[maker-devel] non-nucleotide characters in the maker generated transcripts

[Carson Holt]

I have attached 4 files for you to place in the .../maker/Widgets/
directory.

The *blast.pm files will suppress the BLAST+ failures you are getting
(alternatively you can just downgrade to BLAST 2.27 to get the same
effect).  BLAST 2.29 gives a lot of warnings etc., which you can ignore.
In the latest release NCBI redid all their warnings and error codes so it
spits out a lot of garbage and fails with different messages than it did
before.  For example BLAST now warns you every time it encounter a fasta
header with a comment (virtually every fasta entry in existence falls in
this category), so your screen will be awash with meaningless warning
messages.

The fgenesh.pm file will fix the other failure, which only occurs if you
use fgenesh simultaneously with the est_fustion=1 option.  No other
predictors are affected.

Thanks,
Carson


On 3/14/14, 5:14 PM, "Borhan, Hossein" <Hossein.Borhan at AGR.GC.CA> wrote:

>Dear  Carson
>
>Sorry for the late reply. I was away for a couple of days. I have uploaded
>the out put files plus control and error output on the FTP site that you
>provided
>The user ID is borhanh
>
>I used blast+ for this run.
>
>
>
>
>Regards
>
>
>HB
>
>
>
>
>
>
>
>
>On 14-03-13 10:00 AM, "Carson Holt" <carson.holt at genetics.utah.edu> wrote:
>
>>Just resending this to the correct maker-devel address.  Please when
>>replying, do not CC the incorrect maker-devel-bounce address.
>>
>>Thanks,
>>Carson
>>
>>
>>On 3/13/14, 9:56 AM, "Carson Holt" <carson.holt at genetics.utah.edu> wrote:
>>
>>>FGENESH is not a heavily used tool, so depending on which version it is
>>>(either too old or too new), output might be slightly different which
>>>could cause incorrect parsing. Could you tar up your maker.output
>>>folder,
>>>and send it to http://weatherby.genetics.utah.edu/cgi-bin/mwas/bug.cgi
>>>(send me either your user/guest ID after you upload).
>>>
>>>For the BLAST error, use BLAST+ instead.  You are using blastall which
>>>is
>>>the old legacy version of NCBI BLAST.  You can do this by setting the
>>>blast type in maker_bopts.ctl and the location of executables in
>>>maker_exe.ctl.
>>>
>>>Thanks,
>>>Carson
>>>
>>>
>>>
>>>On 3/12/14, 11:58 AM, "Borhan, Hossein" <Hossein.Borhan at AGR.GC.CA>
>>>wrote:
>>>
>>>>Dear Maker users
>>>>
>>>>
>>>>I ran maker (2.31) on a fungal genome and found out that it inserted
>>>>the
>>>>word SCLAR   followed by a pair of bracket like this (0x22de7020)
>>>>inserted in the nucleotide sequence of some of the genes. This seems to
>>>>be related to transcripts predicted by fgenesh_masked.
>>>>
>>>>
>>>>Here is an example for one of the genes
>>>>
>>>>
>>>>>fgenesh_masked-scaffold00087-processed-gene-3.142-mRNA-1 transcript
>>>>>offset:0 AE
>>>>D:0.01 eAED:0.00 QI:0|1|0.85|1|0.5|0.42|7|144|651
>>>>ATGCGTTACTCCCAGATCTTTGGCAGTGCTGCTGCGCTTGTTGGCTCTGSCALAR(0x23
>>>>418b90)SCALAR(0x244c8ca0)GCTTTGGGGCGTGGAGAACAGTGGTGACGACTTCA
>>>>AGCGCAACGGCAAAGACATTCACATGAACAACCCCGGCGAGAAAATCCATTACATGGGCG
>>>>ATGTCACCAAGCCAAATGACAACTGGTATGGATATCCTACCTGCTTCACTGTCTGGCAAC
>>>>CCAGTGACTTCACCGACAAAACCTTCAAGGTCGGCGACTGGTTCGTGCAAGCACCCACTT
>>>>CTTCCTTTGGCGACGAAACATGCAGTCAGCGGGCCACCGCACCCAAGCTCACCCTGTTTC
>>>>CTCACTCTGCACCCATTGATTGCAAGTTCGATGCCGAGAGTACGACCATGTACATTACCT
>>>>ATCATGGTAGCTGGAACCGCTCGCCCGTCACGGGCTTCAAGCTCGTCGCTGTGCAGTTTA
>>>>AGCTTGGCGCTGATGGCCAGTATACGCCTGTCGAGCCGCTTACCAGCACAACCGCGGCCA
>>>>AGGATATCTTTTACAATCCGAGGGTGGAGAGCTGTCAGGGTAATGGCCCGGGATTCAGCT
>>>>CGGGTTGCTTCAGACCTGCAGGCTTGGCATGGGATCCCCAGGGTCGGTTGATCATGACGT
>>>>CGGATACATCGAGCAATGGTGAGCTGTGGATCTTGGGTACATCTTGAATGACATGTCAGC
>>>>AAGGCAGAAGGTAAGTAGTGGATGCCGTTGGAGGAAGTTTGTAAATACAGTGATGCAATG
>>>>CCACGGTCGTTCTCTTTTTGCGGTGCTGGCCAGGATAACAAGGTCAATTGACTTTGGATG
>>>>TTTCGACAAGC
>>>>
>>>>The same genome sequence was used for the first round of maker (2.10)
>>>>without such problem. I checked the sequence for the scaffold related
>>>>to
>>>>one of the affected transcripts and there was no error in the sequence.
>>>>I am not sure what is causing this. The only error that I could spot in
>>>>the output error file is the following
>>>>
>>>>
>>>>[blastall] FATAL ERROR:  search cannot proceed due to errors in all
>>>>contexts/frames of query sequences.
>>>>
>>>>
>>>>
>>>>Your help is appreciated
>>>>
>>>>
>>>>
>>>>HB
>>>>
>>>>
>>>>
>>>>
>>>>
>>>>
>>>
>>
>

-------------- next part --------------
A non-text attachment was scrubbed...
Name: blastn.pm
Type: text/x-perl-script
Size: 8112 bytes
Desc: blastn.pm
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20140317/e73c4b0f/attachment-0012.bin>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: blastx.pm
Type: text/x-perl-script
Size: 8218 bytes
Desc: blastx.pm
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20140317/e73c4b0f/attachment-0013.bin>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: fgenesh.pm
Type: text/x-perl-script
Size: 19744 bytes
Desc: fgenesh.pm
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20140317/e73c4b0f/attachment-0014.bin>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: tblastx.pm
Type: text/x-perl-script
Size: 9113 bytes
Desc: tblastx.pm
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20140317/e73c4b0f/attachment-0015.bin>