From samuel.decker at student.montana.edu Tue Jan 31 12:28:09 2023 From: samuel.decker at student.montana.edu (Decker, Samuel) Date: Tue, 31 Jan 2023 19:28:09 +0000 Subject: [maker-devel] Maker error after calling SNAP Message-ID: Hi, I am trying to run maker on Camelina Sativa, and it runs smoothly for the most part until it reaches a certain stage in SNAP. Maker passes a short sequence to SNAP to predict genes on, but that sequence is more than half N's, and SNAP fails, leading to maker calling that chunk as a failure and ending the run. When looking at the Widget call, it seems that for some reason the .hmm file is not included in the command sent to SNAP. I manually ran the command with the .hmm file included and it seems to execute, though no output file is produced. After speaking with Ian Korf, he seemed to think it was an error relating to the very short and ambiguous (many N's) fasta file that maker passed to SNAP. So two questions: Why did the .hmm file not get passed to SNAP as part of the command, and why did maker send such a short chunk to SNAP for gene prediction? I've attached a text file with the command and the error log, the fasta that maker is sending to SNAP, and the xdef file as well. Thank you for your help, Samuel Decker PhD Student Montana State University Plant Sciences/Plant Pathology -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- #--------- command -------------# Widget::snap: /usr/bin/snap -plus -xdef /home/nostril/maker_stuff/results.maker.output/results_datastore/07/64/CHR_4//theVoid.CHR_4/172_0.18616337-18617933.CS.hmm.auto_annotator.xdef.snap /home/nostril/maker_stuff/results.maker.output/results_datastore/07/64/CHR_4//theVoid.CHR_4/172_0.18616337-18617933.CS.hmm.auto_annotator.snap.fasta > /home/nostril/maker_stuff/results.maker.output/results_datastore/07/64/CHR_4//theVoid.CHR_4/172_0.18616337-18617933.CS.hmm.auto_annotator.snap #-------------------------------# SNAP - Semi-HMM-based Nucleic Acid Parser (version 2006-07-28) usage: snap [options] [options] options: -help report useful information -lcmask treat lowercase as N -plus predict on plus strand only -minus predict on minus strand only -gff output annotation as GFF -ace output annotation as ACED -quiet do not send progress to STDERR -aa create FASTA file of proteins -tx create FASTA file of transcripts -xdef external definitions -name name for the gene [default snap] ERROR: Snap failed --> rank=NA, hostname=DESKTOP-AD6C0QF --> rank=NA, hostname=DESKTOP-AD6C0QF ERROR: Failed while annotating transcripts ERROR: Chunk failed at level:1, tier_type:4 FAILED CONTIG:CHR_4 deleted:0 genes ERROR: Chunk failed at level:6, tier_type:0 FAILED CONTIG:CHR_4 >CHR_4 172_0 offset:18616337 AATCTGTGATTTGCAGAAAACCCTTAAAAATATTTGTAATTTGCATAATCCTTATAAAAT CCTACCAATTGATGTTTAATGGTTTTTTCCCCACCCACAAACCCAACACAAACCCAATCG GATCTCTCTCGGATCTATTTACCCCCACTATTTCTTTTAATTTCAAACAATGGTTTTCTC TCTCTCTTCTTGAAAAACTAGGGATTACTAATCGAGAGATCATTTGCTCTCTTTGATTGT TGTGTTGTTCGATCGATTGTGGAGACTCATCGATTGTTAGCAGTTagatgaatatgagga agaacaataagaagagaaaaattgccgaggaagaacaagaTTCGGAACCGGGGGAGAGTT CACAGCCGGCGGATCTCCCTGCGGCTGGTGATGGAGATGGTGAGGATGAAGTCGAAAGGA GTGATAAAGAGGATGAGGGAGTCGACTCAGAGACTTCGGGAGATGATGAGAAGGGAGACG AGGAGGATGTCGGAAGTGACGAAGGAGAAGAAGAGAGCGAGCCAGATCTCGTTGGCGAAG GAGAAGTAGATTTGGACGCATCCTTGGGAGAGACAGATTCGGGCGACTCCACCGAGGCAA TGGTACGTAGTACCGATTGATTGACCATGTAGAAGTAGGGAAAACATATTTTTTTCTGGG TTTGTAATACTAGGATAACATAGTATAACTGTTTNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN >xdef file offset: 18616337 i_flank:2 Coding 294 602 + 0.2 . . . ADJ Coding 803 836 + 0.2 . . . ADJ Intron 604 801 + 1000 . . . ADJ Coding 604 801 + -100 . . . ADJ From samuel.decker at