) > model_org=Mammalia #select a model organism for RepBase masking in > RepeatMasker > rmlib=myRepeat.fa #provide an organism specific repeat library in fasta > format for RepeatMasker > > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From qwzhang0601 at gmail.com Wed Aug 30 08:21:15 2017 From: qwzhang0601 at gmail.com (Quanwei Zhang) Date: Wed, 30 Aug 2017 10:21:15 -0400 Subject: [maker-devel] repeats masking In-Reply-To: <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> Message-ID: Dear Daniel: Thank you! I am running it on an unmasked genome. Just want to make sure it is the correct way. Have a nice day! Best Quanwei 2017-08-30 10:19 GMT-04:00 Daniel Ence : > Hi Quanwei, > > I think you should run it on an unmasked genome. I don?t think that > redundancy between repeat libraries will be an issue. > > Thanks, > Daniel > > > > On Aug 30, 2017, at 10:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the > species specific repeat library. I wonder whether I need to remove the > masked the regions by existing repeatMasker library, before I run > repeatModeler? I think there may be some redundancy if I run repeatModeler > directly on the genome and then use both existing repeatMasker library and > the repeatModeler library to mask the genome. Does it matter, if there is > such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt : > >> >> (1) For the predicted unknown (unclassified) repeat sequences (those in >> Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were >> searched against a transposase database (derived from RepeatMaske >> r) and sequences matching transposase were >> considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences >> using the Repeatmaker? Then what to do, if for an "unknown" repeat >> sequence, only part of the sequence match the known repeat elements. >> >> >> You can use RepBase match I guess, but I would not be overly worried >> about classification. MAKER won?t use any classification info you give it. >> >> >> (2) To exclude gene fragments, I need map the predicted repeat sequences >> against a protein database, and then run the package "ProExcluder"*. * >> Right? I wonder how to get such protein database. Since I am working on >> a new rodent species, can I use all the rodent proteins from Uniprot (both >> Swiss-Prot and TrEMBL)? >> >> >> Try Swiss-Prot. That is a well curated cross species set. >> >> >> (3) After I generate the species specific repeat library, do I still need >> to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in >> RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta >> format for RepeatMasker >> >> >> Yes. Supply both. >> >> >> ?Carson >> > > > -------------- next part -------------- An HTML attachment was scrubbed... URL: From lcampbell at ebi.ac.uk Wed Aug 30 03:41:48 2017 From: lcampbell at ebi.ac.uk (Lahcen Campbell) Date: Wed, 30 Aug 2017 10:41:48 +0100 Subject: [maker-devel] Processing contig output - MPI job fail Message-ID: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> Hello folks, Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) /............/ /clustering transcripts into genes for annotations// //Processing transcripts into genes// //adding statistics to annotations// //Calculating annotation quality statistics// //choosing best annotation set// //Choosing best annotations// //processing chunk output// //processing contig output/ However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. *_The following error output was captured_*/*_:_* / Calculating annotation quality statistics choosing best annotation set Choosing best annotations processing chunk output processing contig output [proxy:0:0 at loom7.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:0 at loom7.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:0 at loom7.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:4 at loom6.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [mpiexec at loom7.ebi.ac.uk] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting [mpiexec at loom7.ebi.ac.uk] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. Any hints or insight on this would be greatly appreciated. Thank you in advance, Lahcen EBI-Hinxton, UK. -------------- next part -------------- An HTML attachment was scrubbed... URL: From lahcencampbell at gmail.com Wed Aug 30 03:44:03 2017 From: lahcencampbell at gmail.com (lahcen campbell) Date: Wed, 30 Aug 2017 10:44:03 +0100 Subject: [maker-devel] Processing contig output - MPI job fail Message-ID: *REPOSTED UNDER CORRECTED SUBSCRIBED MEMBER EMAIL ACCOUNT.* Hello folks, Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) *............