[maker-devel] maker_gff parameter - problem when gff contains fasta sequences
Jacques Dainat
jacques.dainat at nbis.se
Tue Aug 20 07:28:46 MDT 2019
Thank you for your quick answer, you are right I should have read the gff3 specification more carefully.
I will investigate which step I modified that introduced the problem.
Thank again.
/Jacques
> On 20 Aug 2019, at 15:16, Carson Holt <carsonhh at gmail.com> wrote:
>
> All fasta entries must occur at the end of the file according to gff3 specification. If a fasta entry is embedded in the middle, you have a corrupt file. If you are trying to merge gff3, files you can use the gff3_merge script. Concatenation via something like “cat” however results in a broken file.
>
> —Carson
>
> Sent from my iPhone
>
> On Aug 20, 2019, at 2:14 AM, Jacques Dainat <jacques.dainat at nbis.se <mailto:jacques.dainat at nbis.se>> wrote:
>
>> Dear Carson,
>>
>> I’m using maker/3.01.02 with open MPI.
>> I realised that the option maker_gff from the maker_opts.ctl works great as long as no FASTA sequence is embeded in the GFF3 file.
>> e.g:
>> ```
>> ###
>> ##FASTA
>> >3098|quiver
>> TTTATGGGTTCAGGCGGACCCATGGCGCCGACCATATTTTGAGAGCTGGACGACTCTGTA
>> GGGTTGGGTATTGGCTGATTATTCATTCAAATCCCACGAGTAGCCTAGGAAGTGACGGTC
>> ```
>> I ended up with GFF3 files containing fasta sequences in a sequential manner (All contig1 features then the sequence of contig1, all contig2 features then the sequence of contig2, etc… I precise this because we can meet gff3 files where all the sequences are gather at the end of the file). In such case MAKER takes in consideration only the features met before to reach the first FASTA sequence in the file. Then it stops to process the file and doesn’t consider the rest of it.
>>
>> I haven’t seen any particular message but my resulting annotation was obviously wrong. Indeed most of the data repeat/alignment/models contained in the gff file haven’t been passed to MAKER. Would it be possible to add a fix to continue to parse a gff file even after meeting a fasta sequence?
>>
>>
>> Best regards,
>>
>> /Jacques
>> -------------------------------------------------
>> Jacques Dainat, Ph.D.
>> NBIS (National Bioinformatics Infrastructure Sweden)
>> Genome Annotation Service
>> http://nbis.se/about/staff/jacques-dainat <http://nbis.se/about/staff/jacques-dainat>
>> https://github.com/NBISweden/GAAS <https://github.com/NBISweden/GAAS>
>> http://nbis.se <http://nbis.se/>
>>
>> — Contact —
>> Address: Uppsala University, Biomedicinska Centrum
>> Department of Medical Biochemistry Microbiology, Genomics
>> Husargatan 3, box 582
>> S-75123 Uppsala Sweden
>> Phone: +46 18 471 46 25
>>
>> _______________________________________________
>> maker-devel mailing list
>> maker-devel at box290.bluehost.com <mailto:maker-devel at box290.bluehost.com>
>> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org <http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20190820/621b8ba5/attachment-0003.html>
More information about the maker-devel
mailing list