[maker-devel] maker_gff parameter - problem when gff contains fasta sequences

[Jacques Dainat]

Dear Carson,

I’m using  maker/3.01.02 with open MPI.
I realised that the option maker_gff from the maker_opts.ctl works great as long as no FASTA sequence is embeded in the GFF3 file.
e.g: 
```
###
##FASTA
>3098|quiver
TTTATGGGTTCAGGCGGACCCATGGCGCCGACCATATTTTGAGAGCTGGACGACTCTGTA
GGGTTGGGTATTGGCTGATTATTCATTCAAATCCCACGAGTAGCCTAGGAAGTGACGGTC
```
I ended up with GFF3 files containing fasta sequences in a sequential manner (All contig1 features then the sequence of contig1, all contig2 features then the sequence of contig2, etc… I precise this because we can meet gff3 files where all the sequences are gather at the end of the file). In such case MAKER takes in consideration only the features met before to reach the first FASTA sequence in the file. Then it stops to process the file and doesn’t consider the rest of it.

I haven’t seen any particular message but my resulting annotation was obviously wrong. Indeed most of the data repeat/alignment/models contained in the gff file haven’t been passed to MAKER. Would it be possible to add a fix to continue to parse a gff file even after meeting a fasta sequence?


Best regards,

/Jacques
-------------------------------------------------
Jacques Dainat, Ph.D.
NBIS (National Bioinformatics Infrastructure Sweden)
Genome Annotation Service
http://nbis.se/about/staff/jacques-dainat <http://nbis.se/about/staff/jacques-dainat>
https://github.com/NBISweden/GAAS <https://github.com/NBISweden/GAAS>
http://nbis.se <http://nbis.se/>

—	Contact	— 
Address: Uppsala University, Biomedicinska Centrum
Department of Medical Biochemistry Microbiology, Genomics
Husargatan 3, box 582
S-75123 Uppsala Sweden
Phone: +46 18 471 46 25

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20190820/e0247a0d/attachment-0002.html>