[maker-devel] Errors with Blast engine and Fasta index

[Ence,daniel]

Hi Isabel, if the issue isn’t with the fasta file itself, then I would look into the things that Carson suggested: out of memory issues on the disk where the TMP directory is located, etc.

~Daniel


On Aug 23, 2017, at 1:38 PM, Isabel Marcelino <isabel.marcelino.im at gmail.com<mailto:isabel.marcelino.im at gmail.com>> wrote:

Hi Daniel,
Thank you for your feedback. In fact, my fasta entry is not empty (please see below). I even tried to reprocess the genome fasta file that I already processed using MAKER and it doesn't work either...
Isabel

(PS: I do not manage to "reply" your message but only "forward" it. I was wondering if there are any settings I should change? I participate in other google groups and I can "reply" to messages. Thanks for the help)

 (>NODE_1_length_465927_cov_94.9908
ACAAATCAATGTCGTTCAATTCAACATTTTCGATATGAGAACATTAAACAATTCAACATA
ATCGAGCAGAATTGATTTTCTCAACAATTTCTTATCAATTTTGCTCGAAAAAATCGATTT
CCACATGGTAAAAGCAACGCAACATCGATTCACAAACGATGAAAGACGAGTTTTCAAACA
AAAAACAGGTGTCCAAATATCTCAAAAACTAAGACCATATATCCAAGGTCAAAAATTAGC
CCCAGAACAAATTGAGTTCATTAAATTGGTGTGTGGAAAGTATGGAGAGTGTGTTTTGGC
AAAGCCCATACTCTCCTGACTTCAATCCCATTGAATTGCTTTTCGGATGGATGAAAACAC
AGTTGAAAAACTATGAACATTCGGTTGACTCTCTCGAAGAGATAATGGAGCAGGTGTTTG
ATCAAGTTACACCCAAGTTAATCAAATCGTTTGTTCATCATTGCAAGGAAATCTGGCATG
ATGAGACAAAAACTTAATAAATTTCGAGTTTGATCGAAATCGATTTTGAAGGATTTCGAT
GTTAATCAACATCAAGTCAAAACGACAACGCATCAATGTCGCTCATTTCGATC.....)


On Wednesday, 23 August 2017 12:58:21 UTC-4, Ence,daniel wrote:
Hi Isabel, The warning is referring to an empty entry in one of the fasta files (“Warning: Sequence contains no data”). This is probably in the genome fasta file that you are trying to annotate. Can you check the fasta entry “NODE_1_length_465927_cov_94.9908”?

~Daniel



On Aug 23, 2017, at 12:29 PM, Isabel Marcelino <isabel.ma... at gmail.com<javascript:>> wrote:


---------- Forwarded message ----------
From: Isabel Marcelino <isabel.ma... at gmail.com<javascript:>>
Date: 23 August 2017 at 11:37
Subject: Errors with Blast engine and Fasta index
To: maker... at googlegroups.com<javascript:>


Hello,

I am new to linux and bioinformatics but I managed to set MAKER (v2.31.9) running smoothly a few weeks ago and I could perform a de novo annotation of one of my genome. In the meantime, I worked on other topics and, yesterday, when I tried to annotate another genome, MAKER was not working.
The following message was appearing:

BLAST engine error: Warning: Sequence contains no data
deleted:0 hits
stop here: NODE_1_length_465927_cov_94.9908
ERROR: Fasta index error
at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 1095.
        Process::MpiChunk::__ANON__() called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 415
        eval {...} called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Error.pm line 407
        Error::subs::try('CODE(0x4cd5320)', 'HASH(0x4cd53f8)') called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 4224
        Process::MpiChunk::_go('Process::MpiChunk=HASH(0x4cfae20)', 'run', 'HASH(0x4cca458)', 3, 0) called at /home/administrateur/results/Isa/ANNOTATION/MAKER_running_tools/RUN_MAKER/bin/../lib/Process/MpiChunk.pm line 341
        Process::MpiChunk::run('Process::MpiChunk=HASH(0x4cfae20)', 2) called at ../../bin/maker line 1614
        main::run('ARRAY(0x4af3e68)', 2) called at ../../bin/maker line 999
--> rank=2, hostname=SRV-WGS
ERROR: Failed while preparing masked sequence
ERROR: Chunk failed at level:3, tier_type:0
FAILED CONTIG:NODE_1_length_465927_cov_94.9908

I tried to solve the problem (re-install Repeatmasker and blast, check location of the several executables, check tmp folder, re-install MAKER, etc) but still, I am not able to solve the problem.
Could you please help me out with this? Thank you so much.

Cheers,
Isabel

*************************************************
Isabel MARCELINO, PhD
Unité Environnement Santé
Institut Pasteur de Guadeloupe
Morne Jolivière - B.P. 484
97183 LES ABYMES Cedex
Guadeloupe, FWI



[https://lh6.googleusercontent.com/proxy/JjzEPM_1UQiAcgcIii9zH3waHJfrDmD6mwOpzjvKSWAzeFyvEmJKxjsfyB4-JKbN4o_rmMG0O6UuV95TfuAG3NaBCtKzucfHCUODobStNrGqQJzTwuEOKfxUSFySxNn_igewCYnfXbgJP-gAq2cupOvC=w5000-h5000]<https://www.avast.com/sig-email?utm_medium=email&utm_source=link&utm_campaign=sig-email&utm_content=webmail>     Garanti sans virus. www.avast.com<https://www.avast.com/sig-email?utm_medium=email&utm_source=link&utm_campaign=sig-email&utm_content=webmail>
_______________________________________________
maker-devel mailing list
maker... at box290.bluehost.com<javascript:>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

_______________________________________________
maker-devel mailing list
maker-devel at box290.bluehost.com<mailto:maker-devel at box290.bluehost.com>
http://box290.bluehost.com/mailman/listinfo/maker-devel_yandell-lab.org

-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20170823/8f404c2b/attachment-0003.html>