* *clustering transcripts into genes for annotations* *Processing transcripts into genes* *adding statistics to annotations* *Calculating annotation quality statistics* *choosing best annotation set* *Choosing best annotations* *processing chunk output* *processing contig output* However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. *The following error output was captured* *: * Calculating annotation quality statistics choosing best annotation set Choosing best annotations processing chunk output processing contig output [proxy:0:0 at loom7.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:0 at loom7.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:0 at loom7.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed [proxy:0:4 at loom6.ebi.ac.uk] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:4 at loom6.ebi.ac.uk] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event [mpiexec at loom7.ebi.ac.uk] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting [mpiexec at loom7.ebi.ac.uk] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion [mpiexec at loom7.ebi.ac.uk] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. Any hints or insight on this would be greatly appreciated. Thank you in advance, Lahcen EBI-Hinxton, UK. -- ========================================== > Dr. Lahcen Campbell < > Contact: lahcencampbell at gmail.com < > https://www.ebi.ac.uk/about/people/lahcen-campbell < ========================================== -------------- next part -------------- An HTML attachment was scrubbed... URL: From dandence at gmail.com Wed Aug 30 08:19:13 2017 From: dandence at gmail.com (Daniel Ence) Date: Wed, 30 Aug 2017 10:19:13 -0400 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: <36E5327A-02C0-4E78-9B79-B2B815393BB8@gmail.com> Hi Quanwei, I think you should run it on an unmasked genome. I don?t think that redundancy between repeat libraries will be an issue. Thanks, Daniel > On Aug 30, 2017, at 10:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt >: > >> (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. > > You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > > >> (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? > > Try Swiss-Prot. That is a well curated cross species set. > > >> (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 30 08:53:48 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 30 Aug 2017 08:53:48 -0600 Subject: [maker-devel] repeats masking In-Reply-To: References: <6FCA8DEC-EA5E-489F-A83C-2BA792E1F77D@gmail.com> <256BF853-3B43-4975-9D5D-9D4F30A27AC3@gmail.com> <0E3DD0D8-0147-4BC0-B06D-6B3754F85D7B@gmail.com> Message-ID: You don?t need to worry about redundancy. ?Carson > On Aug 30, 2017, at 8:01 AM, Quanwei Zhang wrote: > > Dear Carson: > > Thank you again for all you valuable suggestions. Now I am generating the species specific repeat library. I wonder whether I need to remove the masked the regions by existing repeatMasker library, before I run repeatModeler? I think there may be some redundancy if I run repeatModeler directly on the genome and then use both existing repeatMasker library and the repeatModeler library to mask the genome. Does it matter, if there is such redundancy? > > Thanks > > Best > Quanwei > > 2017-08-23 14:10 GMT-04:00 Carson Holt >: > >> (1) For the predicted unknown (unclassified) repeat sequences (those in Modelerunknown.lib), it mentioned "Sequences in Modelerunknown.lib were searched against a transposase database (derived from RepeatMaske r) and sequences matching transposase were considered as transposons belonging to the relevant superfamily". >> I wonder how to do this search. Annotate the "unknown" repeat sequences using the Repeatmaker? Then what to do, if for an "unknown" repeat sequence, only part of the sequence match the known repeat elements. > > You can use RepBase match I guess, but I would not be overly worried about classification. MAKER won?t use any classification info you give it. > > >> (2) To exclude gene fragments, I need map the predicted repeat sequences against a protein database, and then run the package "ProExcluder". Right? I wonder how to get such protein database. Since I am working on a new rodent species, can I use all the rodent proteins from Uniprot (both Swiss-Prot and TrEMBL)? > > Try Swiss-Prot. That is a well curated cross species set. > > >> (3) After I generate the species specific repeat library, do I still need to select a model organism for RepBase masking (as shown below). >> >> In the file "maker_opts.ctl" >> #-----Repeat Masking (leave values blank to skip repeat masking) >> model_org=Mammalia #select a model organism for