[maker-devel] failed to assign putative gene function

[Quanwei Zhang]

I just found at the bottom of the output file it include information like
below. But I did not get those GFF3 files with gene homolog information
added.

>snap_masked-CasCan_contig_27993-processed-gene-0.6-mRNA-1 transcript
Name:"Protein of unknown function" offset:0 AED:0.47 eAED:0.47
QI:0|0|0|1|1|1|2|0|84
ATGAAAGACATTGGTACCCCAGAGGCATGGCAGATAATGATGTCCCTCAAGTCTGGACTC
TTGGCAGAGATCACATGGGCTTTAGACACCATTAACATTCTACTGTATGATGACAGCAGC
ATTATGACCTTCAACCTCAGTCAGTTCCCAGGATTGCTAGAGCTCTTTGAGTATGAGGTG
GGTGACCGAAGACAGAGAACTCTACTGGACTCTGGGAGATTCAGTGAAGTGTCTGGTCCA
ACCCCTACAGAG

Thanks

Best
Quanwei

2017-02-13 10:16 GMT-05:00 Quanwei Zhang <qwzhang0601 at gmail.com>:

> Hello:
>
> I am trying to add putative gene function to the predicted gene models.
> Firstly, I use uniProt/Swiss-Prot protein sequences to build the database.
> I used canonical and isoform proteins of human, mouse and rat with the
> script "makeblastdb". Then use "blastp" generated "maker2uni.blastp" whose
> context is as below.
> maker-CasCan_contig_64815-snap-gene-0.0-mRNA-1    sp|Q6P5S2|LEG1H_HUMAN
>  69.97    303    91    0    1    303    1    303    7e-164    464
> snap_masked-CasCan_contig_14203-processed-gene-0.10-mRNA-1
>  sp|Q91ZA8|NRARP_MOUSE    99.12    114    1    0    1    114    1    114
>  3e-80    236
>
> After that, I am trying to add the protein homology data to the Maker gff3
> and fasta files with maker_functional_gff and maker_functional_fasta, but
> get the reports as below.
>
> Can't parse details from FASTA header: >sp|Q7Z5M8-2|AB12B_HUMAN Isoform 2
> of Protein ABHD12B OS=Homo sapiens GN=ABHD12B
>
> Use of uninitialized value $id in hash element at
> /public/apps/MAKER/2.31.9/bin/maker_functional_gff line 139, <$IN> line
> 39.
> Use of uninitialized value $id in hash element at
> /public/apps/MAKER/2.31.9/bin/maker_functional_gff line 141, <$IN> line
> 39.
> Can't parse details from FASTA header: >sp|Q7Z5M8-4|AB12B_HUMAN Isoform 4
> of Protein ABHD12B OS=Homo sapiens GN=ABHD12B
>
> Use of uninitialized value $id in hash element at
> /public/apps/MAKER/2.31.9/bin/maker_functional_gff line 139, <$IN> line
> 45.
> Use of uninitialized value $id in hash element at
> /public/apps/MAKER/2.31.9/bin/maker_functional_gff line 141, <$IN> line
> 45.
> Can't parse details from FASTA header: >sp|Q7Z5M8-5|AB12B_HUMAN Isoform 5
> of Protein ABHD12B OS=Homo sapiens GN=ABHD12B
> .....
>
> I am not sure how to deal with this. I followed the command given in the
> protocol. Any suggestions?
>
> Thanks
>
> Best
> Quanwei
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://yandell-lab.org/pipermail/maker-devel_yandell-lab.org/attachments/20170213/de6504f3/attachment-0002.html>