[maker-devel] non-nucleotide characters in the maker generated transcripts

[Borhan, Hossein]

Dear Carson

I ran maker and modified .pm files and it resolved the problem with the
fasta output. Thanks a lot for your help.




HB








On 14-03-17 1:45 PM, "Carson Holt" <carson.holt at genetics.utah.edu> wrote:

>I have attached 4 files for you to place in the .../maker/Widgets/
>directory.
>
>The *blast.pm files will suppress the BLAST+ failures you are getting
>(alternatively you can just downgrade to BLAST 2.27 to get the same
>effect).  BLAST 2.29 gives a lot of warnings etc., which you can ignore.
>In the latest release NCBI redid all their warnings and error codes so it
>spits out a lot of garbage and fails with different messages than it did
>before.  For example BLAST now warns you every time it encounter a fasta
>header with a comment (virtually every fasta entry in existence falls in
>this category), so your screen will be awash with meaningless warning
>messages.
>
>The fgenesh.pm file will fix the other failure, which only occurs if you
>use fgenesh simultaneously with the est_fustion=1 option.  No other
>predictors are affected.
>
>Thanks,
>Carson
>
>
>On 3/14/14, 5:14 PM, "Borhan, Hossein" <Hossein.Borhan at AGR.GC.CA> wrote:
>
>>Dear  Carson
>>
>>Sorry for the late reply. I was away for a couple of days. I have
>>uploaded
>>the out put files plus control and error output on the FTP site that you
>>provided
>>The user ID is borhanh
>>
>>I used blast+ for this run.
>>
>>
>>
>>
>>Regards
>>
>>
>>HB
>>
>>
>>
>>
>>
>>
>>
>>
>>On 14-03-13 10:00 AM, "Carson Holt" <carson.holt at genetics.utah.edu>
>>wrote:
>>
>>>Just resending this to the correct maker-devel address.  Please when
>>>replying, do not CC the incorrect maker-devel-bounce address.
>>>
>>>Thanks,
>>>Carson
>>>
>>>
>>>On 3/13/14, 9:56 AM, "Carson Holt" <carson.holt at genetics.utah.edu>
>>>wrote:
>>>
>>>>FGENESH is not a heavily used tool, so depending on which version it is
>>>>(either too old or too new), output might be slightly different which
>>>>could cause incorrect parsing. Could you tar up your maker.output
>>>>folder,
>>>>and send it to http://weatherby.genetics.utah.edu/cgi-bin/mwas/bug.cgi
>>>>(send me either your user/guest ID after you upload).
>>>>
>>>>For the BLAST error, use BLAST+ instead.  You are using blastall which
>>>>is
>>>>the old legacy version of NCBI BLAST.  You can do this by setting the
>>>>blast type in maker_bopts.ctl and the location of executables in
>>>>maker_exe.ctl.
>>>>
>>>>Thanks,
>>>>Carson
>>>>
>>>>
>>>>
>>>>On 3/12/14, 11:58 AM, "Borhan, Hossein" <Hossein.Borhan at AGR.GC.CA>
>>>>wrote:
>>>>
>>>>>Dear Maker users
>>>>>
>>>>>
>>>>>I ran maker (2.31) on a fungal genome and found out that it inserted
>>>>>the
>>>>>word SCLAR   followed by a pair of bracket like this (0x22de7020)
>>>>>inserted in the nucleotide sequence of some of the genes. This seems
>>>>>to
>>>>>be related to transcripts predicted by fgenesh_masked.
>>>>>
>>>>>
>>>>>Here is an example for one of the genes
>>>>>
>>>>>
>>>>>>fgenesh_masked-scaffold00087-processed-gene-3.142-mRNA-1 transcript
>>>>>>offset:0 AE
>>>>>D:0.01 eAED:0.00 QI:0|1|0.85|1|0.5|0.42|7|144|651
>>>>>ATGCGTTACTCCCAGATCTTTGGCAGTGCTGCTGCGCTTGTTGGCTCTGSCALAR(0x23
>>>>>418b90)SCALAR(0x244c8ca0)GCTTTGGGGCGTGGAGAACAGTGGTGACGACTTCA
>>>>>AGCGCAACGGCAAAGACATTCACATGAACAACCCCGGCGAGAAAATCCATTACATGGGCG
>>>>>ATGTCACCAAGCCAAATGACAACTGGTATGGATATCCTACCTGCTTCACTGTCTGGCAAC
>>>>>CCAGTGACTTCACCGACAAAACCTTCAAGGTCGGCGACTGGTTCGTGCAAGCACCCACTT
>>>>>CTTCCTTTGGCGACGAAACATGCAGTCAGCGGGCCACCGCACCCAAGCTCACCCTGTTTC
>>>>>CTCACTCTGCACCCATTGATTGCAAGTTCGATGCCGAGAGTACGACCATGTACATTACCT
>>>>>ATCATGGTAGCTGGAACCGCTCGCCCGTCACGGGCTTCAAGCTCGTCGCTGTGCAGTTTA
>>>>>AGCTTGGCGCTGATGGCCAGTATACGCCTGTCGAGCCGCTTACCAGCACAACCGCGGCCA
>>>>>AGGATATCTTTTACAATCCGAGGGTGGAGAGCTGTCAGGGTAATGGCCCGGGATTCAGCT
>>>>>CGGGTTGCTTCAGACCTGCAGGCTTGGCATGGGATCCCCAGGGTCGGTTGATCATGACGT
>>>>>CGGATACATCGAGCAATGGTGAGCTGTGGATCTTGGGTACATCTTGAATGACATGTCAGC
>>>>>AAGGCAGAAGGTAAGTAGTGGATGCCGTTGGAGGAAGTTTGTAAATACAGTGATGCAATG
>>>>>CCACGGTCGTTCTCTTTTTGCGGTGCTGGCCAGGATAACAAGGTCAATTGACTTTGGATG
>>>>>TTTCGACAAGC
>>>>>
>>>>>The same genome sequence was used for the first round of maker (2.10)
>>>>>without such problem. I checked the sequence for the scaffold related
>>>>>to
>>>>>one of the affected transcripts and there was no error in the
>>>>>sequence.
>>>>>I am not sure what is causing this. The only error that I could spot
>>>>>in
>>>>>the output error file is the following
>>>>>
>>>>>
>>>>>[blastall] FATAL ERROR:  search cannot proceed due to errors in all
>>>>>contexts/frames of query sequences.
>>>>>
>>>>>
>>>>>
>>>>>Your help is appreciated
>>>>>
>>>>>
>>>>>
>>>>>HB
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>
>>>
>>
>