student.montana.edu Tue Jan 31 12:28:09 2023 From: samuel.decker at student.montana.edu (Decker, Samuel) Date: Tue, 31 Jan 2023 19:28:09 +0000 Subject: [maker-devel] Maker error after calling SNAP Message-ID: Hi, I am trying to run maker on Camelina Sativa, and it runs smoothly for the most part until it reaches a certain stage in SNAP. Maker passes a short sequence to SNAP to predict genes on, but that sequence is more than half N's, and SNAP fails, leading to maker calling that chunk as a failure and ending the run. When looking at the Widget call, it seems that for some reason the .hmm file is not included in the command sent to SNAP. I manually ran the command with the .hmm file included and it seems to execute, though no output file is produced. After speaking with Ian Korf, he seemed to think it was an error relating to the very short and ambiguous (many N's) fasta file that maker passed to SNAP. So two questions: Why did the .hmm file not get passed to SNAP as part of the command, and why did maker send such a short chunk to SNAP for gene prediction? I've attached a text file with the command and the error log, the fasta that maker is sending to SNAP, and the xdef file as well. Thank you for your help, Samuel Decker PhD Student Montana State University Plant Sciences/Plant Pathology -------------- next part -------------- An HTML attachment was scrubbed... URL: -------------- next part -------------- #--------- command -------------# Widget::snap: /usr/bin/snap -plus -xdef /home/nostril/maker_stuff/results.maker.output/results_datastore/07/64/CHR_4//theVoid.CHR_4/172_0.18616337-18617933.CS.hmm.auto_annotator.xdef.snap /home/nostril/maker_stuff/results.maker.output/results_datastore/07/64/CHR_4//theVoid.CHR_4/172_0.18616337-18617933.CS.hmm.auto_annotator.snap.fasta > /home/nostril/maker_stuff/results.maker.output/results_datastore/07/64/CHR_4//theVoid.CHR_4/172_0.18616337-18617933.CS.hmm.auto_annotator.snap #-------------------------------# SNAP - Semi-HMM-based Nucleic Acid Parser (version 2006-07-28) usage: snap [options] [options] options: -help report useful information -lcmask treat lowercase as N -plus predict on plus strand only -minus predict on minus strand only -gff output annotation as GFF -ace output annotation as ACED -quiet do not send progress to STDERR -aa create FASTA file of proteins -tx create FASTA file of transcripts -xdef external definitions -name name for the gene [default snap] ERROR: Snap failed --> rank=NA, hostname=DESKTOP-AD6C0QF --> rank=NA, hostname=DESKTOP-AD6C0QF ERROR: Failed while annotating transcripts ERROR: Chunk failed at level:1, tier_type:4 FAILED CONTIG:CHR_4 deleted:0 genes ERROR: Chunk failed at level:6, tier_type:0 FAILED CONTIG:CHR_4 >CHR_4 172_0 offset:18616337 AATCTGTGATTTGCAGAAAACCCTTAAAAATATTTGTAATTTGCATAATCCTTATAAAAT CCTACCAATTGATGTTTAATGGTTTTTTCCCCACCCACAAACCCAACACAAACCCAATCG GATCTCTCTCGGATCTATTTACCCCCACTATTTCTTTTAATTTCAAACAATGGTTTTCTC TCTCTCTTCTTGAAAAACTAGGGATTACTAATCGAGAGATCATTTGCTCTCTTTGATTGT TGTGTTGTTCGATCGATTGTGGAGACTCATCGATTGTTAGCAGTTagatgaatatgagga agaacaataagaagagaaaaattgccgaggaagaacaagaTTCGGAACCGGGGGAGAGTT CACAGCCGGCGGATCTCCCTGCGGCTGGTGATGGAGATGGTGAGGATGAAGTCGAAAGGA GTGATAAAGAGGATGAGGGAGTCGACTCAGAGACTTCGGGAGATGATGAGAAGGGAGACG AGGAGGATGTCGGAAGTGACGAAGGAGAAGAAGAGAGCGAGCCAGATCTCGTTGGCGAAG GAGAAGTAGATTTGGACGCATCCTTGGGAGAGACAGATTCGGGCGACTCCACCGAGGCAA TGGTACGTAGTACCGATTGATTGACCATGTAGAAGTAGGGAAAACATATTTTTTTCTGGG TTTGTAATACTAGGATAACATAGTATAACTGTTTNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN >xdef file offset: 18616337 i_flank:2 Coding 294 602 + 0.2 . . . ADJ Coding 803 836 + 0.2 . . . ADJ Intron 604 801 + 1000 . . . ADJ Coding 604 801 + -100 . . . ADJ