[maker-devel] Using multiple protein profiles as queries for prediction in intergenic regions?

[Anand K S Rao]

Greetings!

I am exploring the use of MAKER-P. But I need your advice in determining if
MAKER-P is the best choice for me.

In the recent past, I've tried using the AUGUSTUS --profile option which
allows for user defined protein profiles to be used as query.

I am interested in predicted gene-like structures in intergenic regions
(I've masked away genic regions as predicted by genome annotation pipeline)
- in some orphan legume plant species - so not much in the way of extrinsic
/ external data in the way of EST, NGS data - let alone extrinsic data that
might map to so called intergenic regions i.e. whatever little data there
exists, has been already used to predict 'genes'.

When I tried using --profile option of AUGUSTUS, I was not satisfied with
the frequency and magnitude of fusion genes. Additionally, there was no
easy way for me to consolidate gene-like structures that varied, but
overlapped when using different protein profiles as queries (one profile
per Pfam HMM within a 4 member clan).

Additionally, training all the orphan legume species is not an exciting
undertaking... because of time and computing resource requirements.

All this led me to consider MAKER-P as an option. Based on what I've
described above, do you think I should proceed with trying to use MAKER-P
for my purposes?

Thank you, in advance.

Sincerely,
Anand



-- 
Anand K.S. Rao  PhD candidate, Plant Biology <http://www-plb.ucdavis.edu/>
with a Designated Emphasis in Biotechnology <http://deb.ucdavis.edu/>,
UC- Davis <http://ucdavis.edu/>,  CA - 95616 USA   |   aksrao at ucdavis.edu
 |   (530) 574-5134   |   LinkedIn <http://www.linkedin.com/in/anandksrao>
_________________________________________________________________________
  CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT - translate THAT!
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20140925/cb124355/attachment-0002.html>