RepBase masking in RepeatMasker >> rmlib=myRepeat.fa #provide an organism specific repeat library in fasta format for RepeatMasker > > Yes. Supply both. > > > ?Carson > -------------- next part -------------- An HTML attachment was scrubbed... URL: From carsonhh at gmail.com Wed Aug 30 08:55:02 2017 From: carsonhh at gmail.com (Carson Holt) Date: Wed, 30 Aug 2017 08:55:02 -0600 Subject: [maker-devel] Processing contig output - MPI job fail In-Reply-To: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> References: <908ac38d-7bd2-4d29-ec8e-c075242f76aa@ebi.ac.uk> Message-ID: MAKER will start up where it left off as long as the settings are identical between runs. ?Carson > On Aug 30, 2017, at 3:41 AM, Lahcen Campbell wrote: > > Hello folks, > Can anyone inform me on the ability of MAKER to restart from a checkpoint following annotation processing has compelted. > I had an MPI MAKER job running successfully for 6 weeks for a de novo fly genome I am working on. It was running with mpich3-3.1-icc on LSF batch system using 96 cpu's and 140Gb RAM. MAKER had processed 91% of the overall assembly length of my genome under MAKER_Finished contigs. Numbers of "Finished" contigs hadn't changed for ~10 days when it died, as I assume MAKER was collecting annotated gene stats, collecting contig statistics and clustering of transcripts into fasta files etc: (As follows) > ............ > > clustering transcripts into genes for annotations > Processing transcripts into genes > adding statistics to annotations > Calculating annotation quality statistics > choosing best annotation set > Choosing best annotations > processing chunk output > processing contig output > > However, this job exited after processing 26,767 of the 42,207 "MAKER Finished" contigs. The job died with a 255 exit code, which I suspect means somoene in our systems team may have killed the job to maintain system stability or someting. > The following error output was captured: > > Calculating annotation quality statistics > choosing best annotation set > Choosing best annotations > processing chunk output > processing contig output > > [proxy:0:0 at loom7.ebi.ac.uk ] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:0 at loom7.ebi.ac.uk ] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:0 at loom7.ebi.ac.uk ] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:1 at loom15] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:5 at loom14] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:5 at loom14] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:4 at loom6.ebi.ac.uk ] HYD_pmcd_pmip_control_cmd_cb (./pm/pmiserv/pmip_cb.c:886): assert (!closed) failed > [proxy:0:4 at loom6.ebi.ac.uk ] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:4 at loom6.ebi.ac.uk ] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:5 at loom14] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [proxy:0:1 at loom15] HYDT_dmxu_poll_wait_for_event (./tools/demux/demux_poll.c:77): callback returned error status > [proxy:0:1 at loom15] main (./pm/pmiserv/pmip.c:206): demux engine error waiting for event > [mpiexec at loom7.ebi.ac.uk ] HYDT_bscu_wait_for_completion (./tools/bootstrap/utils/bscu_wait.c:76): one of the processes terminated badly; aborting > [mpiexec at loom7.ebi.ac.uk ] HYDT_bsci_wait_for_completion (./tools/bootstrap/src/bsci_wait.c:23): launcher returned error waiting for completion > [mpiexec at loom7.ebi.ac.uk ] HYD_pmci_wait_for_completion (./pm/pmiserv/pmiserv_pmci.c:217): launcher returned error waiting for completion > [mpiexec at loom7.ebi.ac.uk ] main (./ui/mpich/mpiexec.c:331): process manager error waiting for completion > > Unfortunately since this process died, I have been unable to get the job reschduled again on our system due to resource limitations and job queing. But can anyone tell me, will MAKER be able to finish processing contig stats and information to completion, following this early exit ? I really can't afford another 6 weeks of computation so Im worried as you might expect. Would you recommend I submit this MAKER job again to finalize contig information/produce fasta files etc with the same amount of resources, or might I be able to request less resources without too much of a penalty in terms of compute time. > > Any hints or insight on this would be greatly appreciated. > > Thank you in advance, > > Lahcen > > EBI-Hinxton, UK. > > > _______________________________________________ > maker-devel mailing list > maker-devel at box290.bluehost.com > http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org -------------- next part -------------- An HTML attachment was scrubbed... URL: