[maker-devel] Fwd: Errors with Blast engine and Fasta index

[Isabel Marcelino]

Hi Daniel,
Thank you for your feedback. In fact, my fasta entry is not empty (please 
see below). I even tried to reprocess the genome fasta file that I already 
processed using MAKER and it doesn't work either...
Isabel

(PS: I do not manage to "reply" your message but only "forward" it. I was 
wondering if there are any settings I should change? I participate in other 
google groups and I can "reply" to messages. Thanks for the help)

 (>NODE_1_length_465927_cov_94.9908
ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA
ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT
CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA
AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC
CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC
AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC
AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG
ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG
ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT
GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....)


On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote:
>
> Hi Isabel, The warning is referring to an empty entry in one of the fasta 
> files (“Warning: Sequence contains no data”). This is probably in the 
> genome fasta file that you are trying to annotate. Can you check the fasta 
> entry “NODE_1_length_465927_cov_94.9908”?  
>
> ~Daniel
>
>
>
> On Aug 23, 2017, at 12:29 PM, Isabel Marcelino <isabel.ma... at gmail.com 
> <javascript:>> wrote:
>
>
> ---------- Forwarded message ----------
> From: Isabel Marcelino <isabel.ma... at gmail.com <javascript:>>
> Date: 23 August 2017 at 11:37
> Subject: Errors with Blast engine and Fasta index
> To: maker... at googlegroups.com <javascript:>
>
>
> Hello,
>
> I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) 
> running smoothly a few weeks ago and I could perform a de novo annotation 
> of one of my genome. In the meantime, I worked on other topics and, 
> yesterday, when I tried to annotate another genome, MAKER was not working. 
> The following message was appearing:
>
> BLAST engine error: Warning: Sequence contains no data 
> deleted:0 hits
> stop here: NODE_1_length_465927_cov_94.9908
> ERROR: Fasta index error
> at 
> /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm 
> line 1095.
>         Process::MpiChunk::__ANON__() called at 
> /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm 
> line 415
>         eval {...} called at 
> /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm 
> line 407
>         Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at 
> /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm 
> line 4224
>         Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 
> 'HASH(0x4cca458)', 3, 0) called at 
> /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm 
> line 341
>         Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) 
> called at ../../bin/maker line 1614
>         main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999
> --> rank=2, hostname=SRV-WGS
> ERROR: Failed while preparing masked sequence
> ERROR: Chunk failed at level:3, tier_type:0
> FAILED CONTIG:NODE_1_length_465927_cov_94.9908
>
> I tried to solve the problem (re-install Repeatmasker and blast, check 
> location of the several executables, check tmp folder, re-install MAKER, 
> etc) but still, I am not able to solve the problem.
> Could you please help me out with this? Thank you so much.
>
> Cheers,
> Isabel 
>
> *************************************************
> Isabel MARCELINO, PhD
> Unité Environnement Santé
> Institut Pasteur de Guadeloupe
> Morne Jolivière - B.P. 484
> 97183 LES ABYMES Cedex
> Guadeloupe, FWI
>
>
>
>
> <https://www.avast.com/sig-email?utm_medium=email&utm_source=link&utm_campaign=sig-email&utm_content=webmail> Garanti 
> sans virus. www.avast.com 
> <https://www.avast.com/sig-email?utm_medium=email&utm_source=link&utm_campaign=sig-email&utm_content=webmail> 
> _______________________________________________
> maker-devel mailing list
> maker... at box290.bluehost.com <javascript:>
> http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org
>
>
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20170823/24095bce/attachment-0003.html>