[maker-devel] non-nucleotide characters in the maker generated transcripts

[Carson Holt]

Just resending this to the correct maker-devel address.  Please when
replying, do not CC the incorrect maker-devel-bounce address.

Thanks,
Carson


On 3/13/14, 9:56 AM, "Carson Holt" <carson.holt at genetics.utah.edu> wrote:

>FGENESH is not a heavily used tool, so depending on which version it is
>(either too old or too new), output might be slightly different which
>could cause incorrect parsing. Could you tar up your maker.output folder,
>and send it to http://weatherby.genetics.utah.edu/cgi-bin/mwas/bug.cgi
>(send me either your user/guest ID after you upload).
>
>For the BLAST error, use BLAST+ instead.  You are using blastall which is
>the old legacy version of NCBI BLAST.  You can do this by setting the
>blast type in maker_bopts.ctl and the location of executables in
>maker_exe.ctl.
>
>Thanks,
>Carson
>
>
>
>On 3/12/14, 11:58 AM, "Borhan, Hossein" <Hossein.Borhan at AGR.GC.CA> wrote:
>
>>Dear Maker users
>>
>>
>>I ran maker (2.31) on a fungal genome and found out that it inserted the
>>word SCLAR   followed by a pair of bracket like this (0x22de7020)
>>inserted in the nucleotide sequence of some of the genes. This seems to
>>be related to transcripts predicted by fgenesh_masked.
>>
>>
>>Here is an example for one of the genes
>>
>>
>>>fgenesh_masked-scaffold00087-processed-gene-3.142-mRNA-1 transcript
>>>offset:0 AE
>>D:0.01 eAED:0.00 QI:0|1|0.85|1|0.5|0.42|7|144|651
>>ATGCGTTACTCCCAGATCTTTGGCAGTGCTGCTGCGCTTGTTGGCTCTGSCALAR(0x23
>>418b90)SCALAR(0x244c8ca0)GCTTTGGGGCGTGGAGAACAGTGGTGACGACTTCA
>>AGCGCAACGGCAAAGACATTCACATGAACAACCCCGGCGAGAAAATCCATTACATGGGCG
>>ATGTCACCAAGCCAAATGACAACTGGTATGGATATCCTACCTGCTTCACTGTCTGGCAAC
>>CCAGTGACTTCACCGACAAAACCTTCAAGGTCGGCGACTGGTTCGTGCAAGCACCCACTT
>>CTTCCTTTGGCGACGAAACATGCAGTCAGCGGGCCACCGCACCCAAGCTCACCCTGTTTC
>>CTCACTCTGCACCCATTGATTGCAAGTTCGATGCCGAGAGTACGACCATGTACATTACCT
>>ATCATGGTAGCTGGAACCGCTCGCCCGTCACGGGCTTCAAGCTCGTCGCTGTGCAGTTTA
>>AGCTTGGCGCTGATGGCCAGTATACGCCTGTCGAGCCGCTTACCAGCACAACCGCGGCCA
>>AGGATATCTTTTACAATCCGAGGGTGGAGAGCTGTCAGGGTAATGGCCCGGGATTCAGCT
>>CGGGTTGCTTCAGACCTGCAGGCTTGGCATGGGATCCCCAGGGTCGGTTGATCATGACGT
>>CGGATACATCGAGCAATGGTGAGCTGTGGATCTTGGGTACATCTTGAATGACATGTCAGC
>>AAGGCAGAAGGTAAGTAGTGGATGCCGTTGGAGGAAGTTTGTAAATACAGTGATGCAATG
>>CCACGGTCGTTCTCTTTTTGCGGTGCTGGCCAGGATAACAAGGTCAATTGACTTTGGATG
>>TTTCGACAAGC
>>
>>The same genome sequence was used for the first round of maker (2.10)
>>without such problem. I checked the sequence for the scaffold related to
>>one of the affected transcripts and there was no error in the sequence.
>>I am not sure what is causing this. The only error that I could spot in
>>the output error file is the following
>>
>>
>>[blastall] FATAL ERROR:  search cannot proceed due to errors in all
>>contexts/frames of query sequences.
>>
>>
>>
>>Your help is appreciated
>>
>>
>>
>>HB
>>
>>
>>
>>
>>
>>
>