[maker-devel] non-nucleotide characters in the maker generated transcripts

[Carson Holt]

Thanks for letting me know.

--Carson


On 3/21/14, 10:41 AM, "Borhan, Hossein" <Hossein.Borhan at AGR.GC.CA> wrote:

>Dear Carson
>
>I ran maker and modified .pm files and it resolved the problem with the
>fasta output. Thanks a lot for your help.
>
>
>
>
>HB
>
>
>
>
>
>
>
>
>On 14-03-17 1:45 PM, "Carson Holt" <carson.holt at genetics.utah.edu> wrote:
>
>>I have attached 4 files for you to place in the .../maker/Widgets/
>>directory.
>>
>>The *blast.pm files will suppress the BLAST+ failures you are getting
>>(alternatively you can just downgrade to BLAST 2.27 to get the same
>>effect).  BLAST 2.29 gives a lot of warnings etc., which you can ignore.
>>In the latest release NCBI redid all their warnings and error codes so it
>>spits out a lot of garbage and fails with different messages than it did
>>before.  For example BLAST now warns you every time it encounter a fasta
>>header with a comment (virtually every fasta entry in existence falls in
>>this category), so your screen will be awash with meaningless warning
>>messages.
>>
>>The fgenesh.pm file will fix the other failure, which only occurs if you
>>use fgenesh simultaneously with the est_fustion=1 option.  No other
>>predictors are affected.
>>
>>Thanks,
>>Carson
>>
>>
>>On 3/14/14, 5:14 PM, "Borhan, Hossein" <Hossein.Borhan at AGR.GC.CA> wrote:
>>
>>>Dear  Carson
>>>
>>>Sorry for the late reply. I was away for a couple of days. I have
>>>uploaded
>>>the out put files plus control and error output on the FTP site that you
>>>provided
>>>The user ID is borhanh
>>>
>>>I used blast+ for this run.
>>>
>>>
>>>
>>>
>>>Regards
>>>
>>>
>>>HB
>>>
>>>
>>>
>>>
>>>
>>>
>>>
>>>
>>>On 14-03-13 10:00 AM, "Carson Holt" <carson.holt at genetics.utah.edu>
>>>wrote:
>>>
>>>>Just resending this to the correct maker-devel address.  Please when
>>>>replying, do not CC the incorrect maker-devel-bounce address.
>>>>
>>>>Thanks,
>>>>Carson
>>>>
>>>>
>>>>On 3/13/14, 9:56 AM, "Carson Holt" <carson.holt at genetics.utah.edu>
>>>>wrote:
>>>>
>>>>>FGENESH is not a heavily used tool, so depending on which version it
>>>>>is
>>>>>(either too old or too new), output might be slightly different which
>>>>>could cause incorrect parsing. Could you tar up your maker.output
>>>>>folder,
>>>>>and send it to http://weatherby.genetics.utah.edu/cgi-bin/mwas/bug.cgi
>>>>>(send me either your user/guest ID after you upload).
>>>>>
>>>>>For the BLAST error, use BLAST+ instead.  You are using blastall which
>>>>>is
>>>>>the old legacy version of NCBI BLAST.  You can do this by setting the
>>>>>blast type in maker_bopts.ctl and the location of executables in
>>>>>maker_exe.ctl.
>>>>>
>>>>>Thanks,
>>>>>Carson
>>>>>
>>>>>
>>>>>
>>>>>On 3/12/14, 11:58 AM, "Borhan, Hossein" <Hossein.Borhan at AGR.GC.CA>
>>>>>wrote:
>>>>>
>>>>>>Dear Maker users
>>>>>>
>>>>>>
>>>>>>I ran maker (2.31) on a fungal genome and found out that it inserted
>>>>>>the
>>>>>>word SCLAR   followed by a pair of bracket like this (0x22de7020)
>>>>>>inserted in the nucleotide sequence of some of the genes. This seems
>>>>>>to
>>>>>>be related to transcripts predicted by fgenesh_masked.
>>>>>>
>>>>>>
>>>>>>Here is an example for one of the genes
>>>>>>
>>>>>>
>>>>>>>fgenesh_masked-scaffold00087-processed-gene-3.142-mRNA-1 transcript
>>>>>>>offset:0 AE
>>>>>>D:0.01 eAED:0.00 QI:0|1|0.85|1|0.5|0.42|7|144|651
>>>>>>ATGCGTTACTCCCAGATCTTTGGCAGTGCTGCTGCGCTTGTTGGCTCTGSCALAR(0x23
>>>>>>418b90)SCALAR(0x244c8ca0)GCTTTGGGGCGTGGAGAACAGTGGTGACGACTTCA
>>>>>>AGCGCAACGGCAAAGACATTCACATGAACAACCCCGGCGAGAAAATCCATTACATGGGCG
>>>>>>ATGTCACCAAGCCAAATGACAACTGGTATGGATATCCTACCTGCTTCACTGTCTGGCAAC
>>>>>>CCAGTGACTTCACCGACAAAACCTTCAAGGTCGGCGACTGGTTCGTGCAAGCACCCACTT
>>>>>>CTTCCTTTGGCGACGAAACATGCAGTCAGCGGGCCACCGCACCCAAGCTCACCCTGTTTC
>>>>>>CTCACTCTGCACCCATTGATTGCAAGTTCGATGCCGAGAGTACGACCATGTACATTACCT
>>>>>>ATCATGGTAGCTGGAACCGCTCGCCCGTCACGGGCTTCAAGCTCGTCGCTGTGCAGTTTA
>>>>>>AGCTTGGCGCTGATGGCCAGTATACGCCTGTCGAGCCGCTTACCAGCACAACCGCGGCCA
>>>>>>AGGATATCTTTTACAATCCGAGGGTGGAGAGCTGTCAGGGTAATGGCCCGGGATTCAGCT
>>>>>>CGGGTTGCTTCAGACCTGCAGGCTTGGCATGGGATCCCCAGGGTCGGTTGATCATGACGT
>>>>>>CGGATACATCGAGCAATGGTGAGCTGTGGATCTTGGGTACATCTTGAATGACATGTCAGC
>>>>>>AAGGCAGAAGGTAAGTAGTGGATGCCGTTGGAGGAAGTTTGTAAATACAGTGATGCAATG
>>>>>>CCACGGTCGTTCTCTTTTTGCGGTGCTGGCCAGGATAACAAGGTCAATTGACTTTGGATG
>>>>>>TTTCGACAAGC
>>>>>>
>>>>>>The same genome sequence was used for the first round of maker (2.10)
>>>>>>without such problem. I checked the sequence for the scaffold related
>>>>>>to
>>>>>>one of the affected transcripts and there was no error in the
>>>>>>sequence.
>>>>>>I am not sure what is causing this. The only error that I could spot
>>>>>>in
>>>>>>the output error file is the following
>>>>>>
>>>>>>
>>>>>>[blastall] FATAL ERROR:  search cannot proceed due to errors in all
>>>>>>contexts/frames of query sequences.
>>>>>>
>>>>>>
>>>>>>
>>>>>>Your help is appreciated
>>>>>>
>>>>>>
>>>>>>
>>>>>>HB
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>
>>>>
>>>
>>
>
>
>_______________________________________________
>maker-devel mailing list
>maker-devel at box290.bluehost.com
>http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org